CN115873122B - Light chain and heavy chain variable region of anti-carbaryl monoclonal antibody and application thereof - Google Patents
Light chain and heavy chain variable region of anti-carbaryl monoclonal antibody and application thereof Download PDFInfo
- Publication number
- CN115873122B CN115873122B CN202310072047.8A CN202310072047A CN115873122B CN 115873122 B CN115873122 B CN 115873122B CN 202310072047 A CN202310072047 A CN 202310072047A CN 115873122 B CN115873122 B CN 115873122B
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- seq
- carbaryl
- cdr
- chain variable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a light chain and heavy chain variable region of an anti-carbaryl monoclonal antibody and application thereof, wherein the light chain variable region of the monoclonal antibody is respectively CDR-L1, CDR-L2 and CDR-L3, and the amino acid sequences of the monoclonal antibody are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7; the heavy chain variable regions of the monoclonal antibody are CDR-H1, CDR-H2 and CDR-H3, and the amino acid sequences of the monoclonal antibody are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10. The monoclonal antibody with higher affinity and detection sensitivity for carbaryl provided by the invention has the advantages of strong specificity, high affinity and detection sensitivity and convenience and rapidness in detection, can be used as a raw material for enzyme-linked immunosorbent assay and colloidal gold immunodetection, and can lay a foundation for research and development and popularization of indirect competitive ELISA kits and colloidal gold test strips.
Description
Technical Field
The invention relates to the field of pesticide residue detection, in particular to a light chain and heavy chain variable region of an anti-carbaryl monoclonal antibody and application thereof.
Background
Carbaryl (Carbaryl), also known as Carbaryl, is a carbamate insecticide, and has the chemical name of 1-naphthyl-N-methyl carbamate, and has the characteristics of high efficiency, long drug effect, high selectivity and the like. The industrial pure product of the carbaryl is white crystal, the melting point of the pure product is 142 ℃, and the flash point is 202.7 ℃, so that the cholinesterase activity of pests can be inhibited, and the pests can be killed. The carbaryl is a moderately toxic pesticide, can invade the immune system, the nerve center and the endocrine system of people, is not easy to degrade in nature, has long residual time, and is extremely easy to cause the drug residue and exceeding standard of agricultural products.
Currently, carbaryl is detected by gas chromatography (GS), liquid chromatography-mass spectrometry (LCMS), gas chromatography-mass spectrometry (GC-MS), and the like. The quantitative analysis of the instrument method has lower detection limit, but the instrument method has complex pretreatment operations such as separation, extraction, purification, derivatization and the like, has high cost and can not meet the requirement of on-site scale rapid detection. The immunoassay method has the advantages of low cost, high efficiency, high sensitivity, low relative requirements on technicians and the like, and is suitable for rapid detection of a large number of samples.
Disclosure of Invention
The invention aims to provide a light chain and heavy chain variable region of an anti-carbaryl monoclonal antibody and application thereof, and the monoclonal antibody has the characteristics of strong specificity, high sensitivity and the like, can be used as a raw material for enzyme-linked immunosorbent assay and colloidal gold immunodetection, and lays a foundation for research and development and popularization of indirect competition ELISA (enzyme-linked immunosorbent assay) kits and colloidal gold test strips.
In order to achieve the above purpose, the invention provides a light chain and heavy chain variable region of an anti-carbaryl monoclonal antibody, wherein the light chain variable region of the monoclonal antibody is respectively CDR-L1, CDR-L2 and CDR-L3, and the amino acid sequences of the monoclonal antibody are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7;
the heavy chain variable regions of the monoclonal antibody are CDR-H1, CDR-H2 and CDR-H3, and the amino acid sequences of the monoclonal antibody are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10.
Preferably, the gene sequence of Kappa chain of the monoclonal antibody is shown as SEQ ID NO.1, and the amino acid sequence of the monoclonal antibody is shown as SEQ ID NO. 2; the gene sequence of the Heavy chain of the monoclonal antibody is shown as SEQ ID NO.3, and the amino acid sequence of the Heavy chain of the monoclonal antibody is shown as SEQ ID NO. 4.
The application of the light chain and heavy chain variable regions of an anti-carbaryl monoclonal antibody in preparing carbaryl detection reagent or kit.
The application of the light chain and heavy chain variable regions of an anti-carbaryl monoclonal antibody in preparing genetically engineered antibodies or vaccines.
