CN115851732B

CN115851732B - Sebastes schlegeli male sex reversal interference fragment, recombinant strain and application thereof

Info

Publication number: CN115851732B
Application number: CN202211538047.4A
Authority: CN
Inventors: 贺艳; 侯梦玥; 宋宗诚; 宋伟豪; 岳新璐; 齐洁; 张全启
Original assignee: Weihai Shenghang Marine Technology Co ltd; Ocean University of China
Current assignee: Weihai Shenghang Marine Technology Co ltd; Ocean University of China
Priority date: 2022-12-02
Filing date: 2022-12-02
Publication date: 2023-07-04
Anticipated expiration: 2042-12-02
Also published as: CN115851732A

Abstract

The invention relates to a Sebastes schlegeli male sex reversal interference fragment, recombinant bacteria and application thereof, belonging to the field of molecular biology, wherein the nucleotide sequence of the interference fragment is shown as SEQ ID NO. 1. Recombinant bacteria containing the interference fragment can knock down Semicatida schlegeli sex determination key genes in sex determination periodamhr2The expression of the gene is induced to produce female fish with XY genotype, and a novel means is provided for the acquisition of the monosomic culture of the Sebastes schlegeli.

Description

Sebastes schlegeli male sex reversal interference fragment, recombinant strain and application thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a schwann male sex reversal interference fragment, recombinant bacteria and application thereof.

Background

Sebastes schlegeli (Sebastes schlegelii) belonging to the genus Sebastes of the order Sebastes, the family Sebastes, also known as black rockfish, commonly known as snakehead, black village, black wife, etc., is an off-shore bottom fish distributed in the northwest of the Pacific ocean. The sea water aquaculture fish has the advantages of tender meat, delicious taste, capability of naturally overwintering in the north, and the like, and becomes an important sea water aquaculture economic fish in the north of China. However, with the expansion of the cultivation scale, the problems of disease frequency, cultivation benefit reduction and the like are gradually developed under the influence of factors such as cultivation environment, bait feeding, inbreeding and the like, and the development of industry is severely restricted.

Hermaphroditic refers to the phenomenon of significant differences in the growth of male and female individuals in larger populations or larger populations, as a result of long-term interactions between natural selection and sex selection. This difference is more pronounced in aquaculture conditions. Research data show that the growth process of Selaginella schlegeli exhibits obvious sex dichotomy, and female individuals of the same age are about 25% compared with male individuals. Therefore, the female growth advantage is utilized to carry out the full female monospecific culture, the culture yield can be greatly improved, the method has good industrial prospect, and the aquaculture benefit of the sebastes schlegeli is remarkably improved. The current common approaches for obtaining parthenocarpic culture include artificial separation of male and female individuals, interspecific hybridization to produce all-male/all-female offspring, or artificial sex control using hormone treatment. However, the high time and economic costs of the first two methods, as well as the threat of hormone treatment to the environment, have greatly limited their use in the cultivation process.

Early studies found that sex determination of sebastes schlegeli was completed within 100 days after birth. Morphological observation shows that the female gonads of the sebastes schlegeli are in an ovarian cavity structure about 25 days after birth, which means female sex determination; about 85 days after birth, the male gonads appear to resemble the structure of a seminiferous duct, meaning male sex determination. Recent studies report that the sex-determining type of Sebastes schlegeli is XX/XY type, and that the amy gene is its male sex-determining gene. Amhy protein acts as a ligand, binding to the type II receptor Amhr2, mediates downstream TGF-beta signaling pathways to facilitate sex determination in male individuals. Overexpression of the amy gene can induce sex reversal of female individuals to male; while inhibiting the expression of the receptor amhr2 gene can block TGF-beta signaling pathway transmission, so that the amhy gene signaling is blocked, and the male individual is reversed to female. Therefore, the sex determination key gene amyy/amhr 2 expression in the sebastes schlegeli body is regulated in the sex determination period, so that the sex of the sebastes schlegeli individuals can be reversed, and pseudo-male/pseudo-female individuals can be obtained. The individual is subjected to sexual inversion by regulating the gene expression of the species, so that the method has the characteristics of low cost and high efficiency, and has less influence on the environment.

Disclosure of Invention

The invention aims to provide a Sebastes schlegeli male sex reversal interference fragment, recombinant bacteria and application thereof, wherein the recombinant bacteria can knock down the expression of Sebastes schlegeli sex determination key gene amhr2 in the sex determination period, can induce to generate female fish with XY genotype, provides a novel means for acquiring Sebastes schlegeli monospecific culture, and simultaneously provides a novel method for sex control of Sebastes schlegeli.

The invention achieves the above object by the following scheme:

an interference fragment of the male sex reversal of the sebastes schlegeli, wherein the nucleotide sequence of the interference fragment is shown as SEQ ID NO. 1.

A recombinant bacterium for inducing male sex reversal of sebastes schlegeli, the recombinant bacterium comprising sebastes schlegeli amhr2 gene interference fragment SEQ ID No.1, L4440 nematode RNAi interference vector and HT115 strain.

The nucleotide sequence of the interference fragment is as follows:

atgacatggcaacagtggtggacgtttttggctgtggaatgcatctttatatgcatctccggccagtcttttc

ctcaaaggagacggtgtgctttccaagtgactcctcagaacaacatatacgaaactgctggcaatgtgag

cgggtcggtgcagctctgtgagaacacccaatgctgcgttggctattttcttatccacgatggccagccaa

aggttgacgttctcgcttgtgatatggctgaaaagttttgcccggatgcaacctgcaaggcacaaacacg

cttcgacgggcgcctcgttgtctgcgtgtgcaacacagacctctgcaatagcaacatcacttggacccca

gagttggaagagcctcgacccacctactctcattttgtagctgccttaatcattctgactttgctagtcctgtg

cttcctgttgatcgctgcagccaaatggacaagccaatttacaaagaaaaaggataatccaccctcccttgatgattacagtgtc.

the invention also provides a preparation method of the recombinant bacterium, which comprises the steps of constructing the nucleotide sequence SEQ ID NO.1 of the interference fragment on an L4440 nematode RNAi interference vector, and then introducing an escherichia coli HT115 strain to obtain the recombinant bacterium.

The invention also provides application of the recombinant bacterium, and the application method comprises the following steps:

and culturing and propagating the recombinant bacteria to an OD value of 0.4, after induction, re-suspending the bacteria according to the ratio of 1mL of re-suspending culture medium to 200mL of initial bacterial amount, sucking the re-suspended induced bacteria according to the ratio of 1mL/200 fish/day, mixing with bait, and feeding the Sebastes zeylanicus fries in the sex determination period for 90 days.

Further, the feeding time is from 5 days after the juvenile of the Sebastes schlegeli, to 95 days after birth.

Further, the baits are rotifer, artemia and pellet feed in sequence.

Compared with the prior art, the invention has the beneficial effects that:

1) Compared with the traditional technology of generating pseudo-female/pseudo-male by hormone induction and generating all-male/all-female offspring by hybridization, the novel technology for acquiring the parthenogenesis culture is established and has the characteristics of time and labor saving, economy and high efficiency.

2) The interference fragment can inhibit the expression of sex determining genes to obtain single female sebastes schlegeli, and compared with a sex control mode induced by hormone, the method has stronger specificity and purpose, and avoids the hidden trouble of environmental pollution caused by the use of the hormone.

Drawings

FIG. 1 is an electrophoresis chart of genetic sex identification of sex-reversed male Sebastes schlegeli and male and female Sebastes schlegeli of control group; 1-4 is amhr2 gene knock-down group genetic male Sebastes schlegeli, 5-8 is control group genetic male Sebastes schlegeli, and 9-12 is control group genetic female Sebastes schlegeli.

FIG. 2 is an electrophoretogram of the sex-reversed group amhr2 expression level and female control group;

fig. 3 is a gonadal morphology structure picture of sex reversal male sebastes schlegeli, and male and female sebastes schlegeli in control group: a. b is a gonadal pattern of the genetic male Sebastes schlegeli of the knock-down group, c and d are gonadal patterns of the genetic male Sebastes schlegeli of the control group, and e and f are gonadal patterns of the genetic female Sebastes schlegeli of the control group.

Detailed Description

The technical scheme of the present invention is further explained by examples below, but the scope of the present invention is not limited in any way by the examples.

Example 1

The implementation object of the embodiment is the Sebastes schlegeli fish with sex determination period, morphology observation is carried out on gonads obtained through dissection in 360 days after birth, and genetic sex identification is carried out by using published Sebastes schlegeli sex marks.

1) Selection of the interference fragment of the ambastes schlegeli amhr2 gene: the target region is selected by utilizing siRNA to predict the http:// sidirect2.Rnai. Jp/, inputting the ORF sequence of the amhr2 gene, and the sequence of the selected region in the embodiment is shown as SEQ ID NO. 1:

the predicted sirnas for this region are shown in table 1:

TABLE 1 Amhr2 Gene interference fragment prediction siRNA

2) Construction of the sebastes schlegeli amhr2 gene L4440-amhr2 interference vector: based on the sequence characteristics of the selected fragments, restriction enzymes Sac I and Hind III were selected to form a ligation cut for the amhr2 gene interference fragment and the L4440 interference vector. The interfering fragment was then constructed onto an L4440 nematode RNAi interfering vector using T4 ligase. The primers used for cloning are shown in Table 2, 6-11 in the forward primer are SacI endonuclease cut sequences GAGCTC and 6-11 in the reverse primer are HindIII endonuclease cut sequences AAGCTT:

TABLE 2amhr2 cloning primers for gene interference fragments

3) Screening of L4440-amhr2 interfering vector-positive HT115 strain: transforming the constructed L4440-amhr2 interference vector into an escherichia coli HT115 strain, coating a plate by using a solid flat-plate culture medium with two resistances of tetracycline and ampicillin, growing for 12-14 hours, picking single colonies, and carrying out sanger sequencing verification, wherein the verification result proves that the sequencing sequence is completely consistent with an amhr2 gene interference fragment:

sanger sequencing validation sequence:

ggggggagctcatgacatggcaacagtggtggacgtttttggctgtggaatgcatctttatatgcatctccggccagtcttttcctcaaaggagacggtgtgctttccaagtgactcctcagaacaacatatacgaaactgctggcaatgtgagcgggtcggtgcagctctgtgagaacacccaatgctgcgttggctattttcttatccacgatggccagccaaaggttgacgttctcgcttgtgatatggctgaaaagttttgcccggatgcaacctgcaaggcacaaacacgcttcgacgggcgcctcgttgtctgcgtgtgcaacacagacctctgcaatagcaacatcacttggaccccagagttggaagagcctcgacccacctactctcattttgtagctgccttaatcattctgactttgctagtcctgtgcttcctgttgatcgctgcagccaaatggacaagccaatttacaaagaaaaaggataatccaccctcccttgatgattacagtgtcaagcttccccc

4) Induction of expression of amhr2 knockout fragment dsRNA: selecting HT115 strain positive to verify L4440-amhr2, using LB liquid medium containing double antibody to expand to 0.4OD, adding IPTG inducer to induce dsRNA expression (IPTG final concentration is 0.5 mM) for 4h, and extracting RNA for verification; the components and final concentration of the LB liquid medium of the double antibody are as follows: 10g/L tryptone, 5g/L, naCl g/L yeast extract, 100mg/L ampicillin and 25mg/L tetracycline.

5) Enrichment of thalli: after the induction is finished, the thalli are collected by centrifugation at 4000rpm for 5min, and the thalli are resuspended according to the ratio of 1mL of resuspension culture medium to 200mL of initial bacterial load; the re-suspension culture medium is also called as a double-antibody LB liquid culture medium.

6) Sex determination method of Sebastes schlegeli fries: selecting healthy sebastes schlegeli female fish in gestation period, culturing in a workshop, simulating long-time illumination under natural conditions, and waiting for natural production;

7) The main steps of the artificial induction of the male individuality reversal of the sebastes schlegeli are as follows:

(1) after the sebastes schlegeli, about 400 fish fries are put into a cement pond with 2 x 0.5m, so that the fish fries are adapted for 5 days;

(2) taking 2mL of the red mud fish with the mixed rotifer of the resuspended induced bacteria, feeding the red mud fish with the mixed rotifer for 5 days after the mixed rotifer is produced, the usage amount of the induced bacteria is 400 of the sebastes schlegeli, the usage amount of which is 2mL of resuspended induced bacteria per day.

(3) After feeding the rotifers for 20 days, replacing the baits of the Sebastes schlegeli from the rotifers to artemia, and processing in the same way (2);

(4) after 40 days, the feed of the Sebastes schlegeli is replaced by commercial pellet feed from artemia, and the treatment mode is as follows: taking out 2mL of resuspended induced bacteria every day, spraying the re-suspended induced bacteria onto pellet feed, airing the re-suspended induced bacteria, and feeding the re-suspended induced bacteria with the amount of 2mL/400 tail per day;

(5) the sex reversal treatment of the embodiment is carried out until the postnatal period of the fries is 95 days.

8) Sample acquisition: at 360 days after the birth of the young fish, the individuals of the sebastes schlegeli in a control group and a sex reversal group are randomly selected, a small amount of tail fins are sheared and fixed in 95% ethanol for identification of the genetic sex of the sebastes schlegeli, a part of gonads is taken and placed in liquid nitrogen for quick freezing for RNA extraction, analysis of gene expression quantity, and a part of the gonads is fixed in the Boen liquid for morphological observation of the gonads of the sebastes schlegeli. Carrying out genetic sex identification by using a sebastes schlegeli sex-specific DNA molecular marker, wherein the primer used for the marker is shown in table 3, the genetic sex identification result is shown in figure 1, and the sex reversal group and the male control group both have two amplification bands, and the female control group has only one amplification band; the gene expression is shown in figure 2, the expression level of the sex reversal group amhr2 is similar to that of the female control group and is obviously lower than that of the male control group; morphological characterization results As shown in FIG. 3, the sex reversal groups showed oocytes and ovarian cavities (a-b), which were different from the testis structures (c-d) of the male control group, and more similar to the ovary structures (e-f) of the female control group.

TABLE 3 sex-specific DNA molecular marker primer for sebastes schlegeli

TABLE 4 Semicastes schlegeli amhr2 Gene expression semi-quantitative primers

As can be seen from fig. 1 and 2, the expression level of the male AMHR2 is obviously reduced by feeding the ambr 2 knockdown recombinant bacteria to the level of the male schiff base, and the expression level is similar to that of the genetic female control group and is obviously lower than that of the male control group. As can be seen from fig. 3, the knockout group of males phenotypically exhibited a male-to-female sex reversal.

Claims

1. The application of recombinant bacteria for inducing the male sex reversal of the sebastes schlegeli is characterized in that the recombinant bacteria comprise the sebastes schlegeliamhr2Gene interference fragment SEQ ID NO.1, L4440 nematode RNAi interference vector and HT115 strain; the application method comprises the following steps: culturing and propagating the recombinant bacteria to an OD value of 0.4, centrifugally concentrating the bacteria in 200mL of initial culture solution after induction expression, re-suspending the bacteria with 1mL of re-suspension culture medium, sucking the re-suspended recombinant bacteria according to the proportion of 1mL of the re-suspension culture medium for 200 fish per day, mixing with bait, and feeding the larval fish of the Hemicentrotus marmoreus in the sex determination period for 90 days.

2. The use according to claim 1, wherein the feeding time is from 5 days after birth of the schwann larvae to 95 days after birth.

3. The use according to claim 1, wherein the bait is in turn a rotifer, artemia and pellet feed.