CN115851745A

CN115851745A - Application of substance for regulating Esrrb activity in preparation of product for intervening retinoschisis

Info

Publication number: CN115851745A
Application number: CN202211281658.5A
Authority: CN
Inventors: 雷博; 刘婧阳; 王卫萍; 靳秀秀; 郝冰涛
Original assignee: Henan Provincial Peoples Hospital
Current assignee: Henan Provincial Peoples Hospital
Priority date: 2022-10-19
Filing date: 2022-10-19
Publication date: 2023-03-28
Anticipated expiration: 2042-10-19
Also published as: CN115851745B

Abstract

The invention provides application of a substance for regulating Esrrb activity in preparation of a product for intervening retinoschisis, and relates to the technical field of biology. The retinal cleavage disease intervened by a substance for regulating Esrrb activity is mainly retinal cleavage disease caused by RS1 gene mutation or deletion; esrrb can also be used as a target point to be applied to the expression of the regulation and control visual function protein for non-diagnosis and treatment purposes, and the technical problem of poor treatment effect on the product for treating the retinoschisis caused by RS1 gene mutation or deletion in the prior art is solved.

Description

Application of substance for regulating Esrrb activity in preparation of product for intervening retinoschisis

Technical Field

The invention relates to the technical field of biology, in particular to application of a substance for regulating Esrrb activity in preparation of a product for intervening retinoschisis.

Background

X-Linked congenital Retinoschisis (XLRS) is a common early-onset central retinal degenerative disease, has a worldwide morbidity of 1/5000-1/25000, and is one of the leading causes of male juvenile macular degeneration. XLRS affects mainly both eyes and is clinically characterized by progressive central vision loss, foveal cleavage-induced radial streaks, cleavage between peripheral retinal layers, retinal detachment, and vitreous hemorrhage. Currently, no effective treatment method for XLRS exists, and clinical observation and treatment of complications are mainly taken. The gene mutation is the main reason of XLRS, and the pathogenic gene is RS1.RS1 encodes a retinal cleavage protein 1 (retinospisin 1, rs1) that plays an important role in retinal development and maintenance of structure. RS1 mutation causes RS1 protein dysfunction, such as RS1 synthesis and secretion blockage, and the like, and further causes Muller cell fiber dysfunction, thereby causing retina cleavage. Gene therapy is the main treatment means of XLRS at present, but the curative effect of clinical trials is not ideal. However, there are currently no other palliative or therapeutic approaches worldwide other than gene therapy. Therefore, how to improve therapeutic products of XLRS is a problem to be solved.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention aims to provide application of a substance for regulating Esrrb activity in preparing a product for intervening retinoschisis and a method for regulating expression of an opsin for non-diagnosis and treatment purposes based on the intervention effect of a orphan estrogen receptor Esrrb in retinoschisis caused by RS1 gene mutation or deletion, and solves the technical problem of poor treatment effect of products for treating retinoschisis caused by RS1 gene mutation or deletion in the prior art.

In order to solve the technical problems, the invention adopts the following technical scheme:

according to one aspect of the invention, the invention provides the application of a substance for regulating Esrrb activity in preparing a product for intervening retinoschisis; the retinoschisis is caused by RS1 gene mutation or deletion.

Preferably, the retinoschisis is X chromosome-linked congenital retinoschisis;

or, the retinoschisis is caused by knockout of mammalian RS1 gene.

Preferably, the mammal comprises a mouse, rat, rabbit, pig, cow, dog, monkey, or human;

preferably, the mammal comprises a mouse.

Preferably, the product for intervening in retinoschisis is a product for preventing, treating or relieving retinoschisis, and the substance for regulating Esrrb activity is an Esrrb expression vector or Esrrb agonist;

preferably, the Esrrb agonist comprises DY131.

Preferably, the product for intervening in retinoschisis is a product for aggravating retinoschisis, and the substance for regulating Esrrb activity is an Esrrb inhibitor;

preferably, the Esrrb inhibitor comprises siRNA, shRNA or miRNA;

preferably, the Esrrb inhibitor is an siRNA;

preferably, the nucleotide sequence of the siRNA is shown in Seq _1 or Seq _ 7.

According to another aspect of the invention, there is also provided a method of modulating the expression of an opsin protein for non-diagnostic and therapeutic purposes, comprising modulating the activity of Esrrb to achieve modulation of the expression level of an opsin protein;

preferably, the opsin protein includes one or more of Rho, rgs9 and Kcnb 1.

Preferably, the expression of the regulatory opsin protein is up-regulation of the opsin protein, and the regulation of Esrrb activity comprises overexpression of Esrrb protein, or the Esrrb activity is improved by using Esrrb agonist;

preferably, the expression of the up-regulated visual function protein is up-regulated expression of a Kcnb1 protein;

preferably, the Esrrb agonist comprises DY131;

preferably, the expression of the visual function protein is up-regulated to the expression of the visual function protein of the RS1 gene knockout mammal;

preferably, the RS1 knockout mammal is an RS1 knockout mouse.

Preferably, the regulating expression of the opsin protein is down-regulating expression of the opsin protein, and the regulating activity of Esrrb comprises down-regulating expression of Esrrb using an Esrrb inhibitor;

preferably, the down-regulating expression of a visual function protein comprises down-regulating expression of one or more of Rho, rgs9 and Kcnb 1;

preferably, the Esrrb inhibitor comprises siRNA, shRNA or miRNA;

preferably, the Esrrb inhibitor is an siRNA;

preferably, the nucleotide sequence of the siRNA is shown in Seq _1 or Seq _ 7.

According to another aspect of the invention, the invention also provides an siRNA for silencing Esrrb, and the nucleotide sequence of the siRNA is shown in Seq _ 1.

According to another aspect of the invention, the invention also provides a product for down-regulating expression of a visual function protein, the product comprising the siRNA.

Compared with the prior art, the invention has the following beneficial effects:

the orphan nuclear estrogen receptor Esrrb (orphan nuclear hormone receptor-related receptor β), also known as Nr3b2, is one of the important members of the estrogen receptor family. At present, the medicines taking Esrrb as a target point are mainly hormone analogues and are used for treating climacteric and postmenopausal disorders. The orphan estrogen receptor Esrrb is never applied as an action target of a therapeutic drug for eye diseases.

The invention discovers that Esrrb is related to the expression of an opsin protein. Esrrb in wild-type mouse MEF cells was knocked down to down-regulate visual function protein expression. Expression of an opsin protein is also reduced in RS1 knock-out mice. The mouse Esrrb protein is knocked out by over-expressing the RS1 gene, and the expression of the visual function protein is recovered. The Esrrb agonist is applied to the RS1 gene knockout mouse, the cleavage cavity of the mouse is obviously reduced through OCT observation, and the result proves that the retina form of the RS1 gene knockout mouse can be obviously improved by improving the Esrrb activity.

Based on the discovery, the application of the substance for regulating Esrrb activity in the preparation of the product for intervening retinal cleavage disease can provide a new drug target for intervening retinal cleavage disease caused by RS1 gene mutation or deletion. Meanwhile, the provided method for regulating the expression of the visual function protein for non-diagnosis and treatment purposes provides an important research means for researching the visual function protein and related mechanisms or pathological symptoms thereof.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the immunofluorescence results of the wild-type mouse MEF cells in example 2;

FIG. 2 shows the results of immunofluorescence of the Rs1 knock-out mouse MEF cells in example 2;

FIG. 3 is a graph of the effect of knockdown of Esrrb on the expression of an opsin protein in murine MEF cells in example 2;

FIG. 4 is a graph of the effect of Esrrb on the expression of an opsin in mouse MEF cells over-expressed in example 2;

FIG. 5 shows the result of DNA identification of Rs1 knockout mice in example 1;

FIG. 6 shows the expression of the Rs1 protein in the retinas of the wild mouse and the Rs1 knockout mouse in example 1;

FIG. 7 is the retinal morphology of the Rs1 knockout mice in example 3 following intraperitoneal injection of Esrrb agonist.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be apparent that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Generally, the nomenclature used, and the techniques thereof, in connection with the cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly employed in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references, and laboratory procedures and techniques thereof are those well known and commonly used in the art.

It should be noted that:

in the present invention, all embodiments and preferred methods mentioned herein may be combined with each other to form a new technical solution, if not specifically stated; all the technical features mentioned herein, as well as preferred features, can be combined with each other to form new solutions; the components concerned or their preferred components can be combined with one another to form new solutions.

The orphan nuclear estrogen receptor Esrrb (orphan nuclear hormone receptor-related receptor beta), also known as Nr3b2, is an estrogen receptorOne of the important members of the body family. Esrrb is significantly expressed in retinal photoreceptor cells. Overexpression of Esrrb induces NrL in the absence of rod photoreceptors ^-/- Both mice and wild-type mice express rod-like specific genes such as rhodopsin Rho, slc24a1, etc. At present, the medicines taking Esrrb as a target point are mainly non-steroidal estrogen hormones, such as diethylstilbestrol, estradiol, tamoxifen and the like. These drugs are mainly used as hormone analogues for menopausal and postmenopausal disorders, and the orphan nuclear estrogen receptor Esrrb has never been applied in the treatment of ocular diseases.

Experiments show that the expression of the visual function proteins Rho, rgs9 and Kcnb1 in an RS1 gene knockout mouse (Rs 1-KO) MEF cell is reduced, meanwhile, siRNA is used for knocking down Esrrb in a wild mouse MEF cell, the expression of the visual function proteins Rho, rgs9 and Kcnb1 is also reduced, and the result shows that the Esrrb is related to the expression of the visual function proteins.

Furthermore, the inventor finds that the over-expression of Esrrb can up-regulate the expression of the visual function protein Kcnb1 by over-expressing Esrrb protein in Rs1-KO mouse MEF cells, and shows that the over-expression of Esrrb protein in an RS1 gene knockout cell line can recover the function of the reduction of the visual function protein expression caused by the deletion of an RS1 gene.

Further, the inventors applied the Esrrb agonist DY131 to Rs1-KO mice, observed the morphology of the Rs1-KO mice by OCT (clinical coherence tomography), and found that the cleavage cavity of the Rs1-KO mice applied with the Esrrb agonist DY131 was significantly reduced compared to the blank control, and as a result, confirmed that the improvement of Esrrb activity could significantly improve the retinal morphology of the Rs1-KO mice.

Based on the above findings, in some alternative embodiments, there is provided a use of a substance that modulates Esrrb activity in the preparation of a product for intervening retinoschisis.

Wherein "a substance that modulates Esrrb activity" refers to a substance that increases or decreases Esrrb activity. Increasing the Esrrb activity is optionally achieved by increasing the expression level of endogenous Esrrb or exogenous Esrrb, or alternatively by increasing the Esrrb activity of the cell or the body itself; reducing the Esrrb activity is optionally downregulating Esrrb expression in a cell or body, or alternatively reducing the Esrrb activity of the cell or body itself. Wherein increasing or decreasing Esrrb activity is compared to wild type Esrrb activity without intervention.

"intervening with retinoschisis" includes preventing, treating or ameliorating retinoschisis; alternatively, retinoschisis is exacerbated. I.e. aggravating or alleviating, by intervention, retinoschisis, or preventing, when not suffering from retinoschisis.

The retinal cleavage disease regulated in the above embodiment is retinal cleavage disease caused by RS1 gene mutation or deletion. RS1 gene mutations include, but are not limited to, point mutations, or deletion, insertion and cleavage site mutations. The retinal cleavage disease caused by RS1 gene mutation can be X chromosome linkage congenital retinal cleavage disease (XLRS), or retinal cleavage disease caused by artificially mutating RS1 gene, such as retinal cleavage disease obtained by constructing a retinal cleavage disease animal model. Optionally, the retinal cleavage disease is caused by the knockout of mammalian RS1 gene. Wherein the mammal comprises mouse, rat, rabbit, pig, cow, dog, monkey or human. Experiments prove that the increase of the Esrrb activity of the RS1 gene knockout mouse relieves the retinal cleavage of the RS1 gene knockout mouse, so that at least in one embodiment, the substance for regulating the Esrrb activity can be used for preparing a product for intervening the retinal cleavage of the RS1 gene knockout mouse.

In some alternative embodiments, the product for intervening in retinoschisis is a product for preventing, treating or relieving retinoschisis, and the substance for regulating the activity of Esrrb is an Esrrb expression vector or Esrrb agonist. The Esrrb expression vector is transformed into a host and can express exogenous Esrrb protein in the host, thereby up-regulating Esrrb expression, increasing Esrrb number and achieving the purpose of improving Esrrb activity in cells or organisms. The Esrrb agonist can enhance Esrrb activity and promote downstream reaction, thereby achieving the purpose of enhancing the Esrrb activity in cells or organisms. One example of an Esrrb agonist is DY131 (CAS: 95167-41-2), DY131 (GSK 9089) is a selective agonist of ERR β and ERR γ, with very low activity on ERR α, ER α and ER β.

In some alternative embodiments, the product for intervening in retinoschisis is a product for aggravating retinoschisis, and the substance that modulates the activity of Esrrb is an Esrrb inhibitor. An Esrrb inhibitor refers to a substance that is capable of down-regulating the expression of Esrrb in a cell or body, or alternatively, a substance that reduces the activity of Esrrb in the cell or body itself. Esrrb inhibitors include, but are not limited to, siRNA, shRNA, or miRNA, all of which are capable of silencing Esrrb expression in a cell, reducing Esrrb levels in a cell or body, and thereby reducing Esrrb activity. An example of an Esrrb inhibitor is an siRNA with a nucleotide sequence as shown in Seq _1 or Seq _ 7.

The expression quantity of the visual function protein is also found to be changed while the intervention of the retinal cleavage disease is realized by regulating the Esrrb activity. Thus in further alternatives, there is provided a method of modulating the expression of an opsin protein for non-diagnostic and therapeutic purposes, wherein the opsin protein includes, but is not limited to, one or more of Rho, rgs9 and Kcnb 1. Experiments show that the Esrrb activity in cells or hosts is changed, and the expression amount of the visual function protein is changed.

In some alternative embodiments, modulating expression of an opsin is upregulating expression of the opsin and modulating Esrrb activity comprises overexpressing an Esrrb protein or increasing Esrrb activity using an Esrrb agonist. The expression of the up-regulated visual function protein is preferably up-regulated expression of a Kcnb1 protein, and is preferably up-regulated expression of the Kcnb1 protein through overexpression Esrrb; if an Esrrb agonist is used to upregulate opsin expression, an alternative example of an Esrrb agonist includes DY131. The up-regulation of the expression of the visual function protein can be selected from up-regulation of the expression of the visual function protein of an RS1 gene knockout mammal, wherein the mammal includes but is not limited to a mouse, a rat, a rabbit, a pig, a cow, a dog, a monkey or a human. The RS1 gene knockout mammal is preferably an RS1 gene knockout mouse.

In other alternative embodiments, modulating expression of an opsin protein is down-regulating expression of an opsin protein, modulating Esrrb activity comprises down-regulating Esrrb expression using an Esrrb inhibitor, down-regulating expression of an opsin protein includes, but is not limited to, down-regulating expression of one or more of Rho, rgs9, and Kcnb 1. Wherein the Esrrb inhibitor includes but is not limited to siRNA, shRNA or miRNA, such as siRNA with nucleotide sequence shown in Seq _1 or Seq _ 7. The SiRNA may also optionally be modified in a manner known in the art, such as by adding two thymines at the 3' end to improve the stability of the SiRNA, the sequence of which is shown in Seq _ 7.

The invention also provides the siRNA for silencing Esrrb, and experiments prove that the expression level of the visual function proteins Rho, rgs9 and Kcnb1 is reduced by using the siRNA for silencing Esrrb. Correspondingly, the invention also provides a product for down regulating expression of the visual function protein, which comprises the siRNA.

The technical scheme and the technical effect of the invention are further explained by combining the preferred embodiments.

Example 1

Construction of Rs1 knockout mice

(1) Preparation of sgRNA and Cas9-mRNA:

the Rs1-gRNA1 sequence is GTTAACTGTAAGGCGAGTAAT (5 'to3', seq _ 2),

the Rs1-gRNA2 sequence is GAGACTCGTGGGCCATACGCC (5 'to3', seq _ 3).

And carrying out PCR amplification by taking the sgRNA-Vector as a template to obtain a DNA fragment of Rs1-sgRNA, and then recovering the DNA fragment as a template for in vitro transcription of the sgRNA. Then carrying out sgRNA in-vitro transcription and purification recovery, subpackaging and storing in a refrigerator at minus 80 ℃ for later use. And linearizing the Cas9 transcription vector, and performing in-vitro transcription, purification, recovery, split charging and storage in a refrigerator at-80 ℃ for later use.

(2) Microinjection: cas9-mRNA and Rs1-sgRNA were co-microinjected into C57 mouse embryos, which were then transplanted into the oviducts of surrogate recipient mice.

(3) Embryo transplantation and F0 mouse identification and propagation: and (3) returning the fertilized eggs after microinjection to the oviducts of the surrogate mother mice, wherein the mice are born about 21 days after embryo transplantation, and the genotype identification is completed about 2 weeks after the birth.

(4) Phenotypic characterization of Rs1-KO mice:

DNA extracted from the Rs1 knock-out mouse tail is subjected to PCR identification homozygote, the sequence of a PCR primer is shown in Table 1, sequencing comparison proves that an XLRS model mouse is successfully constructed, as shown in FIG. 5, homo (+ +) represents an Rs1-KO mouse homozygote, het (+ -) represents an Rs1-KO mouse heterozygote, WT represents a wild mouse, and the primer and the target fragment used in each group are shown in Table 2. Through the Founder mouse sequence alignment and immunofluorescence research, the Rs1 protein (green fluorescence) is visible in the retina of a wild mouse, while the Rs1-KO mouse retina does not express the Rs1 protein, and as shown in figure 6, the XLRS model mouse is proved to be successfully constructed.

TABLE 1

/>

TABLE 2

	RS1-KO-CF/RS1-KO-CR	RS1-WT-F/RS1-KO-CR
			WT	Without strips	350bp
heter(+/-)	670bp	350bp
			Homo(+/+)	670bp	Without strips

Example 2

Effect of Esrrb on XLRS cell model

(1) MEF cell line for constructing XLRS disease model Rs1-KO mouse

1.Rs1 knockout mice (and control mice) were sacrificed by carbon dioxide inhalation and soaked in 75% alcohol for 13.5 days of pregnancy. The abdomen was then swabbed with 75% ethanol, the abdomen was cut with a sterile instrument, and the uterus was removed and placed in a 10cm petri dish and rinsed with PBS. The membranes were cut with scissors, embryos removed, transferred to a new 10cm petri dish, and the placenta and other maternal tissues removed. The head (eyes and above) was cut away and all internal organs were removed, leaving the extremities of the mice. Washed with sterile PBS. The embryo bodies were placed in separate 10cm plates, the embryos were minced, and then 10ml of trypsin was added for digestion (to cover the cells with trypsin). Incubate at 37 ℃ for 30-45 minutes in cell incubator until more cells are digested and overflow, add equal amount of MEF medium (90% DMEM +10 FBS +1% P/S) to terminate digestion. The cells were harvested by gentle pipetting, and after aspiration of the supernatant through a 200 mesh cell screen, centrifugation at 1000 rpm for 5 minutes. The cells were then resuspended, the cell suspension transferred to a culture flask and 10mL MEF medium was added and the cells were allowed to grow to confluency (3-4 days).

Identification of MEF cell lines

MEF cells were seeded in 24-well plates, the medium was aspirated after cell attachment and washed with PBS, 0.1% Triton X-100 was added and permeabilized 30min at room temperature, PBS washed three times. Incubate 5% BSA block for 2 hours and wash with PBS. The Vimentin antibody was added and incubated overnight at 4 ℃. The next day, a fluorescent secondary antibody was added and incubated for 2 hours at room temperature in the dark. Washing with PBS, adding DAPI dye solution, and incubating for 5min in dark. After washing, the images were observed and photographed using a fluorescence microscope. Immunofluorescence results for wild-type mouse MEF cells and Rs1-KO mouse MEF cells are shown in FIGS. 1 and 2.

(2) Downregulation of Esrrb may result in reduced expression of an opsin protein

Wild type mouse MEF (WT-MEF) cells were plated in 6-well plates at 2.5X 10 ⁵ Well cells, by transfection of siRNA, 3. Mu.l per well (10. Mu.M working concentration)) siRNA (GGAUGGAGAUUCUCAUCUUtt, seq _ 7) and 9. Mu.l of liprNAiMax transfection reagent, cells were harvested after 48h, and proteins were extracted. WB experiments demonstrated that knocking down Esrrb down regulated the expression of visual function proteins. Expression of the opsfunctional proteins Rho, rgs9, kcnb1 in Rs1 knock-out mouse MEF cells (Rs 1-KO-MEF) was reduced compared to wild-type mouse MEF (WT-MEF) cells. Expression of the visual function proteins Rho, rgs9, kcnb1 was down-regulated after knockdown of Esrrb by siRNA in wild-type mouse MEF (WT-MEF) cells, and the results are shown in FIG. 3. As can be seen in fig. 3, knockdown of Esrrb down-regulates expression of visual function proteins. Expression of the opsfunctional proteins Rho, rgs9, kcnb1 in Rs1 knock-out mouse MEF cells (Rs 1-KO-MEF) was reduced compared to wild-type mouse MEF (WT-MEF) cells. Expression of visual function proteins Rho, rgs9 and Kcnb1 can be reduced after Esrrb is knocked down by siRNA in wild mouse MEF (WT-MEF) cells, which shows that Esrrb is related to expression of visual function proteins, and the expression of Esrrb is reduced to reduce the expression of the visual function proteins.

(3) Esrrb up-regulation can save visual function protein damage caused by RS1 deletion

Rs1 knockout mouse MEF (Rs 1-KO-MEF) cells were plated in 6cm dishes at 8X 10 ⁵ Cells were harvested 48h after each dish by transfection of pcDNA3.1-Esrrb plasmid, 6. Mu.g DNA and 20. Mu.l transfection reagent per well and protein was extracted. The results are shown in fig. 4, and it can be seen from fig. 4 that overexpression of Esrrb in Rs1 knockout mouse MEF cells (Rs 1-KO-MEF) can up-regulate the expression of visual function protein Kcnb1, and WB experiments confirm that overexpression of Esrrb can up-regulate the expression of visual function protein Kcnb 1.

Example 3

Therapeutic effect of Esrrb agonist DY131 on XLRS mouse model Rs1-KO mouse

(1) Treatment of XLRS mice

Rs1-KO mice were divided into two groups of 10-15 mice each. PBS and Esrrb agonist DY131 (CAS: 95167-41-2) were injected intraperitoneally 7 days after birth of Rs1-KO mice, respectively, at 1mg/kg, and were administered every other day for two months. Low dose stimulation Rs1-KO mice activate the Esrrb receptor.

(2) DY131 can improve visual function of XLRS mice

The morphology of the Rs1-KO mice injected with Esrrb agonist DY131 in the abdominal cavity was observed by OCT at 15D, 1M, 1.5M and 2M, respectively. The results are shown in fig. 7, and the cleavage cavities of Rs1-KO mice injected with Esrrb agonist DY131 in the abdominal cavity are remarkably reduced compared with that of a blank control (PBS) after two months of continuous administration, and the results prove that DY131 treatment group can obviously improve the retinal morphology of Rs1-KO mice.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of a substance for regulating Esrrb activity in preparing a product for intervening retinoschisis; the retinoschisis is caused by RS1 gene mutation or deletion.

2. The use of claim 1, wherein the retinoschisis is X-chromosome-linked congenital retinoschisis;

or, the retinoschisis is caused by knockout of mammalian RS1 gene.

3. The use of claim 2, wherein the mammal comprises a mouse, rat, rabbit, pig, cow, dog, monkey, or human;

preferably, the mammal comprises a mouse.

4. The use according to any one of claims 1 to3, wherein the product for intervening retinoschisis is a product for preventing, treating or alleviating retinoschisis, and the substance for regulating Esrrb activity is an Esrrb expression vector or an Esrrb agonist;

preferably, the Esrrb agonist comprises DY131.

5. The use according to any one of claims 1 to3, wherein the product for intervening retinoschisis is a product for aggravating retinoschisis, and the substance that regulates Esrrb activity is an Esrrb inhibitor;

preferably, the Esrrb inhibitor comprises siRNA, shRNA or miRNA;

preferably, the Esrrb inhibitor is an siRNA;

preferably, the nucleotide sequence of the siRNA is shown in Seq _1 or Seq _ 7.

6. A method for regulating the expression of an opsin protein for non-diagnostic and therapeutic purposes, comprising regulating the activity of Esrrb to achieve regulation of the expression level of the opsin protein;

preferably, the opsin protein includes one or more of Rho, rgs9 and Kcnb 1.

7. The method of claim 6, wherein the modulating expression of an opsin is up-regulating expression of an opsin, and the modulating Esrrb activity comprises overexpressing Esrrb protein or increasing Esrrb activity using an Esrrb agonist;

preferably, the Esrrb agonist comprises DY131;

preferably, the RS1 knockout mammal is an RS1 knockout mouse.

8. The method of claim 6, wherein the modulating expression of an opsin is down-regulating expression of an opsin, and the modulating Esrrb activity comprises down-regulating Esrrb expression using an Esrrb inhibitor;

preferably, the Esrrb inhibitor comprises siRNA, shRNA or miRNA;

preferably, the Esrrb inhibitor is an siRNA;

preferably, the nucleotide sequence of the siRNA is shown in Seq _1 or Seq _ 7.

9. siRNA for silencing Esrrb, wherein the nucleotide sequence is shown as Seq _ 1;

preferably, said siRNA is modified;

preferably, the nucleotide sequence of the modified siRNA is shown as Seq _ 7.

10. A product for down-regulating expression of a visual function protein comprising the siRNA of claim 9.