Therefore, the monoclonal antibody with higher affinity and detection sensitivity for carbaryl has the advantages of strong specificity, high affinity and detection sensitivity and convenient and quick detection, can be used as a raw material for enzyme-linked immunosorbent assay and colloidal gold immunodetection, and can lay a foundation for research and development and popularization of indirect competitive ELISA kits and colloidal gold test strips.
The technical scheme of the invention is further described in detail through the drawings and the embodiments.
Drawings
FIG. 1 is a drawing of carbaryl OD using RIDA SOFT four parameter method 450nm Is a standard curve of (2);
FIG. 2 is a graph showing half-inhibitory concentrations of monoclonal antibodies;
FIG. 3 shows the homology alignment of the light chain gene sequences of carbaryl monoclonal antibodies;
FIG. 4 shows the homology alignment of heavy chain gene sequences of carbaryl monoclonal antibodies;
FIG. 5 shows the homology alignment of the light chain amino acid sequences of the carbaryl monoclonal antibodies;
FIG. 6 shows the results of homology of heavy chain amino acid sequences of carbaryl monoclonal antibodies.
Detailed Description
The technical scheme of the invention is further described below through the attached drawings and the embodiments.
Example 1
Preparation of monoclonal antibodies
Immunization (one)
Emulsifying the carbaryl artificial antigen by adopting Freund's complete adjuvant (1:1), and subcutaneously injecting Balb/c mice with 6 weeks of age, wherein the immune dose is 500 mug/mouse; the first immunization was performed by boosting the first immunization once every 4 weeks, 2 times, and using Freund's incomplete adjuvant instead of Freund's complete adjuvant.
And (3) performing 1-time impact immunization when the titer reaches more than 1:10000 after the 2 nd immunization is strengthened for one week, namely, performing intraperitoneal injection of 0.5mL of an immunogen solution, taking spleen cells and myeloma cells to fuse after three days, and screening positive holes. Cloning the positive hole by utilizing a limiting dilution method to obtain and establish a hybridoma cell strain for stably secreting the carbaryl monoclonal antibody.
(II) preparation of ascites and antibody purification
Transferring the obtained hybridoma cell strain which stably secretes the carbaryl monoclonal antibody into a culture flask for culture, or immediately placing a freezing tube of the carbaryl monoclonal antibody hybridoma cell strain into a water bath at 37 ℃ for medium-speed thawing, centrifuging to remove frozen solution, and transferring into the culture flask for culture.
Balb/c mice (8 weeks old) were intraperitoneally injected with sterilized paraffin oil 0.8 mL/mouse by in vivo induction, and after 7 days, hybridoma cells were intraperitoneally injected with 8X 10 5 Ascites was collected after 10 days. Purifying by octanoic acid-saturated ammonium sulfate method to obtain carbaryl monoclonal antibody.
Example two
Sensitivity of monoclonal antibodies
The monoclonal sensitivity was measured by the indirect Elisa method and the results are shown in Table 1. As shown in FIG. 1, the concentrations of carbaryl (0,2,5, 10, 20, 40 ng/mL) are plotted on the abscissa, and the OD corresponding to the concentrations of carbaryl is plotted on the abscissa 450nm Values are plotted on the ordinate, a standard curve is drawn using the RIDA SOFT four-parameter method, and the median Inhibitory Concentration (IC) 50 ）。
TABLE 1 monoclonal antibody sensitivity verification
The results show that curve R 2 =0.9999，IC 50 =4.5 ng/mL, as in fig. 2. Half maximal Inhibitory Concentration (IC) 50 ) Is superior to CN107515298A (IC) 50 =113.31ng/ml）。
Examples
Cloning of light and heavy chain variable region genes
Total RNA extraction
Total RNA was extracted using a cultured cell total RNA extraction kit (available from Tiangen Biochemical technologies (Beijing) Co., ltd.) at a concentration of 241.5 ng/. Mu.L.
(II) Synthesis of first strand of cDNA
cDNA was synthesized using TIANScript II cDNA first strand synthesis kit (available from Tiangen Biochemical technologies (Beijing) Co., ltd.).
(III) Gene amplification
The Lambda strand, kappa strand, heavy strand downstream primer and upstream universal primer were designed.
Primer: AAGCAGTGGTATCAACGCAGA (SEQ ID NO. 11)
Rκ:AACATTGATGTCTTTGGGGTAGAA（SEQ ID NO.12）
Rλ:AATCGTACACACCAGTGTGTGGG（SEQ ID NO.13）
RH:AGGGATCCAGAGTTCCAGGT（SEQ ID NO.14）
PCR was performed using the first strand of cDNA as a template, and the reaction system was 50. Mu.l.
PCR reaction system: 3. Mu.L of template, 2.5. Mu.L of upstream and downstream primers (10. Mu.M) each, 25. Mu.L of Green Taq Mix, ddH 2 O 17μL。
PCR reaction conditions: 95 ℃ for 5min; cycling for 12 times at 95 ℃ for 30s,60 ℃ for 30s and 72 ℃ for 1 min; cycling for 28 times at 95 ℃ for 30s,56 ℃ for 30s and 72 ℃ for 1 min; 7min at 72 ℃.
(IV) cloning and screening of PCR amplified products
The PCR products were subjected to 2% agarose gel electrophoresis, antibody Kappa chain, lambda chain and Heavy chain fragments were recovered using agarose gel DNA recovery kit (Tiangen Biochemical technologies (Beijing) Co., ltd.), the fragments were inserted into pLB vector using pLB zero background rapid cloning kit (Beijing Tiangen), transformed into DH 5. Alpha. Competent cells (ampicillin resistance), and recombinant positive clones were selected and sequenced.
The gene sequence of the Kappa chain is shown as SEQ ID NO.1, and the gene sequence of the Heavy chain is shown as SEQ ID NO. 3. The amino acid sequence of the Kappa chain is shown as SEQ ID NO.2, and the amino acid sequence of the Heavy chain is shown as SEQ ID NO. 4.
(V) analysis of amino acid sequence and homology of variable region
The analysis in NCBI database shows that the light chain variable region gene Sequence of the carbaryl monoclonal antibody has the highest homology with the mouse immunoglobulin Kappa chain variable region (Sequence ID: U56414.1), the homology is 423/477, and the homology percentage is 89%, as shown in figure 3.
The heavy chain variable region gene Sequence of the carbaryl monoclonal antibody has the highest homology with the murine monoclonal antibody IgH heavy chain variable region (Sequence ID: X87228.1), the homology is 448/550 and the homology percentage is 81 percent, as shown in figure 4.
The amino acid Sequence of the light chain variable region of the carbaryl monoclonal antibody has the highest homology with the mouse immunoglobulin light chain (Sequence ID: AAT 46395.1), the homology is 141/170, and the homology percentage is 83%, as shown in figure 5.
The amino acid Sequence of the heavy chain variable region of the carbaryl monoclonal antibody has the highest homology with the heavy chain of the mouse immunoglobulin (Sequence ID: CZF 87187.1), the homology is 108/181, and the homology percentage is 60 percent, as shown in figure 6. The results of homology analysis of the gene sequences and amino acid sequences encoding the light and heavy chain variable regions of the carbaryl monoclonal antibody revealed that the same sequences as in the present invention were not found.
Example IV
CDR analysis
The sequences of the heavy chain variable region and the light chain variable region were analyzed at https:// www.novopro.cn/tools/cdr.html to obtain the CDR regions.
Antibody light chain CDR regions:
CDR-L1：RASKSVSTSAYNYMH（SEQ ID NO.5）
CDR-L2：FASNLES（SEQ ID NO.6）
CDR-L3：QHSREVSLT（SEQ ID NO.7）
antibody heavy chain CDR regions
CDR-H1：FYLFS（SEQ ID NO.8）
CDR-H2：CLSGRRSSGFPDRVKG（SEQ ID NO.9）
CDR-H3：GLAQYAYYVY（SEQ ID NO.10）
Examples
1. Preparation of colloidal gold test paper card
(1) The test strip consists of a bottom plate, a sample absorption pad, a conjugate release pad, a nitrocellulose membrane, a water absorption pad and a clamping shell;
(2) Sequentially adhering a sample absorption pad, a conjugate release pad, a nitrocellulose membrane and a water absorption pad on a PS bottom plate; the conjugate release pad is covered by a sample absorption pad from the initial end in a 1/4 area, the tail end of the conjugate release pad is connected with the initial end of the nitrocellulose membrane, the tail end of the nitrocellulose membrane is connected with the initial end of the water absorption pad, the initial end of the sample absorption pad is aligned with the initial end of the PS bottom plate, and the tail end of the water absorption pad is aligned with the tail end of the PS bottom plate;
(3) The nitrocellulose membrane is provided with a detection line and a quality control line, and the detection line and the quality control line are strip-shaped belts which are perpendicular to the length of the test strip; the detection line is positioned at one side close to the tail end of the conjugate release pad; the control line is located on a side remote from the end of the conjugate release pad. Cutting the test paper strip into small strips with the width of 4.05mm by a machine, putting the small strips into a specially-made plastic card shell, sealing the small strips by an aluminum foil bag, and storing the small strips for 12 months at the temperature of 2-30 ℃.
2. Preparation of carbaryl colloidal gold test paper card
The preparation method of the carbaryl colloidal gold test paper card comprises the following steps:
s1, preparing a nitrocellulose membrane with a detection line of carbaryl artificial antigen and a quality control line coated with goat anti-mouse antibody;
s2, preparing a conjugate release pad sprayed with the carbofuran marked by colloidal gold;
s3, sequentially fixing a sample absorption pad, a conjugate release pad, a nitrocellulose membrane and a water absorption pad on a bottom plate;
s4, loading the shell into a clamping shell.
3. Definition of test paper card detection limit
A sample 1 (10 ppb of carbaryl), a sample 2 (5 ppb of carbaryl), and a sample 3 (0 ppb of carbaryl) were prepared using milk completely free of carbaryl as a negative sample. And (3) sucking 100 mu L of sample solution to be detected into the clamping shell hole by using a micropipette, and judging a result after reacting for 10 minutes at room temperature, wherein the result is not more than 20 minutes.
Result determination
Negative (-). The color of the C line and the T line is far stronger than that of the C line, which means that the sample does not contain carbaryl or is far lower than the detection limit.
Positive (+): developing color by a C line; the color development of the T line is the same as that of the C line, the color development of the T line is weaker than that of the C line or the T line does not develop, and the T line color development is the same as that of the C line, and the T line color development are the same as that of the C line.
Invalidation: the absence of the C line indicates an incorrect operation or that the test card has failed.
The results show that: sample 1 to be tested (carbaryl 10 ppb) was positive, sample 2 to be tested (carbaryl 5 ppb) was negative, and sample 3 to be tested (carbaryl 0 ppb) was negative. This result indicates that the test strip has a detection limit of 10ppb.
Therefore, the monoclonal antibody with higher affinity and detection sensitivity for carbaryl has the advantages of strong specificity, high affinity and detection sensitivity and convenient and quick detection, can be used as a raw material for enzyme-linked immunosorbent assay and colloidal gold immunodetection, and can lay a foundation for research and development and popularization of indirect competitive ELISA kits and colloidal gold test strips.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention and not for limiting it, and although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that: the technical scheme of the invention can be modified or replaced by the same, and the modified technical scheme cannot deviate from the spirit and scope of the technical scheme of the invention.
Claims (3)
1. An anti-carbaryl monoclonal antibody comprising a monoclonal antibody light chain variable region and a monoclonal antibody heavy chain variable region;
wherein the light chain variable region of the monoclonal antibody comprises CDR-L1, CDR-L2 and CDR-L3, and the amino acid sequences of the light chain variable region are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7;
the heavy chain variable region of the monoclonal antibody comprises CDR-H1, CDR-H2 and CDR-H3, and the amino acid sequences of the heavy chain variable region are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10.
2. An anti-carbaryl monoclonal antibody according to claim 1, wherein: the coding gene sequence of Kappa type light chain of the monoclonal antibody is shown as SEQ ID NO.1, and the amino acid sequence of the monoclonal antibody is shown as SEQ ID NO. 2; the coding gene sequence of the Heavy chain of the monoclonal antibody is shown as SEQ ID NO.3, and the amino acid sequence of the Heavy chain of the monoclonal antibody is shown as SEQ ID NO. 4.
3. Use of an anti-carbaryl monoclonal antibody according to any one of claims 1-2 in the preparation of a carbaryl detection reagent or kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310072047.8A CN115873122B (en) | 2023-02-07 | 2023-02-07 | Light chain and heavy chain variable region of anti-carbaryl monoclonal antibody and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310072047.8A CN115873122B (en) | 2023-02-07 | 2023-02-07 | Light chain and heavy chain variable region of anti-carbaryl monoclonal antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115873122A CN115873122A (en) | 2023-03-31 |
| CN115873122B true CN115873122B (en) | 2023-08-29 |
Family
ID=85760820
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310072047.8A Active CN115873122B (en) | 2023-02-07 | 2023-02-07 | Light chain and heavy chain variable region of anti-carbaryl monoclonal antibody and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115873122B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2847294Y (en) * | 2005-03-24 | 2006-12-13 | 万积成 | Colloidal gold test paper for quick detecting carbaryl residue |
| CN106636010A (en) * | 2017-01-13 | 2017-05-10 | 中国农业科学院油料作物研究所 | Hybridoma cell strain Jnw1D2 and anti-carbaryl monoclonal antibody generated by same |
| CN112759646A (en) * | 2021-04-07 | 2021-05-07 | 北京纳百生物科技有限公司 | Dexamethasone monoclonal antibody and application thereof |
| CN113773390A (en) * | 2021-11-15 | 2021-12-10 | 北京纳百生物科技有限公司 | Chlorothalonil monoclonal antibody and application thereof |
| CN114702584A (en) * | 2022-06-06 | 2022-07-05 | 北京纳百生物科技有限公司 | Anti-estradiol monoclonal antibody and application thereof |
-
2023
- 2023-02-07 CN CN202310072047.8A patent/CN115873122B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2847294Y (en) * | 2005-03-24 | 2006-12-13 | 万积成 | Colloidal gold test paper for quick detecting carbaryl residue |
| CN106636010A (en) * | 2017-01-13 | 2017-05-10 | 中国农业科学院油料作物研究所 | Hybridoma cell strain Jnw1D2 and anti-carbaryl monoclonal antibody generated by same |
| CN112759646A (en) * | 2021-04-07 | 2021-05-07 | 北京纳百生物科技有限公司 | Dexamethasone monoclonal antibody and application thereof |
| CN113773390A (en) * | 2021-11-15 | 2021-12-10 | 北京纳百生物科技有限公司 | Chlorothalonil monoclonal antibody and application thereof |
| CN114702584A (en) * | 2022-06-06 | 2022-07-05 | 北京纳百生物科技有限公司 | Anti-estradiol monoclonal antibody and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115873122A (en) | 2023-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8841419B2 (en) | Hybridoma cell line 10G4 and a monoclonal antibody against the total of aflatoxin B1, B2, G1 and G2 | |
| CN114437213B (en) | Monoclonal antibody of resisting fluogesterone acetate and application thereof | |
| CN112111009B (en) | Variable region sequence of specific anti-pyraclostrobin antibody and recombinant full-length antibody thereof | |
| CN116333115B (en) | Anti-progesterone monoclonal antibody, kit and application | |
| CN114702584B (en) | Anti-estradiol monoclonal antibody and application thereof | |
| CN113773390B (en) | Chlorothalonil monoclonal antibody and application thereof | |
| CN115819565A (en) | Novel coronavirus Omicron mutant strain specific antibody and application thereof | |
| CN112759649B (en) | Aflatoxin M1 monoclonal antibody and application thereof | |
| CN115873122B (en) | Light chain and heavy chain variable region of anti-carbaryl monoclonal antibody and application thereof | |
| US11884743B2 (en) | Preparation and application of an intact recombinant antibody specific to clothianidin based on the identified variable region sequence | |
| CN114560945B (en) | Novel monoclonal antibody specifically binding to erythromycin and application thereof | |
| CN112759646B (en) | Dexamethasone monoclonal antibody and application thereof | |
| CN116425880B (en) | Anti-isoprocarb monoclonal antibody, kit and application | |
| CN116143909A (en) | anti-HIV-1P 24 antibody and preparation method and application thereof | |
| CN113150160A (en) | Aflatoxin M1Anti-idiotype nano antibody and preparation method thereof | |
| CN112062852A (en) | Variable region sequence of anti-clothianidin and dinotefuran broad-spectrum antibody and preparation of recombinant complete antibody thereof | |
| CN116284425B (en) | Monoclonal antibody of anti-nonylphenol polyoxyethylene ether, kit and application | |
| CN116535505B (en) | Anti-erythrocyte envelope antigen antibody, reagent and kit containing same and method for trapping or separating erythrocyte | |
| CN115873103B (en) | Antibody for resisting novel coronavirus N protein, preparation method and application thereof | |
| CN114560934B (en) | Monoclonal antibody specifically binding beta-bungarotoxin and application thereof | |
| CN116120447B (en) | IFN-gamma protein monoclonal antibody and application thereof | |
| CN115819571B (en) | Anti-aflatoxin B1 monoclonal antibody and application thereof | |
| CN115785273B (en) | Antibody for resisting pepsinogen I and application thereof | |
| CN117820482A (en) | Antibody of antiprogestin-progesterone antibody complex, and preparation method and application thereof | |
| CN118440209A (en) | Anti-methylenedioxymethamphetamine antibodies, reagents and kits for detecting methylenedioxymethamphetamine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |