CN115887660A - Application of inhibitor of Hsa _ circ _0136666 in preparation of tumor immunopotentiator - Google Patents

Abstract

The invention belongs to the field of biomedicine, and relates to application of an inhibitor of hsa _ circ _0136666 in preparation of a tumor immunopotentiator, which is characterized in that: the inhibitor is one or more of antisense oligonucleotide, siRNA, shRNA, aptamer and transcription activation RNA of targeted hsa _ circ _ 0136666. Experiments further prove that the over-expression hsa _ circ _0136666 can obviously promote the generation of tumor immune escape phenomenon, promote the abnormal increase of cells TAM, treg and MDSCs in a tumor region and obviously reduce the down-regulation of CD4+ and CD8+ T cells. It is suggested that inhibitors that reduce the expression of hsa _ circ _0136666 can be used as tumor immunopotentiators for the treatment of gastric cancer.

Description

Application of inhibitor of Hsa _ circ _0136666 in preparation of tumor immunopotentiator

Technical Field

The invention belongs to the field of biomedicine, and relates to application of an inhibitor of hsa _ circ _0136666 in preparation of a tumor immunopotentiator.

Background

Gastric Cancer (GC) is the second leading cause of cancer death worldwide, and since gastric cancer is often diagnosed in the late stage, the mortality rate is very high, about 770,000 people die in 2020, and china alone accounts for more than half of the global disease burden. Early gastric cancer is either asymptomatic or has only mild symptoms. When clinical symptoms are evident, the lesions are already in the advanced stage. The main clinical scheme of first-line chemotherapy for treating advanced gastric cancer comprises oxaliplatin combined with fluorouracil drugs, and the targeted drug is trastuzumab (aiming at HER2 positive patients), but due to off-target effect and tumor immune escape mechanism, the effect of the targeted drug on prolonging the life cycle of patients reaches a bottleneck. Therefore, new strategies and methods for treating gastric cancer are urgently sought.

Immune escape generally refers to the immune suppression of pathogens, through other structural and non-structural products, block and suppress the body's immune response. The primary mode of immune evasion from tumor immunity is associated with T cells. Activation of T cells is associated with activation and inhibition of the checkpoint signaling pathway. The direct inhibition of T cell action is achieved by upregulation of CTLA-4, PD1 ligand-receptor interactions. During the formation of tumor, tumor cells can change and maintain the conditions of self survival and development through autocrine and paracrine, promote the growth and development of tumor, and the micro system for promoting the growth is called tumor microenvironment, which is an indirect way of inhibiting the anti-tumor T cell response. By combined administration and the assistance of a checkpoint inhibitor, the immune escape phenomenon can be avoided to a great extent, and the activity and the effect of the anti-cancer medicament are enhanced.

The small nucleic acid drugs are also called RNAi (RNA interference) technology drugs. The small nucleic acid medicine is a completely different and novel medicine category from small molecule medicine and antibody medicine, the medicine is composed of nucleotide sequence, the medicine mechanism is acting on mRNA, and the expression of target protein is inhibited through gene silencing, thus realizing the purpose of treating diseases. The small nucleic acid drug range covers siRNA, miRNA, antisense nucleic acid and the like. In principle, RNA interference can be used to treat any disease associated with elevated expression of an identified gene, including the treatment of viral diseases, cancer and inflammatory diseases.

Circular RNAs (circRNAs) are endogenous biomolecules with covalently closed valences in eukaryotes, and belong to noncoding RNAs. They arise from an unconventional splicing program called "reverse splicing", in which a downstream splice donor site is covalently linked to an upstream splice acceptor site. Circular RNA is abundant and evolutionarily conserved, and its biogenesis is regulated by specific cis-acting elements and trans-acting factors, with tissue-and cell-specific expression patterns. Key physiological functions of circRNA include mirrnange ("sponge"), transcriptional regulators, and binding to RNA binding proteins, by modulating protein function or encoding cryptic peptides to exert important biological functions. Studies have shown that hsa _ circ _0136666 is linked to abnormal growth of tumor, but related studies do not provide circular RNA related immune mechanism, how to cause T cell inactivation and immune escape.

Disclosure of Invention

The invention firstly provides the application of the hsa _ circ _0136666 inhibitor in the preparation of the anti-tumor immune escape medicine, namely the inhibitor can inhibit the tumor immune escape phenomenon; the related immune escape mechanism of hsa _ circ _0136666 in gastric cancer is disclosed for the first time, and hsa _ circ _0136666 mediates tumor immune escape through miR-375/PRKDC/PD-L1 signal axis.

The specific technical scheme of the invention is as follows:

the application of the inhibitor of hsa _ circ _0136666 in preparing the tumor immunopotentiator, wherein the cDNA nucleotide sequence of hsa _ circ _0136666 is shown in SEQ ID NO:1, and the specific information is as follows: GCAATTTATCATCTCAAGTTCCCCTTAAGAGACTTCTGAACACCTGGACAAACAGATATCCAGATGCTAAAATGGACCCAATGAACATCTGGGATGACATCATCACAAATCGATGTTTCTTTCTCAGCAAAATAGAGGAGAAGCTTACCCCTCTTCCAGAAGATAATAGTATGAATGTGGATCAAGATGGAGACCCCAGTGACAGGATGGAAGTGCAAGAGCAGGAAGAAGATATCAGCTCCCTGATCAGGAGTTGCAAGTTTTCCATGAAAATGAAGATGATAGACAGTGCCCGGAAGCAGAACAATTTCTCACTTGCTATGAAACTACTGAAGGAGCTGCATAAAGAGTCAAAAACCAGAGACGATTGGCTGGTGAGCTGGGTGCAGAGCTACTGCCGCCTGAGCCACTGCCGGAGCCGGTCCCAGGGCTGCTCTGAGCAGGTGCTCACTGTGCTGAAAACAGTCTCTTTGTTGG (SEQ ID NO. 1).

Preferably, the inhibitor is one or more of antisense oligonucleotide, siRNA, shRNA, aptamer and transcription activation RNA which target hsa _ circ _ 0136666.

Preferably, the siRNA nucleotide sequence is as follows:

sense strand: 5 'GUUGGGCAAUUUAUCAUUCAUdTdT 3' (SEQ ID NO. 2). Antisense strand: 5 'UGAGAUGAUAAAUUGCCAACdTdT 3' (SEQ ID NO. 3).

Preferably, the nucleotide sequence of the shRNA is as follows:

5’GTTGGGCAATTTATCATCTCA3’(SEQ ID No:6)。

preferably, the inhibitor is combined with a PD-1 inhibitor, a PDL1 inhibitor or a conventional anti-tumor medicament, such as a chemical medicament, paclitaxel and the like, so that the expression of PD-1 or PDL1 is reduced, the tumor immune escape is reduced, the action mechanism of the inhibitor is different from that of the conventional anti-tumor medicament, and the inhibitor is a tumor immune enhancer of the anti-tumor medicament.

Preferably, the medicament further comprises a gene drug delivery system.

Preferably, the tumor is liver cancer, lung cancer, colorectal cancer, gastric cancer or breast cancer.

The action principle is as follows:

as shown in FIG. 9, the mechanism pathway diagram of tumor immunopotentiation disclosed, namely hsa _ circ _0136666 function mechanism diagram, is hsa _ circ _0136666/miR-375/PRKDC/PD-L1 signal axis: hsa _ circ _0136666 is combined with miR-375 in a tumor cell through base complementary pairing, the function of miR-375 degrading target gene PRKDCmRNA through 3' UTR is inhibited, PRKDC transcription up-regulation increases DNAPK protein expression, the interaction between DNAPK and PD-L1 protein is influenced, the PD-L1 protein stability is enhanced, PD-L1 aggregation on the surface of the tumor cell is caused, over-expression of PD-L1 on the surface of the tumor can cause T cell immune suppression and down-regulation of immune response, and the tumor immune escape phenomenon is caused.

The invention proves that hsa _ circ _0136666 is generally highly expressed in tumor tissues and tumor cell lines and is related to the malignancy degree of tumors through fluorescence in situ hybridization experiments and qRT-PCR experiments; CCK-8 experiments prove that the over-expression hsa _ circ _0136666 promotes the proliferation of tumor cells, and the knocking-down inhibits the proliferation, but the anti-tumor effect is general; the Westernblot experiment proves that the overexpression hsa _ circ _0136666 up-regulates the expression of the PD-L1 protein level; luciferase experiments and RIP experiments prove that base complementary pairing sequences exist between hsa _ circ _0136666 and miR-375, and between miR-375 and PRKDC3' UTR; through a xenograft tumor experiment, the fact that the slow virus over-expression hsa _ circ _0136666 can obviously promote tumor growth is proved, and tumor growth is inhibited through knocking down; enzyme-linked immunosorbent assay proves that the knockdown hsa _ circ _0136666 carcinogen-promoting factor expression is obviously reduced; flow cytometry experiments prove that over-expression of hsa _ circ _0136666 promotes proliferation of immunosuppressive cells (TAM, treg, MDSCs), and CD3+ CD4+/CD3+ CD8+ T cells are remarkably reduced, indicating that immune escape occurs.

Advantageous effects

The invention discloses the technical problems that hsa _ circ _0136666 is abnormally highly expressed in late gastric cancer tissues, the hsa _ circ _0136666 is over-expressed to promote tumor cell proliferation, and proliferation is inhibited when the hsa _ circ _ 3242 is knocked down, but the anti-tumor effect is not enough to be developed as an anti-tumor drug, and the anti-tumor drug generates drug resistance or does not work in the tumor treatment process, particularly in the middle and late stages of tumor occurrence, no good method is provided for improving the tumor treatment process at present, the generation of immune escape is prevented or inhibited by changing different drugs clinically, but the same result is generated finally, how to search for reasons from the source to improve the tumor microenvironment and reduce the risk of immune escape are difficult to solve in the field.

The invention provides a tumor immune escape mechanism for the first time, namely hsa _ circ _0136666/miR-375/PRKDC/PD-L1. Experiments prove that the over-expression has _ circ _0136666 can obviously promote the generation of tumor immune escape phenomenon, promote abnormal increase of TAM, treg and MDSCs cells in tumor regions and obviously reduce the reduction of CD4+ and CD8+ T cells. It is suggested that an inhibitor which reduces the expression of hsa _ circ _0136666 can be used as a tumor immunopotentiator or an adjuvant for the treatment of gastric cancer.

Drawings

FIG. 1: FIG. 1A shows a normal tissue distribution map of hsa _ circ _0136666, FIG. 1B shows a normal tissue distribution map of hsa _ circ _0136666 in situ, FIG. 1C shows a normal tissue distribution map of hsa _ circ _0136666 in situ, FIG. 1D shows a normal tissue distribution map of hsa _ circ _0136666 in metastasis

FIG. 2: differential expression maps of hsa _ circ _0136666 in different cell lines

FIG. 3: FIG. 3A is a graph of the efficiency of lentiviral overexpression 0136666 in MKN-45 cells, FIG. 3B is a graph of siRNA knock-down efficiency on hsa _ circ _0136666 in AGS cells, FIG. 3C is a graph of MKN-45 cell CCK-8 overexpressing hsa _ circ _0136666, FIG. 3D is a graph of AGS cell CCK-8 with hsa _ circ _0136666 knocked down

FIG. 4: FIG. 4A is a western blot diagram showing the difference between the expression of an immune checkpoint protein and an mTOR signaling pathway protein in AGS cells, and FIG. 4B is a western blot diagram showing the difference between the expression of an immune checkpoint protein and an mTOR signaling pathway protein in MKN-45 cells

FIG. 5: FIG. 5A shows the RIP assay of hsa _ circ _0136666 in combination with miR-375, FIG. 5B shows the RIP assay of hsa _ circ _0136666 in combination with miR-375 in combination with luciferase reporter gene, FIG. 5C shows the RIP assay of miR-375 in combination with PRKDCmRNA, and FIG. 5D shows the RIP assay of miR-375 in combination with PRKDCmRNA in combination with luciferase reporter gene.

FIG. 6: FIG. 6A is a photograph of Balb/cNude overexpression hsa _ circ _0136666 tumor-bearing mice, FIG. 6B is a photograph of a comparison of tumor weights of hsa _ circ _0136666 overexpression tumor-bearing mice, FIG. 6C is a photograph of a tumor-bearing mice with hsa _ circ _0136666 knocked down, and FIG. 6D is a comparison of tumor weights of hsa _ circ _0136666 tumor-bearing mice with hsa _ circ _ 8936 knocked down

FIG. 7: FIG. 7A is a graph showing the difference in IL-6 expression in the tumor infiltration area of Balb/cNude over-expressed hsa _ circ _ 0136666;

FIG. 7B is a graph showing the difference in IL-6 expression in the Balb/cNude knockdown hsa _ circ _0136666 tumor infiltration region; FIG. 7C is a graph showing the difference in TGF- β 1 expression in the Balb/cNude over-expressed hsa _ circ _0136666 tumor infiltration region; FIG. 7D is a graph showing the difference in TGF- β 1 expression in Balb/cNude knockdown hsa _ circ _0136666 tumor infiltration region

FIG. 8: FIG. 8A is a graph of the difference between tumor-infiltrating CD4+ CD8+ T cells in C57BL/C mice overexpressing hsa _ circ _0136666 tumor-bearing mice, FIG. 8B is a graph of the difference between tumor-infiltrating tumor-associated macrophages, FIG. 8C is a graph of the difference between tumor-infiltrating regulatory T cells, and FIG. 8D is a graph of the difference between tumor-infiltrating myeloid-derived immunosuppressive cells (9): hsa _ circ _0136666/miR-375/PRKDC/PD-L1 action mechanism diagram

Detailed Description

The invention is further described below by way of examples, which include the use of materials and specific sources. It should be understood that these are exemplary only, and are not limiting upon the present invention. Materials of similar or identical nature or function to the reagents, types and models of instruments, or the like, as described below, may be used in the practice of the present invention. Unless otherwise indicated, the reagents used in the present invention may be any suitable commercially available reagent.

Example 1 detection of expression of hsa _ circ _0136666 in tissues and cells

1. Tissue sample

The tissue chip is selected from gastric adenocarcinoma tissue chip purchased from Shanghai core Biotechnology Ltd in 2021 of the laboratory, chip number HStmA050Me01, tissue including 21 adenocarcinoma or signet ring cell carcinoma primary focus, cancer side or metastasis slice, and 5 normal partial stomach tissue slices. The collection of all samples for this study was approved by the hospital ethics committee and informed consent was obtained from the patients.

2. Fluorescence in situ hybridization experiment

(1) Fixed and transparent

a, fixing 10mins in 4% paraformaldehyde at room temperature;

1XPBS cleaning for 5mins for 3 times;

c. 1mL of precooled TritonX-100,4 ℃ is added into each hole and stands for 5mins at the temperature of 5363 ℃;

d. after discarding TritonX-100, adding 1XPBS to clean 5mins for 3 times;

e. pre-hybridization: sufficient RNA hybridization buffer was added to cover the chip and incubated at 55 ℃ for 2h.

(2) Probe denaturation and light resistance

a. The probe was diluted with hybridization buffer at a dilution ratio of 1:50-200, and the common proportion is 1:100. the diluted probe working solution is denatured for 5mins at 85 ℃;

b. the probe working solution was incubated at 37 ℃ for 2mins.

(3) Hybridization light avoidance

a. Wiping off the hybridization buffer solution of the prehybridization;

b. adding the denatured probe working solution;

c. immediately cover the coverslip gently to allow the probe working fluid to completely cover the tissue, or cover it with a thin film. Hybridizing the slide in a wet box at 37-42 ℃ overnight;

d. the coverslip was floated off by dropping 2 XSSC, and washed 3 times for 5mins with PBS after lifting the coverslip.

(4) Fluorescent detection light shielding

a. Adding appropriate amount of 3% (v/v) BSA solution to the slices, and incubating at 37 ℃ for 60mins;

b. wiping off 3% of BSA solution;

c. using 1XPBS to make the cover glass fall off, washing the cover glass for 2 times with PBS for 5mins each time, keeping out of the sun, and throwing away residual PBS; d. adding DAPI, and incubating for 5mins at room temperature;

e. spin off DAPI, wash 3 times 1XPBS for 5mins each time, then rinse properly with distilled water;

f. the chip was removed from Kong Zhongxiao under light-shielding conditions, fixed to a slide glass with a sealing agent, and subjected to detection.

3. Cell culture

Gastric cancer cells AGS and MKN-45 are purchased from Wuhan Pronoch company, and normal human gastric mucosal epithelial cells GES-1, gastric cancer cells BGC-823 and MGC-803 are provided by Nanjing medical university laboratory; wherein AGS is cultured in Ham' sF-12 complete medium (Procell, wuhan, china) containing 10% fetal bovine serum, MKN-45 is cultured in RPMI-1640 medium (KeygEN BioTECH, nanjing, china) containing 20% fetal bovine serum (lonsera, shanghai, china), and GES-1, BGC-823 and MGC-803 are cultured in RPMI-1640 medium (KeygENBIOTECH, nanjing, china) containing 10% fetal bovine serum (lonserera, shanghai, china). Cultured at 37 ℃ in a 5% carbon dioxide incubator. The experiment used cells in logarithmic growth phase.

RNA extraction

Tissue RNA is extracted by a TRIZOL method, the whole process is strictly operated without enzyme, and the temperature is kept at low temperature.

(1) Personnel and environment preparation: the experimenter wears the disposable mask and gloves, sprays and wipes the experimental table top, the liquid-transferring gun, the enzyme-free gun head, the 1.5mL enzyme-free EP tube, the 2mL enzyme-free grinding tube and other experimental devices by using 0.1% exogenous RNA enzyme inhibitor.

(2) Preparation of experimental articles: cooling to 4 deg.C with high-speed low-temperature centrifuge, inserting chloroform, isopropanol, anhydrous ethanol and enzyme-free water into ice box or placing in 4 deg.C refrigerator for precooling, and balancing TRIZOL to room temperature.

(3) Cells were pelleted into 1ml of LTRIZOL and lysed for 10min at room temperature.

(4) 200 mul of chloroform is added into each tube, and the mixture is violently shaken for more than 15 seconds and kept stand for 5 to 10 minutes at room temperature. Centrifuge at 12,000rpm for 15min at 4 ℃. During the centrifugation wait a new enzyme-free 1.5ml lep tube can be prepared and labeled.

(5) After centrifugation, the EP tube was gently removed from the centrifugation well and inserted into the EP tube holder in the ice box without shaking the EP tube hard to avoid breaking the liquid layer. The liquid in the tube is observed to be divided into three layers: the upper layer is a colorless aqueous phase layer, namely a layer where the RNA is located; the middle layer is a white membrane-like layer and is a layer where the protein is located; the lowest layer is a pink organic phase layer which mainly contains organic matters such as phenol red, trichloromethane and the like. Suspending in the air with 200 μ L pipette, slowly sucking the upper layer colorless liquid into the marked enzyme-free 1.5mLEP tube, avoiding touching the white protein layer and the lower layer pink liquid, sucking three times, and obtaining 400-500 μ L upper layer water phase liquid.

(6) Add equal volume of pre-chilled isopropanol (ca. 500. Mu.L) to each tube, cap the tube, invert the EP tube upside down, mix gently, and stand at-20 ℃ for 30 minutes.

(7) Centrifuge at 12,000rpm for 15min at 4 ℃. 75% ethanol (absolute ethanol: enzyme-free water = 3:1) was prepared during the centrifugation waiting period, and after the preparation, an ice box was inserted for precooling.

(8) After centrifugation is finished, the supernatant is carefully discarded, 1mL of the prepared 75% ethanol is added into each tube, the tube cover is tightly covered, the EP tube is turned upside down, the tube wall is knocked, so that RNA adhered to the tube bottom floats in liquid, the washing is more sufficient, and organic matter pollution can be reduced.

(9) Centrifuge at 12,000rpm for 3min at 4 ℃.

(10) After the centrifugation is finished, the ceramic white jelly-like precipitate can be seen at the bottom or the side wall of the tube, namely RNA, and after the liquid in the tube is poured, the tube is centrifuged for 3min at the temperature of 4 ℃ and the speed of 12,000rpm again.

(11) Carefully sucking and discarding residual liquid in the tube by using a pipette until the residual liquid is completely sucked out, placing the open EP tube on an EP tube rack for naturally airing, adding a proper amount of enzyme-free water according to the size of a precipitate after the precipitate is semitransparent, and placing the precipitate in a refrigerator at 4 ℃ for half an hour to fully dissolve the enzyme-free water.

(12) And blowing and stirring the mixed RNA solution, detecting the RNA concentration and OD value by using a Nanodrop2000 ultramicro spectrophotometer, and storing the RNA sample at-80 ℃ or directly starting a subsequent experiment.

Reverse transcription of mRNA into cDNA

The experiment was performed using HiScriptIIIRTSuperMixfor (+ gDNAwiper) (R323-01) reverse transcription kit developed by Vazyme, inc., which includes two steps of genomic DNA removal and cDNA synthesis, and the operation was performed according to the kit instructions.

(1) Personnel and environment preparation: the experimenter wears the disposable mask and gloves, sprays and wipes the experimental table top, the liquid-transferring gun, the enzyme-free gun head, the 1.5mL enzyme-free EP tube, the enzyme-free PCR tube and other experimental devices by using 0.1% exogenous RNA enzyme inhibitor.

(2) Preparation of experimental articles: taking out the required reagent in the kit R323-01 from-20 ℃, knocking the tube wall after thawing, uniformly mixing the liquid in the tube, and inserting the tube into an ice box for later use after spotting.

(3) Removal of genomic DNA: the reaction solution was prepared in an enzyme-free PCR tube according to the system shown in Table 1 below.

TABLE 1 reaction System for removing genomic DNA

(4) Mixing the added reagent and sample RNA uniformly, placing the mixture in a PCR instrument after spotting, and reacting according to the following procedures:

①42℃，2min；②4℃，∞。

(5) Reverse transcription reaction: the reverse transcription reaction solution was prepared according to the system shown in Table 2 below.

TABLE 2 reverse transcription reaction System

(6) Mixing the added reagent and sample RNA uniformly, placing the mixture in a PCR instrument after spotting, and reacting according to the following procedures:

①37℃，15min；②85℃，5sec；③4℃，∞。

(7) After the reverse transcription is finished, 20 mu LcDNA stock solution is obtained and stored at the temperature of 80 ℃ below zero, and is taken out when in use, so that repeated freeze thawing is avoided.

6. Real-time fluorescent quantitative PCR reaction

A2 XChamQUniversal SYBRqPCRMastermix kit from Novozam (Vazyme) was used and the procedures were performed with reference to the kit instructions, and Table 3 shows the preparation system of the PCR reaction solution.

TABLE 3 real-time fluorescent quantitative PCR reaction System

(1) Preparation of experimental articles: taking out the 2 XChamQ Universal SYBR qPCR Master Mix, the forward primer, the backward primer and the cDNA from-20 ℃, knocking the tube wall after thawing, mixing the liquid in the tube uniformly, and inserting the tube into an ice box for later use after spotting.

(2) For the same amplified gene, a mixed solution consisting of 2 XChamQ Universal SYBR qPCR Master Mix, a forward primer, a backward primer and enzyme-free water can be prepared according to the amount of the reaction number +1, the mixed solution is uniformly mixed and added into a PCR reaction plate hole according to 9 mu L of each hole, and finally, corresponding templates are respectively added.

(3) After the PCR reaction plate was completely sealed with a sealing plate, the plate was centrifuged at 2,500rpm for 4min at 4 ℃.

(4) And (3) placing the PCR reaction plate in a corresponding module of a fluorescent quantitative PCR instrument, setting the reaction program shown in the following table 4, starting amplification, and detecting the expression of the target gene.

TABLE 4 qRT-PCR reaction procedure

An upstream primer: 5'-CAGAGACGATTGGCTGGTGA-3' as shown in SEQ No. 4;

a downstream primer: R5'-TGATAAATTGCCCAACAAAGAGACT-3' as shown in SEQ No. 5.

(5) Relative quantitative analysis of genes: at the end of the denaturation period of each cycle, the instrument automatically recorded the mean fluorescence value at the last 10% of the previous cycle, which represents the PCR yield at the end of the previous cycle, and accumulated in turn. And after all reactions are finished, obtaining the fluorescence intensity values of all reaction holes, automatically generating an amplification curve chart, and converting the amplification curve chart into data for analysis. We set a threshold in the range where the curve increases exponentially, and perform relative quantitative analysis according to the cycle number, i.e., ct value, that each reaction well undergoes when the fluorescence intensity reaches the threshold. The calculation formula is as follows: relative expression =2^ - Δ Δ Ct (where Δ Ct = target gene Ct value-reference gene Ct value, Δ Δ Ct = experimental group Δ Ct-control group Δ Ct average).

7. As a result:

hsa _ circ _0136666 was highly expressed in clinical gastric and gastric cancer cell lines with the following specific results:

FIG. 1 shows that hsa _ circ _0136666 expression (FITC labeled with green fluorescence) is observed in normal, primary, paracancerous and metastatic foci, and that the primary (Tumor tissue) is expressed in the highest amount compared to normal tissue (normalssue) and the metastatic (Metastasis) is expressed in a lower amount, but still higher amount, than in normal tissue (ad jacent-Tumor). The hsa _ circ _0136666 molecule provided by the invention is abnormally high in expression in gastric cancer tissues, which shows that hsa _ circ _0136666 has better region specificity expression and has good indication effect on tumor prevention and treatment.

The results in FIG. 2 show that the expression level of each gastric adenocarcinoma cell line hsa _ circ _0136666 is generally higher compared to normal human gastric mucosal epithelial cells GES-1. Among 4 gastric cancer cells, hsa _ circ _0136666 expressed the lowest level among MKN-45 cells and the highest level among MGC-803 cells. And the difference is significant. * p < 0.05, p < 0.001, p < 0.0001.

This example shows that hsa _ circ _0136666 is widely up-regulated in gastric cancer and is associated with tumor cachexia, both in terms of cells and tissues. Suggesting that hsa _ circ _0136666 expression is closely related to tumor growth progression.

Example 2 examination of the Effect of hsa _ circ _0136666 and siRNA on gastric cancer cell proliferation

1. Viral vector construction

The cDNA sequence of hsa _ circ _0136666 was inserted into a lentiviral expression vector to construct a viral vector overexpressing hsa _ circ _ 0136666. The sequence map of hsa _ circ _0136666 was provided by the inventors, and the virus vector was constructed by requesting Ji Ma science and technology ltd.

2. Cell lines and cell cultures

The gastric cancer cell line MKN-45 cells were cultured in 5% CO2 incubator at 37 ℃ in RPMI-1640 supplemented with 20% fetal bovine serum and 1% diabody.

3. Viral transfection

(1) Adherent cells were plated at 1X10^ 5/well in 24-well plates 18-24 hours prior to lentivirus transfection. The number of cells in lentivirus transfection is about 2 x10^ 5/hole.

(2) The next day, the original medium was replaced with 2ml of fresh medium containing 6. Mu.g/ml polybrene, and an appropriate amount of virus suspension was added. Incubation was carried out at 37 ℃.

(3) The culture was continued for 24 hours, and the virus-containing medium was replaced with fresh medium.

(4) And observing the fluorescence expression condition after infection for 72-96 h.

(5) The cells were expanded in 12-well plates and cultured by selection with a medium containing 0.8. Mu.g/ml puromycin.

(6) The cells screened by puromycin are subjected to amplification culture, and after a part of cells are collected, the over-expression effect is detected by fluorescence quantitative PCR.

4. Construction of Small interfering RNAs (siRNAs)

Specific small interfering RNA (siRNA) targeting hsa _ circ _0136666 reverse splice site and negative control (si-NC) were designed and synthesized by Baiomaiki (Biomics) and sequence maps for hsa _ circ _0136666 were provided by the inventors.

The siRNA sequences are as follows:

a sense strand: 5 'GUUGGGCAAUUUAUCAUUCAUdTdT 3' (SEQ ID NO. 2).

Antisense strand: 5 'UGAGAUGAUAAAUUGCCAACdTdT 3' (SEQ ID NO. 3).

siRNA transfection

50nM siRNA was transfected into AGS cells using jet-PRIME (polyplus, new York, USA). And (3) detecting the interference effect by fluorescent quantitative PCR.

CCK-8 experiment

(1) And (5) digesting, centrifuging and collecting the cells treated in the steps 3 and 5, and then counting the cells. Adjusting the cell suspension to the concentration of 5 x10 ^4/mL, uniformly mixing the cell suspension, and paving the cell suspension into a 96-well plate, wherein each well is 100 mu L of cell suspension, namely 5000 cells per well. Each set of cells was plated in 3-6 duplicate wells, and six wells containing medium were also placed in each plate as blanks (100 μ L of empty medium was also added to each well).

(2) After the cells are cultured for about 8h and adhered to the wall, 10 mu L of CCK-8 reaction solution is added into each hole of the first cell culture plate, the cells are incubated for 1h at 37 ℃ in a dark place, and the OD value at 450nm is detected and used as the initial value of the first day.

(3) The subsequent four days, the OD value was measured by adding CCK-8 reagent at the same time point to observe the proliferation change of the cells.

(4) After three consecutive days of detection of the OD values of the cells, data analysis was carried out using Graphpad Prime 8 software.

7. Data processing and analysis

The results were statistically analyzed using SPSS23.0 software. Plots were made using graphpadprism8.0 software. Statistical analysis was performed using paired t-tests as appropriate. Data are presented as mean ± standard deviation of at least three independent experiments, with P < 0.05 considered statistically significant.

8. As a result:

overexpression of hsa _ circ _0136666 resulted in tumor cell proliferation, and decreased tumor proliferation following knock-down of hsa _ circ _0136666 by the interfering sequence siRNA. The specific results are as follows:

FIG. 3A shows that the overexpression efficiency of hsa _ circ _0136666 lentivirus is about 100 times higher than that of NC (negative control group), and the overexpression effect is achieved; FIG. 3B shows that the knockdown efficiency of interfering siRNA to hsa _ circ _0136666 is about 70% compared to NC (negative control group), reaching knockdown effect; FIG. 3C shows that overexpression of hsa _ circ _0136666 enhances tumor cell proliferation in MKN-45 cells, NC stands for hsa _ circ _0136666 empty with significant difference; FIG. 3D shows that AGS cells transfected with siRNA impaired the proliferative capacity of tumor cells, and si-NC represented the interference negative control group, with significant differences. * p < 0.05, p < 0.01, p < 0.0001.

This example shows that hsa _ circ _0136666 is closely related to gastric cancer cell proliferation in terms of both overexpression and knockdown of hsa _ circ _ 0136666.

Example 3 detection of the Effect of hsa _ circ _0136666 on immune checkpoint-related protein expression

1. Cell lines and cell cultures

MKN-45 and AGS cells were cultured in the same manner as in example 1.

2. Plasmid transfection

Cells were seeded one day in advance into 6-well plates, cell density was controlled to 70% the next day, and the overexpression plasmid of hsa _ circ _0136666 was transfected using Polyplus transfection reagent.

3. Extraction of cellular proteins

The culture medium was discarded, the cells were washed 2 times with 4 ℃ pre-cooled PBS, and after pouring off the PBS, the cell culture flasks were placed on ice. Add 200. Mu.l of lysis buffer containing protease and phosphatase inhibitors, shake well, and place on ice to lyse for 30 minutes while shaking the cell vial. After lysis was complete, adherent cells were scraped off with a cell scraper and transferred to a clean 1.5ml centrifuge tube along with the lysate. 12000rpm,4 ℃,5min. And (4) sucking the supernatant in the centrifugal tube after centrifugation, transferring the supernatant into a new centrifugal tube, wherein the supernatant contains the protein sample, and if the supernatant is not used immediately, storing the sample in a refrigerator at-80 ℃.

4. Results

Western blot experiment detection results show that in two cell lines, overexpression of hsa _ circ _0136666 can obviously increase expression of immune checkpoint protein PD-L1, and the expression quantity is reduced after knockdown. While the effect on other immune checkpoints and mTOR pathway protein expression is not significant. The results are shown in FIG. 4.

In this example, key molecules of an immune checkpoint pathway and an mTOR cancer promotion pathway are detected from the protein expression level, which shows that the over-expression of hsa _ circ _0136666 can significantly improve the expression of PD-L1, and the siRNA can significantly reduce the expression of PD-L1 protein, thus suggesting that hsa _ circ _0136666 regulates and controls tumor immunity through the PD-L1 pathway.

Example 4 verification of hsa _ circ _0136666 Regulation of miR-375/PRKDC pathway

1. Bioinformatics prediction

Predicting the base complementary pairing binding site of hsa _ circ _0136666 and miR-375 by using starBase v2.0 online prediction software; and predicting base complementary pairing binding sites of miR-375 and PRKDC mRNA3' UTR by using mircap online prediction software.

2. Luciferase reporter gene assay

Cloning of circ-PRKDC or PRKDC3' utr fragment predicted to contain miR-375 wild type or mutant complement into pmir-report vector to create luciferase reporter plasmid: WT-circ-PRKDC, MUT-circ-PRKDC, PRKDC 3'UTR-WT and PRKDC3' UTR-MUT. Next, HEK-293T cells were seeded into 24-well plates. MiR-375 or MiR-NC was transfected into cells along with the indicated vector, co-transfecting the renilla luciferase plasmid. Luciferase activity was detected after 48 hours by the dual luciferase reporter kit (Vazyme).

RIP experiment

RIP assay was performed using ProteinA/G magnetic beads (Bimake). MKN-45 cells were co-transfected with wild type or mutant sequences hsa _ circ _0136666 (PRKDC 3' UTR) and miR-375 mimics, after culturing for 48h the cells were added to RIPA lysate, and then the cell extracts were incubated overnight with immunoglobulin G (anti-IgG) or Argonaute-2 (Ago 2), and protein A/G magnetic beads were added for 2h at 4 ℃. Finally, the level of miR-375 on the magnetic beads was quantified using qRT-PCR analysis.

4. Results

hsa _ circ _0136666 and miR-375 have base complementary pairing sequences, can be directly combined and enriched with miR-375, and miR-375 can be combined with a PRKDC3' UTR region. The specific results are as follows:

the results of FIG. 5 show that, by using bioinformatics prediction software, the combination sequences of hsa _ circ _0136666 and miR-375 are found, luciferase experiments prove that the combination can reduce luciferase activity, and the side proves that hsa _ circ _0136666 and miR-375 are combined with each other; RIP experiments prove that hsa _ circ _0136666 can bind and enrich miR-375. Similarly, miR-375 can bind to the PRKDC3' UTR region. The above results are significant. * p < 0.05, p < 0.01, p < 0.001, p < 0.0001

This example demonstrates that hsa _ circ _0136666 and miR-375, and miR-375 and PRKDC3' UTR are bound to each other by base complementary pairing, respectively, suggesting that the hsa _ circ _0136666/miR-375/PRKDC signal axis plays a key role in tumor signal transduction.

Example 5 examination of the Effect of hsa _ circ _0136666 on tumor growth and tumor immunity

1. Xenograft tumor experiments

(1) The preparation of nude mice, female 5-week-old BALB/cNude mice, weight 18-20g, purchased from Jiangsu Jiejiekang Biotech GmbH (license number: SCXK (su) 2018-0008), breeding SPF-level experimental animal breeding house, 12 light/dark cycle, constant temperature and humidity culture.

(2) Interfering lentivirus construction

Specific interfering lentiviruses targeting the hsa _ circ _0136666 reverse splice site and negative control viruses were synthesized from Ji Ma gene (shanghai), and a sequence map of hsa _ circ _0136666 was provided by the inventors. The shRNA target sequences are as follows: 5'GTTGGGCAATTTATCATCTCA3' (SEQ ID No: 6)

(3) shRNA infection

Interfering the lentivirus to infect the human gastric cancer MKN-45 cells.

(4) Preparing cells, culturing cells of an over-expressed and blank control group of MKN-45hsa _circ _0136666and cells of an MKN-45shRNA and blank control group in an enlarged mode, digesting, centrifuging, collecting the cells, and counting the cells. The cell suspension was formulated to a density of 2X 10^7 cells/100 uL.

(5) The process of tumor formation comprises injecting the cell resuspension into subcutaneous parts of left and right ventral axilla and inguinal region of the mouse, wherein each part is injected with 2 multiplied by 10^7 cells. The original feeding environment condition is maintained after injection, and the nude mice are killed after one week of injection after the nude mice are out of the spine. And taking out the tumor body, weighing and taking a picture.

(6) As a result, the

Lentiviral infection of hsa _ circ _0136666 promoted tumor volume enlargement, and lentivirus infection of shRNA inhibited tumor growth. The specific results are as follows:

FIG. 6A shows that tumor volumes were significantly increased in the group overexpressing MKN-45 cells injected with hsa _ circ _0136666, with NC representing the group of MKN-45 cells injected with negative control treatment; the results in fig. 6B show that hsa _ circ _0136666 overexpresses MKN-45 cell group tumor weight was significantly increased compared to NC group, with significant difference; figure 6C results show that the injection of sh _ circ _0136666 knockdown expression cell group significantly reduced tumor volume, NC representing the injection of negative control treated MKN-45 cell group; the results in fig. 6D show that sh _ circ _0136666 knockdown expression cells significantly decreased tumor weight compared to NC group, with significant difference. * P < 0.01, p < 0.001

2. Enzyme-linked immunosorbent assay

(1) For tumor tissues with small tumor weight differences, 300. Mu.l of physiological saline (0.9% NaCl solution) was added to the tube, followed by homogenization with an electric homogenizer.

(2) The blade was washed twice before homogenization, using 300. Mu.l of physiological saline for each wash, and then kept under constant stirring at 4 ℃ for 2 hours (on a rotary shaker in a cold room).

(3) Centrifuge at 13,000xrp for 20 minutes at 4 ℃. Place on ice, dispense supernatant into new, pre-cooled tubes and store samples at-80 ℃. The number of repeated freeze thawing times is reduced as much as possible.

(4) The experiment is carried out according to the instructions of a combined organism MouseIL-6ELISAKit (sequence number: EK 206) detection kit and a Human/Mouse/RatTGF-beta 1ELISAKit detection kit (sequence number: EK 981).

(5) Results

The cancer promoting factor IL-6 in the hsa _ circ _0136666 group infected by lentivirus is obviously up-regulated, and the cell factor IL-6 and TGF-beta 1 in the shRNA group infected by lentivirus are obviously down-regulated. Indicating that the tumor microenvironment is regulated by hsa _ circ _ 0136666. The specific results are as follows:

FIG. 7A shows that IL-6 in the tumor infiltration zone was significantly upregulated after lentivirus overexpression of hsa _ circ _ 0136666; the 7B result shows that after the slow virus infects shRNA, the IL-6 in the tumor infiltration area is obviously reduced; FIG. 7C results show that tumor infiltration zone TGF-. Beta.1 did not significantly change compared to the NC group after lentivirus overexpression of hsa _ circ _ 0136666; figure 7D results show that tumor infiltration zone TGF- β 1 was significantly down-regulated following lentivirus infection with shRNA. Some results were significant. * p < 0.05, p < 0.01

3. Experiment of allogenic transplantation tumor

(1) The preparation method comprises the following steps of preparing female 5-week-old C57BL/C mice, weighing 18-20g, purchasing from a Qinglongshan animal breeding farm (license number: SCXK (Yu) 2020-0005), feeding an SPF-level experimental animal feeding house, and culturing under 12 light/dark cycle conditions at constant temperature and humidity.

(2) Cell preparation, culturing MFC (mouse gastric cancer cell) hsa _ circ _0136666 over-expression and blank control group cells, digesting, centrifuging, collecting cells, and counting cells. The cell suspension was formulated to a density of 1X10^7 cells/100 uL.

(3) The process of tumor formation, injecting the cell re-suspension into subcutaneous parts of left and right ventral axilla and groin of mice, and injecting 1x10^7 cells into each part. Maintaining the original feeding environment condition after injection. After 21 days of injection, the mice were sacrificed by invertebrate injection. Tumor tissues were removed and subjected to the next experiment.

4. Flow cytometry

(1) Tumor tissue was collected into tissue culture dishes containing 5ml pbs. The tissue was broken down into single cell suspensions by squeezing the bottom using a 1mL syringe. The cell filter (300 mesh screen) was placed on top of a 15ml centrifuge tube. Cells in the tissue culture dish are passed through a cell filter to remove cell clumps and debris.

(2) The cell suspension was centrifuged at 1850rpm at 2-8 ℃ for 5 minutes and the supernatant discarded.

(3) The cell pellet was resuspended in an appropriate volume of PBS prior to cell counting and activity analysis.

(4) The final concentration of the cells reaches 1x10^7 cells/mL, and the cells are subpackaged into different Ep tubes. According to the experimental group, the homotypic control tube and each flow channel single positive tube CD3/CD4/CD8 (detecting tumor-associated macrophages as CD11c/CD86/CD206, detecting regulatory T cells as CD4/Foxp3, and detecting MDSCs as CD11b/Gr-1, the same below) are set.

(5) 0.5ul of the fluorescent antibody CD3/CD4/CD8 (CD 11c/CD86/CD206, CD4/Foxp3, CD11 b/Gr-1) was added and incubated for 20min in the absence of light.

(6) The cell suspension was centrifuged at 1850rpm at 2-8 ℃ for 5 minutes, and the supernatant was discarded to remove unbound antibody.

(7) The cell pellet was resuspended in not less than 200ul PBS, and the cells were passed through a cell filter (300 mesh screen) into a polypropylene tube (flow tube) and tested on the machine.

(8) As a result, the

The over-expression of hsa _ circ _0136666 leads the cancer-promoting phenotype of immune suppressor cells (TAM, treg and MDSCs) to be obviously up-regulated, leads the number of immune cells (CD 4+ and CD8+ T cells) to be reduced, and has promotion effect on the tumor immune escape phenomenon. The specific results are as follows:

fig. 8A shows that when C57BL/C mice were subcutaneously inoculated with hsa _ circ _0136666 overexpressing MFC cells, the numbers and ratios of CD3+ CD4+ and CD3+ CD8+ T cells in the tumor tissues of the mice were significantly reduced, representing a decline in anti-tumor immune function, and fig. 8B, 8C, and 8D respectively show that the cancer-promoting phenotypes of tumor-associated macrophages, regulatory T cells, and MDSCs cells in the overexpressed group were significantly upregulated compared to the control group. NC stands for the plated negative control-treated MFC cell group. This example demonstrates that hsa _ cic _0136666 can modulate immune function, cause immune dysregulation, and promote immune escape.

The example illustrates in many ways from tumor volume, tumor weight, cytokines and immune cells that overexpression of hsa _ circ _0136666 significantly promotes the immune escape process, and the growth of tumors in the group of lentivirus-infected shRNA is significantly inhibited. The hsa _ circ _0136666 is suggested to be a key factor of immune response, and the inhibitor for reducing the expression of hsa _ circ _0136666 can be used as an anti-tumor immune escape drug for treating cancer.

The above-described embodiments are merely exemplary and are merely preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, and those skilled in the art can make various modifications and variations without departing from the technical principle of the present invention, and these modifications and variations should be construed as the scope of the present invention.

Claims (5)

1. Use of an inhibitor of hsa _circ _0136666in the preparation of a medicament for use as a tumor immunopotentiator, wherein the nucleotide sequence of hsa _ circ _0136666 is shown in SEQ ID NO: 1; the method is characterized in that: the inhibitor is one or more of antisense oligonucleotide, siRNA, shRNA, aptamer and transcription activation RNA of targeted hsa _ circ _ 0136666.
2. 2. Use according to claim 1, characterized in that:

   the siRNA nucleotide sequence is as follows: the sense strand is SEQ ID NO.2, and the antisense strand is SEQ ID NO.3;

   the shRNA nucleotide sequence is as follows: SEQ ID No. 6.
3. 3. Use according to claim 1 or 2, characterized in that: the inhibitor of hsa _ circ _0136666 is used in combination with a PD-1, PDL1 inhibitor or an anti-tumor drug.
4. 4. Use according to claim 3, characterized in that: the antitumor drugs are platinum, fluoropyrimidine, paclitaxel and the like.
5. 5. Use according to claim 3, characterized in that: the tumor is liver cancer, lung cancer, colorectal cancer, gastric cancer or breast cancer.

Images