CN115851786A - Gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin - Google Patents
Gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin Download PDFInfo
- Publication number
- CN115851786A CN115851786A CN202211671280.XA CN202211671280A CN115851786A CN 115851786 A CN115851786 A CN 115851786A CN 202211671280 A CN202211671280 A CN 202211671280A CN 115851786 A CN115851786 A CN 115851786A
- Authority
- CN
- China
- Prior art keywords
- acylase
- penicillin
- gene
- mutated
- cephalexin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides a gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin, and relates to the technical field of genetic engineering and enzyme engineering, wherein the nucleotide sequence of the gene for coding penicillin G acylase is shown as SEQ ID NO.1, and the gene for coding penicillin G acylase is expressed to obtain mutated penicillin G acylase; the enzyme activity of the mutated penicillin G acylase obtained by expression is high, the forward progress of the synthesis of cephalexin can be further promoted, the hydrolysis (H) function of an expression host strain product is reduced, the synthesis (S) function of the product is improved, the S/H ratio of the obtained S/H ratio is higher than that of the old expression host strain, the S/H ratio is improved by 5 times compared with that of the old expression host strain, the generation amount of hydrolysis byproducts is reduced, the generation amount of cephalexin as a main product is improved, the molar ratio of two reactants is reduced, the product quality is improved, and the enterprise cost is reduced.
Description
Technical Field
The invention relates to the technical field of genetic engineering and enzyme engineering, in particular to a gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin.
Background
Cephalexin (cephalexin, cefixin and cephalosporin IV) has become a main variety of cephalosporin antibiotics after years of development, and is the cephalosporin antibiotics with the largest consumption in the world.
Currently, cephalosporin antibiotics are the most widely used beta-lactam antibiotics, and account for 40 percent of the global antibiotic market. Wherein, the cefalexin is a main variety in cephalosporin antibiotics, achieves the bactericidal action by inhibiting the synthesis of cell walls, and is a semi-synthetic cephalosporin with larger clinical use amount at present. Cephalexin is the first generation oral cephalosporin antibiotics, which are applied clinically in the 60 s of the 20 th century, and are the most widely and mostly used antibiotics at present. Is suitable for respiratory tract infection, urinary tract infection, skin soft tissue infection and the like caused by sensitive bacteria, such as acute tonsillitis, angina, otitis media, nasosinusitis, bronchitis, pneumonia and the like. The antibacterial spectrum of the compound is similar to that of cephalothin, but the antibacterial activity of the compound is poorer than that of cephalothin. In addition to enterococcus and methicillin-resistant staphylococci, most strains of Streptococcus pneumoniae, hemolytic streptococci, and Staphyloccocus with or without penicillinase are sensitive to cephalexin. Cefalexin has a good antibacterial effect on Neisseria, but has a poor effect on Haemophilus influenzae, and has a certain antibacterial effect on part of Escherichia coli, proteus mirabilis, salmonella and Shigella. Other enterobacteriaceae bacteria, acinetobacter, pseudomonas aeruginosa, and bacteroides fragilis are resistant to cephalexin, fusobacterium and veillonella are generally sensitive, and gram-positive anaerobic cocci are moderately sensitive.
There are two methods for synthesizing cephalexin, i.e., chemical semi-synthesis (chemical method, including mixed anhydride method and acid chloride method) and enzymatic semi-synthesis (enzymatic method). The traditional synthesis method of cefalexin is to prepare a side chain by starting from benzaldehyde through chemical synthesis; penicillin G is obtained by fermentation of penicillium, mother nucleus 7-ADCA is obtained by chemical ring expansion and cracking, and the mother nucleus and side chain are condensed by a chemical method to obtain the penicillin G. The method is still used by most of enterprises in the world for producing cefalexin, the whole production process approximately needs 10 steps of chemical reaction, and finally the three wastes generated by each kilogram of products are up to more than 30 kg. Enzymatic synthesis technology of cephalexin began in the last 70 th century. The eastern brewing company of Japan used Penicillin acylase (penicillin acylase, penicillin amidase, penicillin acetylase) produced by Bacillus megaterium B-400 and Achromobacter B-402 as acylase (catalyst), condensed to produce cephalexin, and started to carry out industrial research in 1973. The reaction can be carried out in aqueous solution, the used organic solvent is very little, and the reaction condition is mild, so the technology is widely regarded. However, the technical problem of separating the reaction product and excessive raw materials from the reaction mixture has not been solved well due to the poor performance of the enzyme at that time, so the enzymatic synthesis technology is still in the research and trial production stage for many years, and the literature at home and abroad has been described in detail. China has made researches on biotransformation of beta-lactam antibiotics from the 80 s of the last century and has achieved some achievements. However, since there is no substantial breakthrough in the extraction, separation and immobilization techniques of acylase and the separation and recovery techniques of the product and the raw material, it is difficult to realize the technical and economic advantages, and thus it is difficult to put them into practical use in production.
The traditional chemical method needs dichloromethane and other solvents, stoichiometric amount of silanization agent (or other carboxyl protective agent such as DBU, TMG and the like), side chain protective agent of Deng salt, activating agent of acetylation reaction (such as pivaloyl chloride) and the like, thereby forming a large amount of three wastes. The waste water discharged in the process of enzymatic synthesis of cefalexin only contains some simple inorganic salts, which do not cause harm to human living environment and are known as green route. Therefore, the improvement of the enzymatic activity of the enzymatic synthesis of cefalexin and the optimization of the conversion process become problems to be solved at present.
Disclosure of Invention
The present invention aims to provide a gene encoding penicillin G acylase, which has high enzymatic activity of penicillin G acylase after mutation obtained by expression and can further promote forward progress of cefalexin synthesis reaction.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a gene for coding penicillin G acylase, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
Preferably, the gene is obtained by modifying an initial gene of penicillin G acylase, and the nucleotide sequence of the initial gene of penicillin G acylase is shown as SEQ ID No. 2.
The invention also provides the penicillin G acylase obtained after mutation by the gene expression of the coding penicillin G acylase.
The invention also provides the application of the gene for coding penicillin G acylase or the mutated penicillin G acylase in preparing cefalexin.
The invention also provides a method for preparing cephalexin by the gene for coding penicillin G acylase, which comprises the following steps:
(1) Constructing an expression vector carrying the gene for coding the penicillin G acylase, transferring the expression vector into escherichia coli to obtain a recombinant expression strain and express the obtained penicillin G acylase;
(2) Immobilizing the mutated penicillin G acylase;
(3) Mixing the 7-amino-3-deacetoxy cephalosporanic acid solution with immobilized penicillin G acylase at the temperature of 18-22 ℃ to obtain a mixed solution; then, the D-phenylglycine methyl ester hydrochloride solution is dripped into the mixed solution for reaction, and the pH value is maintained to be 7.0 in the reaction process.
Preferably, the pH of the 7-amino-3-desacetoxycephalosporanic acid solution in the step (3) is 7.0.
Preferably, the mass ratio of the immobilized penicillin G acylase in the step (3) to the 7-amino-3-desacetoxycephalosporanic acid in the 7-amino-3-desacetoxycephalosporanic acid solution is 0.4-1.2.
Preferably, the molar ratio of D-phenylglycine methyl ester hydrochloride to 7-amino-3-desacetoxycephalosporanic acid in the step (3) is 1.05-1.10: 1.
preferably, the dropping time in the step (3) is 240-260 min, and the reaction temperature is 18-22 ℃.
The invention has the technical effects and advantages that:
the invention provides a gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin, wherein the cefalexin enzymatic synthesis process takes 7-aminodesacetoxycephalosporanic acid (7-ADCA) as a mother nucleus, phenylglycine methyl ester as an acyl donor, immobilized Penicillin G Acylase (PGA) as acyltransferase and a catalyst for catalytic synthesis of cefalexin; the enzymatic synthesis of cefalexin has the advantages of mild reaction conditions, simple process operation, no need of group protection, cleanness, safety, no pollution and the like, the enzymatic preparation of cephalosporin has great potential in industry, and the synthetic method and route of the biological enzyme have certain social and economic benefits; the invention firstly carries out point mutation of gene on the gene sequence of penicillin G acylase, reduces the hydrolysis (H) function of the product of an expression host strain, improves the synthesis (S) function of the product, obtains an S/H ratio higher expression host strain, improves the S/H ratio by 5 times compared with the old expression host strain, reduces the generation amount of hydrolysis byproducts, improves the generation amount of a main product cefalexin, reduces the molar ratio of two reactants, improves the product quality and reduces the enterprise cost; and secondly, the enzyme adding amount, the adding ratio, the adding sequence, the reaction temperature, the pH value, the reaction time and the like of the reaction are optimized, so that the conversion rate of 7-ADCA reaches more than 99.5 percent, the purity of the cefalexin product is improved, the mother liquor is not required to be recycled, the enterprise cost is greatly reduced, the product quality is improved, the pollution caused by chemical reaction is avoided, and the environmental protection pressure of an enterprise is greatly reduced.
Drawings
FIG. 1 is a liquid chromatography peak of example 1;
FIG. 2 is a liquid chromatography peak of example 2;
FIG. 3 is a peak diagram of liquid chromatography of comparative example 1;
FIG. 4 is a peak chart of liquid chromatography of comparative example 2;
FIG. 5 is a peak image of liquid chromatography of comparative example 3.
Detailed Description
The invention provides a gene for coding penicillin G acylase, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
The nucleotide sequence of the gene for coding the penicillin G acylase is SEQ ID NO.1: gccatgccggccatgccggccggccatgcgccggccggccatgcgccggctggccggccatgctggccggctggccatgctggcgcgcgctggccatgcgctggcgtgccggctggctggcgtgccatgctggctggctggctggctggctggctggctggctggctggcgtgctggctggctggctggctggcgctggctggctggctggctggctggctggctggcgcgctggctggctggcgcgcgctggctggctggctggctggctggctggctggcgcgctggctggcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgctggctggctggcgcgcgcgctggcgcgctggctggctggctggctggctggcgcgcgcgcgcgcgcgctggcgcgcgcgcgctggctggctggctggctggcgcgcgctggctggctggctggctggcgcgctggctggcgcgcgcgcgctggcgctggctggctggcgcgcgctggctggctggctggcgcgcgcgcgcgctggcgcgctggctggctggctggctggcgctggcgcgcgcgcgcgctggctggctggctggcgcgcgctggctggcgcgcgctggctggctggctggctggctggctggctggctggctcgctggctggctggctggctggctggctggctggctggcgctggctggcgcgcgcgctggctggctggctggcgcgcgctcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggctggcgcgctggctggctggctcgctggctggctggctggctggctggctggctggcgcgcgcgcgctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgctggcgcgctggctggcgcgcgcgctggctggctggcgcgcgcgcgctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggcgcgcgctggcgcgcgcgcgctggctggctggctggctggctggctggctggcgcgctggctggcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgctggctggctggctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggcgctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggcgcgcgcgcgcgctggctggcgctggctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgctggcgcgcgcgcgctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgctggctggctggctggctggctggctggcgctggctggctggctggctggctggcgcgcgcgcgcgctggctggctggctggctggctggctggcgcgcgcgctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggctggctggctggctggctggctggcgcgcgcgcgctggctggcgcgcgcgcgctggcgcgcgcgctggctggctggcgctggctggctggctggctggctggctggctggctggctggcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgctggcgcgcgcgcgctggctggcgcgcgcgctggctggcgcgcgcgcgcgcgctggcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgctggctggctggctggctggctggctggctggcgcgcgctggctggctggctggctggcgcgcgcgctggctggctggctggcgcgcgcgctggctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgctggctggcgcgcgcgctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggcgcgctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgctggctggctggctggctggctggctggcgcgcgcgctggctggctggcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggctggcgcgcgcgcgctggctggcgcgcgcgctggctggcgcgcgctggctggcgcgcgctggctggctggcgcgcgcgcgctggctggctggcgctggctggcgctggctggctggcgcgcgctggctggcgctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctg .
In the invention, the gene is obtained by modifying an initial gene of penicillin G acylase, the nucleotide sequence of the initial gene of penicillin G acylase is shown as SEQ ID NO.2, and the nucleotide sequence of the initial gene of penicillin G acylase is shown as SEQ ID NO.2: gctgaggcgcgcgcgcgcgcgccggccatgcgccggccatgcgcgccggccatgcgcgcgctggcaggctggctggcgtgcgcgcgctggcgtgcgcgctggcgtgcgcgctggcgtgccatgctggcgtgctggctggcgtgctggctggcgtgctggctggctggcgtgctggctggctggcgcttagccatgctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggcgcgcgctggctggctggctggctggctggctggctggctggcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgctggctggctggctggcgcgctggctggcgcgctggctggctggcgctggcgctggcgcgcgcatgcgcgcgcgcgcgcgcgctggctggctggctggcgcgctggcgcgctggctggctggctggcgcgctggctggctggcgcgcgcgctggctggctggctggctggcgctggctggcgcgcgctggctggcgcgcgcgcgctggctggcgctggctggctggctggcgcgcgctggcgcgcgcgcgctggctggctggctggcgcgctggctggcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggcgctggctggcgcgcgcgctggcgcgcgcgcgcgctggcgcgcgcgcgctggctggctggcgcgcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgctggcgcgcgcgcgcgcgctggctggctggctggcgcgcgctggctggctggctggctcgctggctggctggctggctggctggctggctggcgctggctggctggctggctggctggctggctggctggcgcgctggctggctggcgcgctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgctggctggcgctggctggcgcgcgcgcgctggctggctggcgcgcgcgcgctggctggcgcgcgcgctggcgcgcgcgcgcgcgcgcgcgctggctggcgcgcgcgctggcgcgcgcgcgctggctggctggctggctggctggctggctggcgcgctggctggcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgctggcgcgcgcgctggctggctggctggcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggcgctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggctggcgcgcgctggctggctggcgctggctggctggcgctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgctggctggcgcgcgcgctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggctggctggctggcgcgctggctggcgcgctggctggctggcgcgcgcgcgctggcgctggctggctggctggctggctggcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgctggctggcgcgcgcgcgctggcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgctggcgcgcgcgctggctggcgcgcgcgcgctggctggctggcgcgcgcgcgctggctggcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgctggctggctggctggcgcgcgcgctggctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgcgctggctggctggcgcgctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggcgcgcgcgctggctggcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggctggcgcgcgcgcgctggctggcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggcgcgcgcgcgcgcgctggcgcgcgcgcgctggctggcgcgcgctggctggcgcgcgctggctggcgcgcgcgcgcgcgctggctggctggcgcgcgcgcgcgcgctggctggcgcgcgcgctggctggctggctggctggctggctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggctggc .
The invention also provides the penicillin G acylase obtained after mutation by the gene expression of the coding penicillin G acylase.
The invention also provides the application of the gene for coding penicillin G acylase or the mutated penicillin G acylase in preparing cefalexin.
The invention also provides a method for preparing cefalexin by the gene for encoding penicillin G acylase, which comprises the following steps:
(1) Constructing an expression vector carrying the gene for coding the penicillin G acylase, transferring the expression vector into escherichia coli to obtain a recombinant expression strain and express the mutated penicillin G acylase;
(2) Immobilizing the mutated penicillin G acylase;
(3) Mixing the 7-amino-3-deacetoxy cephalosporanic acid solution with the mutated immobilized penicillin G acylase at the temperature of 18-22 ℃ to obtain a mixed solution; then, the D-phenylglycine methyl ester hydrochloride solution is dripped into the mixed solution for reaction, and the pH value is maintained to be 7.0 in the reaction process.
In the method for preparing cefalexin, an expression vector carrying the gene for encoding penicillin G acylase is constructed in the step (1), and is transferred into escherichia coli to obtain a recombinant expression strain and express the mutated penicillin G acylase; the nucleotide sequence of the gene for coding the penicillin G acylase is preferably SEQ ID NO.1, and the blank expression vector is preferably a PET28a vector.
In the method for preparing cefalexin, penicillin G acylase is immobilized in the step (2), the recombinant expression strain obtained in the step (1) and a penicillin G acylase mutant obtained by expression are centrifugally concentrated, a concentrated solution is diluted, a diluted solution is homogenized, and acylase cells are broken and the acylase is released into a supernatant; adding flocculant to deposit and filter the cell debris of acylase; adding ammonium sulfate into the filtered clear liquid for ammonium sulfate precipitation, dissolving the obtained precipitate, carrying out secondary ammonium sulfate precipitation, after the secondary ammonium sulfate precipitate is dissolved, passing the dissolved liquid through chromatographic resin, carrying out secondary chromatography on the effluent, and carrying out immobilization, crosslinking, washing and packaging on the effluent of the secondary chromatography to obtain the immobilized enzyme, namely the immobilized penicillin G acylase.
In the method for preparing cephalexin of the invention, the immobilization processing of penicillin G acylase in the step (2) specifically comprises the following steps:
a. and (3) centrifugal concentration: adjusting the pH8.0 of the recombinant expression strain obtained in the step (1) and the penicillin G acylase mutant obtained by expression, and centrifuging and concentrating;
b. homogenizing: homogenizing under 800-900 MPa, 4-6 deg.c and pH 7.0-7.5;
c. filtering, ultrafiltration and concentration: filtering to ensure that the filtrate is clear, and performing ultrafiltration concentration on the filtrate;
d. primary ammonium sulfate precipitation: adding 25% ammonium sulfate into the ultrafiltration concentrated solution, stirring, filtering and dissolving at the pH of 7.2 and the temperature of 8-10 ℃ for 2 hours;
e. secondary ammonium sulfate precipitation: adding 25% ammonium sulfate into the primary ammonium sulfate precipitation solution, stirring, filtering and dissolving at the pH of 7.2 and the temperature of 8-10 ℃ for 2 hours;
f. primary chromatography: feeding the dissolved filtrate into a chromatography tank for adsorption, wherein the feeding speed is 600-700L/h, the feeding pressure is 0.2-0.4 kg, the temperature is 4-10 ℃, the pH value is 6-8, and discharging liquid;
g. and (3) secondary chromatography: continuously feeding the primary chromatography effluent into a chromatography tank for adsorption, wherein the feeding speed is 600-700L/h, the feeding pressure is 0.2-0.4 kg, the temperature is 4-10 ℃, the pH value is 6-8, and the enzyme activity of the effluent is detected;
h. immobilization: resin pretreatment: the amount of resin used was 1500U with 1g of wet resin, addition of activating solution (2 mL of 0.02M phosphate buffer containing 2% glutaraldehyde, pH 8.0), 2mL of activating solution per gram of wet resin, stirring at room temperature for 25Hz/h, and washing with 2 volumes of purified water for 3 times; adding enzyme solution, stirring, adding immobilization solution (0.2M, phosphate buffer solution with pH of 8.0), and controlling the ratio of solution volume to resin weight to be 3: stirring for 4 hours at 1,25Hz; then standing for 4 hours every time, stirring for 10min, fixing for 40-48 hours, and washing for 3 times by using purified water with 2 times of volume; after washing 2 times with 2 volumes of storage buffer (1.0M, phosphate buffer pH 7.0), the immobilized enzyme solution was vacuum filtered until the immobilized enzyme surface appeared granular, and the filtrate was stopped and placed in 1 volume of storage buffer.
In the method for preparing cefalexin, 7-amino-3-desacetoxycephalosporanic acid solution in the step (3) is mixed with immobilized penicillin G acylase after mutation at the temperature of 18-22 ℃ to obtain mixed solution; the mass ratio of the mutated immobilized penicillin G acylase to the 7-amino-3-desacetoxycephalosporanic acid in the 7-amino-3-desacetoxycephalosporanic acid solution is preferably 0.4-1.2, and further preferably 0.6-1.0; the pH value of the 7-amino-3-desacetoxycephalosporanic acid solution is preferably 7.0; the mixing temperature is 18 to 22 ℃, and more preferably 19 to 21 ℃.
In the method for preparing cefalexin, D-phenylglycine methyl ester hydrochloride solution is dropwise added into the mixed solution in the step (3) for reaction, and the pH value is maintained at 7.0 in the reaction process; the mol ratio of the D-phenylglycine methyl ester hydrochloride to the 7-amino-3-desacetoxycephalosporanic acid is preferably 1.05-1.10: 1, more preferably 1.06 to 1.09:1, and still more preferably 1.07 to 1.08; the dripping time is preferably 240-260 min, more preferably 245-255 min, and still more preferably 248-252 min; the reaction temperature is preferably 18 to 22 ℃ and more preferably 19 to 21 ℃.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
(1) Constructing an expression vector carrying a gene which has a nucleotide sequence shown as SEQ ID NO.1 and codes penicillin G acylase by taking PET28a as a blank vector, transferring the expression vector into escherichia coli to obtain recombinant expression escherichia coli, and expressing to obtain mutated penicillin G acylase;
(2) Immobilizing the mutated penicillin G acylase;
(3) The molar ratio of the D-phenylglycine methyl ester hydrochloride to the 7-amino-3-desacetoxycephalosporanic acid is 1.10:1, dropping D-phenylglycine methyl ester hydrochloride into the mutated immobilized penicillin G acylase and 7-amino-3-deacetoxy cephalosporanic acid solution according to the mass ratio of 0.6 and the reaction temperature of 20 ℃, and adopting the immobilized penicillin G acylase obtained in the step (2);
weighing 15G of 7-ADCA in a 200mL beaker, adding 49.5mL of pure water, stirring, adjusting the pH to 7.0 with 3M ammonia water, controlling the temperature to be 20 ℃, and adding 9G of mutated immobilized penicillin G acylase; and weighing 15.53g of D-phenylglycine methyl ester hydrochloride in another beaker, dissolving in cold water, carrying out ice bath all the time, slowly dripping the side chain D-phenylglycine methyl ester hydrochloride into the mother nucleus 7-ADCA solution, dripping for 4 hours, starting reaction at regular time, and maintaining the pH value to be 7.0 by using 3M ammonia water in the reaction process.
Sampling and feeding the reaction solution into a liquid phase after 4 hours of reaction, and detecting the highest point of the 7-ADCA conversion rate;
liquid phase conditions:
column type: inertsil ODS-sp;
mobile phase configuration: adding 900mL of purified water into a 1L beaker, adding 11.53g of phosphoric acid, adding 40mL of acetonitrile, adjusting the pH to 3.0 by using 15% potassium hydroxide solution, and fixing the volume to 1L;
wavelength: 210nm;
temperature: 25 ℃;
flow rate: 1mL/min; the result is shown in figure 1, and the highest reaction conversion rate of 99.74 percent is reached within 4h and 10 min.
Example 2
(1) Constructing an expression vector carrying a gene of the penicillin G acylase with a nucleotide sequence shown as SEQ ID NO.1 by taking PET28a as a blank vector, transferring the expression vector into escherichia coli to obtain recombinant expression escherichia coli, and expressing to obtain mutated penicillin G acylase;
(2) Immobilizing the mutated penicillin G acylase;
(3) The molar ratio of the D-phenylglycine methyl ester hydrochloride to the 7-amino-3-desacetoxycephalosporanic acid is 1.05:1, dropping D-phenylglycine methyl ester hydrochloride into the mutated immobilized penicillin G acylase and a 7-amino-3-deacetoxy cephalosporanic acid solution according to the mass ratio of 0.6 at the reaction temperature of 20 ℃, and adopting the mutated penicillin G acylase obtained in the step (2);
weighing 15G of 7-ADCA in a 200mL beaker, adding 49.5mL of pure water, stirring, adjusting the pH to 7.0 with 3M ammonia water, controlling the temperature to be 20 ℃, and adding 9G of immobilized penicillin G acylase; and weighing 14.82g of D-phenylglycine methyl ester hydrochloride in another beaker, dissolving in cold water, carrying out ice bath all the time, slowly dripping the side chain D-phenylglycine methyl ester hydrochloride into the mother nucleus 7-ADCA solution, dripping for 4 hours, starting reaction at regular time, and maintaining the pH value to be 7.0 by using 3M ammonia water in the reaction process.
Sampling and feeding the reaction solution into a liquid phase after 4 hours of reaction, and detecting the highest point of the 7-ADCA conversion rate;
liquid phase conditions:
column type: inertsilODS-sp;
mobile phase configuration: adding 900mL of purified water into a 1L beaker, adding 11.53g of phosphoric acid, adding 40mL of acetonitrile, adjusting the pH to 3.0 by using 15% potassium hydroxide solution, and fixing the volume to 1L;
wavelength: 210nm;
temperature: 25 ℃;
flow rate: 1mL/min; the result is shown in figure 2, and the highest reaction conversion rate of 99.48% is reached after 4h and 20 min.
Comparative example 1
(1) Constructing an expression vector carrying an initial gene of penicillin G acylase with a nucleotide sequence shown as SEQ ID NO.2 by taking PET28a as a blank vector, transferring the expression vector into escherichia coli to obtain recombinant expression escherichia coli, and expressing to obtain penicillin G acylase;
(2) Immobilizing penicillin G acylase;
(3) The molar ratio of the D-phenylglycine methyl ester hydrochloride to the 7-amino-3-desacetoxycephalosporanic acid is 1.18:1, immobilized penicillin G acylase and 7-amino-3-desacetoxycephalosporanic acid solution according to the mass ratio of 0.6:1, reacting two substrates at 20 ℃, and adopting the immobilized penicillin G acylase obtained in the step (2) as the immobilized penicillin G acylase;
weighing 15G of 7-ADCA and 16.66G of D-phenylglycine methyl ester hydrochloride in a 200mL beaker, adding 99mL of pure water, stirring, adjusting the pH to 7.0 with 3M ammonia water, controlling the temperature to be 20 ℃, adding 9G of immobilized penicillin G acylase, starting the reaction, and maintaining the pH to 7.0 with 3M ammonia water in the reaction process.
Starting to sample and enter a liquid phase after reacting for 3.5 hours, and detecting the highest point of the 7-ADCA conversion rate;
liquid phase conditions:
column type: inertsilODS-sp;
mobile phase configuration: adding 900mL of purified water into a 1L beaker, adding 11.53g of phosphoric acid, adding 40mL of acetonitrile, adjusting the pH to 3.0 by using 15% potassium hydroxide solution, and fixing the volume to 1L;
wavelength: 210nm;
temperature: 25 ℃;
flow rate: 1mL/min; the result is shown in FIG. 3, where 93% of the maximum conversion is reached in 4 h.
Comparative example 2
(1) Constructing an expression vector carrying an initial gene of penicillin G acylase with a nucleotide sequence shown as SEQ ID NO.2 by taking PET28a as a blank vector, transferring the expression vector into escherichia coli to obtain recombinant expression escherichia coli, and expressing to obtain penicillin G acylase;
(2) Immobilizing penicillin G acylase;
(3) The molar ratio of the D-phenylglycine methyl ester hydrochloride to the 7-amino-3-desacetoxycephalosporanic acid is 1.18:1, the immobilized penicillin G acylase and a 7-amino-3-desacetoxycephalosporanic acid solution are mixed according to the mass ratio of 0.6:1, dripping D-phenylglycine methyl ester hydrochloride at the reaction temperature of 20 ℃, and adopting the immobilized penicillin G acylase obtained in the step (2) as the immobilized penicillin G acylase;
weighing 15G of 7-ADCA in a 200mL beaker, adding 49.5mL of pure water, stirring, adjusting the pH to 7.0 with 3M ammonia water, controlling the temperature to be 20 ℃, and adding 9G of immobilized penicillin G acylase; and weighing 16.66g of D-phenylglycine methyl ester hydrochloride in another beaker, dissolving in cold water, carrying out ice bath all the time, slowly dripping the side chain D-phenylglycine methyl ester hydrochloride into the mother nucleus 7-ADCA solution, dripping for 4 hours, starting reaction at regular time, and maintaining the pH value to be 7.0 by using 3M ammonia water in the reaction process.
Sampling and feeding the reaction solution into a liquid phase after 4 hours of reaction, and detecting the highest point of the 7-ADCA conversion rate;
liquid phase conditions:
column type: inertsilODS-sp;
mobile phase configuration: adding 900mL of purified water into a 1L beaker, adding 11.53g of phosphoric acid, adding 40mL of acetonitrile, adjusting the pH to 3.0 by using 15% potassium hydroxide solution, and fixing the volume to 1L;
wavelength: 210nm;
temperature: 25 ℃;
flow rate: 1mL/min; the result is shown in FIG. 4, and the highest reaction conversion rate of 99.48% is reached after 4h10 min.
Comparative example 3
(1) Constructing an expression vector carrying an initial gene of penicillin G acylase with a nucleotide sequence shown as SEQ ID NO.2 by taking PET28a as a blank vector, transferring the expression vector into escherichia coli to obtain recombinant expression escherichia coli, and expressing to obtain penicillin G acylase;
(2) Immobilizing penicillin G acylase;
(3) The molar ratio of the D-phenylglycine methyl ester hydrochloride to the 7-amino-3-desacetoxycephalosporanic acid is 1.10, the immobilized penicillin G acylase and the 7-amino-3-desacetoxycephalosporanic acid solution are 0.6 according to the mass ratio, the reaction temperature is 20 ℃, the D-phenylglycine methyl ester hydrochloride is dropwise added, and the immobilized penicillin G acylase obtained in the step (2) is adopted;
weighing 15G of 7-ADCA in a 200mL beaker, adding 49.5mL of pure water, stirring, adjusting the pH to 7.0 with 3M ammonia water, controlling the temperature to be 20 ℃, and adding 9G of immobilized penicillin G acylase; and weighing 15.53g of D-phenylglycine methyl ester hydrochloride in another beaker, dissolving in cold water, carrying out ice bath all the time, slowly dripping the side chain D-phenylglycine methyl ester hydrochloride into the mother nucleus 7-ADCA solution, dripping for 4 hours, starting reaction at regular time, and maintaining the pH value to be 7.0 by using 3M ammonia water in the reaction process.
Sampling and feeding the reaction solution into a liquid phase after 4 hours of reaction, and detecting the highest point of the 7-ADCA conversion rate;
liquid phase conditions:
column type: inertsilODS-sp;
mobile phase configuration: adding 900mL of purified water into a 1L beaker, adding 11.53g of phosphoric acid, adding 40mL of acetonitrile, adjusting the pH to 3.0 by using 15% potassium hydroxide solution, and fixing the volume to 1L;
wavelength: 210nm;
temperature: 25 ℃;
flow rate: 1mL/min; the result is shown in FIG. 5, and the highest reaction conversion of 96.62% is reached in 4h10 min.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Claims (9)
1. A gene for coding penicillin G acylase is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
2. The gene encoding penicillin G acylase of claim 1 wherein the gene is derived from a penicillin G acylase initial gene having the nucleotide sequence shown in SEQ ID No. 2.
3. A mutated penicillin G acylase obtainable by expression of the gene encoding penicillin G acylase of claim 1.
4. Use of the gene encoding penicillin G acylase of claim 1 or 2 or of the mutated penicillin G acylase of claim 3 for the preparation of cephalexin.
5. Process for the preparation of cephalexin from the gene encoding penicillin G acylase of claim 1 or 2, characterized in that it comprises the following steps:
(1) Constructing an expression vector carrying the gene encoding penicillin G acylase of claim 1, transferring into escherichia coli to obtain a recombinant expression strain and expressing the mutated penicillin G acylase;
(2) Immobilizing the mutated penicillin G acylase;
(3) Mixing the 7-amino-3-deacetoxy cephalosporanic acid solution with the mutated immobilized penicillin G acylase at the temperature of 18-22 ℃ to obtain a mixed solution; then, the D-phenylglycine methyl ester hydrochloride solution is dripped into the mixed solution for reaction, and the pH value is maintained to be 7.0 in the reaction process.
6. Process for the preparation of cephalexin as claimed in claim 5, characterised in that the pH of the 7-amino-3-desacetoxycephalosporanic acid solution in step (3) is 7.0.
7. The process for preparing cephalexin according to claim 5, wherein the mass ratio of the mutated immobilized penicillin G acylase in step (3) to 7-amino-3-desacetoxycephalosporanic acid in the solution of 7-amino-3-desacetoxycephalosporanic acid is 0.4 to 1.2.
8. Process for the preparation of cephalexin according to claim 5, characterised in that in step (3) the molar ratio of D-phenylglycine methyl ester hydrochloride to 7-amino-3-desacetoxycephalosporanic acid is between 1.05 and 1.10:1.
9. process for the preparation of cephalexin according to claim 5, characterised in that the dropwise addition in step (3) is carried out for a period of 240 to 260min and in that the reaction temperature is 18 to 22 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211671280.XA CN115851786A (en) | 2022-12-26 | 2022-12-26 | Gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211671280.XA CN115851786A (en) | 2022-12-26 | 2022-12-26 | Gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115851786A true CN115851786A (en) | 2023-03-28 |
Family
ID=85654602
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211671280.XA Pending CN115851786A (en) | 2022-12-26 | 2022-12-26 | Gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115851786A (en) |
-
2022
- 2022-12-26 CN CN202211671280.XA patent/CN115851786A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO1997004086A1 (en) | An improved immobilized penicillin g acylase | |
| EP2173892B1 (en) | Process for the preparation of penicillin or cephalosporin antibiotics | |
| US6503727B1 (en) | Process for the preparation of an antibiotic | |
| CN101671349B (en) | New method for preparing cefuroxime sodium compound | |
| EP0283218B1 (en) | One-step enzymatic conversion of cephalosporin c and derivatives to 7-aminocephalosporanic acid and derivatives | |
| CN115851786A (en) | Gene for coding penicillin G acylase and application of expressed mutated penicillin G acylase in preparation of cefalexin | |
| EP2513327B1 (en) | Production process for cephradine | |
| EP0730036B1 (en) | Process for the enzymatic synthesis of beta-lactam antibiotics in the presence of an enzyme inhibitor | |
| EP1075479A1 (en) | A method for crystallizing a beta-lactam antibiotic | |
| US6319684B1 (en) | Process for the fermentative production of cephalosporin | |
| EP0638649B1 (en) | New use of alcaligenes faecalis penicillin G acylase | |
| CZ148593A3 (en) | Process of separating a non-dissolved catalyst from one or a plurality of other non-dissolved components comprised in the same reaction mixture | |
| EP1416054B1 (en) | Simple enzymatic process for preparing cefazolin | |
| CN103108879B (en) | For the method producing cephalosporins | |
| WO2002020819A2 (en) | AN ENZYMATIC PROCESS FOR PREPARING β-LACTAM COMPOUNDS | |
| RU2537845C2 (en) | Method of synthesising peptides, including beta-lactam antibiotics with application of penicillin acylase version | |
| Bayer | 7-Aminocephalosporanic acid—chemical versus enzymatic production process | |
| JP2000512860A (en) | How to prepare β-lactam antibiotics | |
| JPH08242884A (en) | Enzyme preparation of penicillin and cephalosporin | |
| Ye-Wang et al. | Effect of substrate concentration on the synthesis of cefaclor by penicillin acylase with in situ product removal | |
| WO1998056945A1 (en) | PROCESS FOR ENZYMATICALLY PREPARING A β-LACTAM ANTIBIOTIC AND THIS ANTIBIOTIC | |
| KR100517235B1 (en) | Improved process for the fermentative production of cephalosporin | |
| MXPA00010537A (en) | A METHOD FOR CRYSTALLIZING A&bgr;-LACTAM ANTIBIOTIC | |
| CS218023B1 (en) | Method of enzymatic production of the 7-aminodesacetoxycefal acid | |
| KR20010069097A (en) | Process for preparation of β-lactam antibiotics by enzymatic acylation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |