CN115851601A - Anti-tumor DC cell and preparation method and application thereof - Google Patents
Anti-tumor DC cell and preparation method and application thereof Download PDFInfo
- Publication number
- CN115851601A CN115851601A CN202211048421.2A CN202211048421A CN115851601A CN 115851601 A CN115851601 A CN 115851601A CN 202211048421 A CN202211048421 A CN 202211048421A CN 115851601 A CN115851601 A CN 115851601A
- Authority
- CN
- China
- Prior art keywords
- cells
- cell
- cancer
- antigen
- trail
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention provides an anti-tumor DC cell and a preparation method and application thereof. The invention firstly provides a DC cell, which can highly express TRAIL and can further highly express NKG2D. The invention further loads CMV pp65 antigen on DC cells expressing TRAIL and NKG2D cytokines, and the DC cells and self-derived PBMC are mixed and cultured to obtain a large amount of high-activity CTL cells, and the T cells can kill target cells in an antigen specificity mode and can be applied to treatment of clinical patients based on the DC cells.
Description
Technical Field
The invention belongs to the field of cellular immunotherapy, and particularly relates to a DC cell for targeting and broad-spectrum killing of tumor cells, a preparation method and related applications thereof.
Background
DC cells are the most powerful professional antigen presenting cells and are the initiator and regulator of T cell specific immune responses. The most important characteristic is that it can stimulate the T lymphocyte of naive and memory to activate and proliferate into the specific cytotoxic effector T Cell (CTL) of antigen, and can secrete cytokines such as IL2, INF-gamma, etc. to play the role of immunoregulation, and participate in the immune response of organism to diseases. DC-CTL therapy has been widely used in clinical treatment and achieves more ideal effects. However, studies using DC cells to directly target and kill tumor cells are currently rarely reported.
TRAIL, a TRAIL, is a member of the tumor necrosis factor superfamily, mediates apoptosis of tumor cells by binding to death receptors such as DR4 or DR5 on tumor cells, and has no toxicity to normal cells. The research shows that TRAIL and its receptor are potential anticancer targets, and the research of recombinant soluble TRAIL protein and activating antibody such as DR5 is under development. However, the data indicate that soluble TRAIL has a short half-life in animals and is rapidly metabolically cleared in the kidney, resulting in low bioavailability. Whereas the intact transmembrane protein of TRAIL, biologically activates much more than histone-soluble TRAIL. Clinically, a new delivery system capable of carrying TRAIL needs to be developed, so that the TRAIL can be efficiently targeted to tumor tissues to play an anti-tumor role.
Disclosure of Invention
One objective of the present invention is to provide a delivery system capable of carrying TRAIL, so that the delivery system can efficiently target tumor tissues and exert an anti-tumor effect.
According to the invention, TRAIL is introduced into DC cells, NKG2D is expressed on DC cell membranes, and tumor tissues can be targeted, so that the DC cells directly kill tumor cells, and subsequently, the cracked tumor cells can release cancer antigens to be taken up by endogenous DC cells. The invention further introduces NKG2D into DC cells, can better target tumor cells and starts killing action. Furthermore, the present invention can induce the activation, differentiation and expansion of specific T cells using antigens carried by DC cells themselves, thereby further expanding the anticancer efficacy. The technology of the invention can be applied to DC cell therapy, has the effects of training T, NK cells to exert an anti-tumor effect and directly inducing cancer cell apoptosis, and then triggers the cascade amplification effect of endogenous DC cell activation, thereby being a precise and efficient novel immune cell therapy.
In particular, in one aspect, the invention provides a DC cell that highly expresses TRAIL.
In the present invention, the "high expression" TRAIL refers to that the DC cells over-express TRAIL (compared with normal DC cells) by using genetic engineering technology, i.e., the DC cells of the present invention with high expression of TRAIL refers to the DC cells engineered to express TRAIL.
In the present invention, the high expression TRAIL includes TRAIL high expression at gene level and/or protein level, unless otherwise specified or can be determined according to the context.
According to a specific embodiment of the present invention, the DC cells provided herein also highly express NKG2D. In the present invention, the high expression of NKG2D includes high expression of NKG2D at the gene level and/or the protein level, unless otherwise noted or can be determined according to the context.
NKD2D is normally expressed on activated NK cells and by this molecule recognizes the corresponding receptor on the target cell, killing tumor cells and virus-infected cells. The ligand corresponding to NKG2D is known to be not less than six molecules, while MHC class I molecule-associated protein A (MICA) is one of the major ligands of NK cell surface activating receptor D (NKG 2D). The MICA protein is expressed in various malignant tumors including lung cancer, gastrointestinal cancer, liver cancer, adenocarcinoma, multiple myeloma and the like, and is an ideal universal anti-cancer target. In the body, MICA is recognized and activated by NK cells via NKG2D receptors, exploiting the ligand-receptor binding pattern. The invention provides that the NKG2D molecule is transferred on the basis of DC-TRAIL cells, so that tumor cells can be better targeted and the killing effect can be started.
In another aspect, the invention also provides a method for preparing the DC cell (i.e., DC cell highly expressing TRAIL or further highly expressing NKG 2D), which can adopt any feasible method to make DC cell highly express TRAIL or further highly express NKG2D.
According to a specific embodiment of the present invention, the method for preparing the DC cell of the present invention comprises: and (3) infecting the DC cell after packaging the target gene by using a lentivirus vector to prepare the DC cell. In general, the DC cell product (or cell preparation) with high TRAIL expression or further NKG2D expression prepared by the method of the present invention has a purity of 90% or more, that is, 90% or more of DC cells in the DC cell product have high TRAIL expression or further NKG2D expression.
On the other hand, the invention also provides application of the DC cell in preparing a preparation for killing tumor cells.
In another aspect, the invention also provides the use of said DC cells in the preparation of a cell preparation for the presentation of an antigen.
In another aspect, the present invention also provides an antigen-loaded DC cell, which is obtained by further loading the DC cell with an antigen according to the present invention.
According to a specific embodiment of the present invention, the antigen further loaded by the DC cells of the present invention may be a tumor antigen or a viral antigen. The DC cell loaded with the tumor antigen can be used for killing tumor cells (namely treating tumors), such as one or more of human lung cancer cells, human pancreatic cancer cells, human melanoma cells, human cervical cancer cells, human liver cancer cells, human osteosarcoma cells and human prostate cancer cells. The DC cells loaded with viral antigens can be used to combat viral infections or to treat associated diseases caused by viral infections.
In some embodiments of the invention, the DC cells of the invention are further loaded with an antigen that is CMVpp65C antigen. The CMV pp65C antigen-loaded DC cells can be used to treat a tumor that expresses CMV pp65 protein (e.g., a glioblastoma) and/or to kill CMV-infected target cells (e.g., CMV infection following bone marrow or organ transplantation).
In some embodiments of the invention, the DC cells of the invention are further loaded with an antigen that is a WT1 antigen. The WT1 antigen-loaded DC cells can be used for treating tumors highly expressing the WT1 antigen, such as one or more of glioblastoma, breast cancer, lung cancer, pancreatic cancer, ovarian cancer, colorectal cancer and the like.
In some embodiments of the invention, the DC cells of the invention are further loaded with an antigen that is an HPV antigen. The DC cell loaded with HPV antigen can be used for treating HPV infection, or treating cancer caused by HPV infection, such as one or more of cervical cancer, oral cancer, vulvar cancer, penile cancer, laryngeal cancer, lung cancer, etc.
In another aspect, the invention also provides the use of said antigen loaded DC cells in the preparation of a formulation for killing tumor cells and/or combating viral infections.
According to a specific embodiment of the invention, the DC cells of the invention are target cells for killing the following tumor cells or viral infections, or for treating the following cancers or viral infections: the tumor cells comprise but are not limited to one or more of human lung cancer cells, human pancreatic cancer cells, human melanoma cells, human cervical cancer cells, human liver cancer cells, human osteosarcoma cells and human prostate cancer cells; tumors expressing CMV pp65 protein (e.g., glioblastoma) and CMV-infected target cells (e.g., CMV infection after bone marrow or organ transplantation); tumor cells highly expressing WT1 antigen, such as one or more of glioblastoma, breast cancer, lung cancer, pancreatic cancer, ovarian cancer, colorectal cancer, etc.; HPV infection and cancer caused by HPV infection, such as cervical cancer, oral cancer, vulvar cancer, penile cancer, laryngeal cancer, lung cancer and other tumor cells.
In another aspect, the present invention also provides a kit comprising: the DC cells of the present invention (i.e., DC cells highly expressing TRAIL, and/or DC cells further highly expressing NKG 2D), and/or the DC cells loaded with antigen of the present invention (i.e., DC cells highly expressing TRAIL or DC cells further highly expressing NKG2D and loaded with antigen).
In some embodiments of the invention, TRAIL, NKG2D, DAP and MICA plasmid are provided first, lentiviruses are prepared, dendritic cells or tumor cells are transfected, i.e., DC cells that respectively obtain high expression TRAIL and NKG2D are named BD2.1B-TRAIL, BJ4.2C and BJ4.2D. The invention further co-cultures the DC cells loaded with the molecules and tumor cells highly expressing MICA, and detects the toxicity of the DC cells to the tumor cells through a killing experiment. DC cells enhance the recognition of tumor cells by expressing NKG2D, and TRAIL on the surface of DC acts on death receptors of tumor cells, thereby inducing the apoptosis of cancer cells. The result of the killing experiment shows that the ratio of the DC cells with high TRAIL expression to different tumor cells in effective targets is 2:1 and 5:1 respectively kill the tumor cells by 25 to 95 percent and 35 to 98 percent, and simultaneously the killing power of DC cells with high expression TRAIL and NKG2D to the tumor cells is improved by 15 to 35 percent. However, such DC cells have little killing of human fibroblasts. These results indicate that such DC cells have a very strong specific killing of tumor cells. Meanwhile, the DC cell with broad-spectrum universality and antigen specificity can be prepared by combining the antigen presenting function of the DC cell, so that the optimal DC cell function is realized. The present invention loads CMV pp65 antigen on DC cells expressing TRAIL and NKG2D cytokines, and mixes the cells with autologous PBMC to culture, so as to obtain a large amount of high-activity CTL cells, and the T cells can specifically kill target cells.
In summary, the present invention provides a DC cell that targets and kills tumor cells in a broad spectrum, a method for preparing the same, and related applications, the DC cell of the present invention can directly kill tumor cells, or antigen loading is increased on the basis of directly killing tumor cells to induce specific T cells, and the DC cell can be applied to treatment of clinical patients based on DC cells.
Drawings
FIG. 1 shows the results of the detection of TRAIL and NKG2D loaded and expressed by DC cells.
Figure 2 shows the results of the assay of target cell loading and expression of MICA.
FIG. 3 shows the results of the killing of target cells by BD2.1B exogenously expressed TRAIL.
FIG. 4 shows the results of BJ4.2.1 exogenous expression of TRAIL and NKG2D killing target cells.
FIG. 5 shows the results of BJ4.2.1 exogenous expression of TRAIL and NKG2D induction of CMV pp65 antigen-specific CTL killing of target cells.
FIG. 6 shows the results of killing target cells by autologous CTLs induced by DC-WT 1.
FIG. 7 shows the killing effect of HPV antigen loaded DC induced T cells.
Detailed Description
The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention. The experimental methods in the examples, in which specific conditions are not noted, are conventional methods and conventional conditions well known in the art, or conditions as recommended by the manufacturer.
The antibodies and cell lines used in the examples of the invention are represented as follows:
antibody: TRAIL flow antibody (CD 253), NKG2D flow antibody was purchased from Biolegend; clean-Caspase 9 was purchased from CST; beta-actin antibodies were purchased from Yi Qiao Shen.
Cell line:
BD2.1B, BJ4.2.1: two dendritic cells which are from different human sources and are subjected to in-vitro culture and amplification by the prior art;
BD2.1B-TRAIL: human dendritic cells engineered to express TRAIL;
BJ4.2C: human dendritic cells engineered to express TRAIL;
BJ4.2D: human dendritic cells engineered to express TRAIL and NKG 2D;
NHFL-MICA: human normal fibroblasts engineered to express luciferase, MICA;
A549L-MICA: a human lung cancer cell line engineered to express luciferase, MICA;
PANC1L-MICA: a human pancreatic cancer cell line engineered to express luciferase, MICA;
A375L-MICA: a human melanoma cell line engineered to express luciferase, MICA;
HelaL-MICA: a human cervical cancer cell line engineered to express luciferase, MICA;
HepG2-MICA: a human hepatoma cell line engineered to express luciferase, MICA;
u2OSL: a human osteosarcoma cell line engineered to express luciferase;
PC3L: human prostate cancer cell lines engineered to express luciferase.
Data analysis
The data of each experiment are expressed as mean ± Standard Deviation (SD), and the significance analysis is obtained by t-test. P <0.05 was considered to be statistically significant difference, with P <0.01 indicating a very significant difference.
Example 1: establishment of DC cells loaded with TRAIL, NKG2D and DAP10 molecules and MICA-loaded target cells
In this example, TRAIL-and NKG 2D-loaded DC cells and MICA-loaded target cells were prepared according to the following procedures
1. Construction of expression vectors such as TRAIL, NKG2D, DAP and MICA
Coding sequence information of TRAIL, NKG2D, DAP10 and MICA is obtained from NCBI database, primers are designed and delivered to a third party company for primer synthesis, each cytokine coding region is cloned by taking commercialized lymph node cell cDNA as a template, and is inserted into a lentiviral vector EcoRI-XbaI site after enzyme digestion, and is transformed into E.coli, and after sequencing is correct, bacteria is shaken and plasmids are extracted for standby. The primer sequences and gene sequences are as follows.
TRAIL EcoRI/XbaI PCR fragment(SEQ ID NO:1)：
atggctatgatggaggtccaggggggacccagcctgggacagacctgcgtgctgatcgtgatcttcacagtgctcctgcagtctctctgtgtggctgtaacttacgtgtactttaccaacgagctgaagcagatgcaggacaagtactccaaaagtggcattgcttgtttcttaaaagaagatgacagttattgggaccccaatgacgaagagagtatgaacagcccctgctggcaagtcaagtggcaactccgtcagctcgttagaaagatgattttgagaacctctgaggaaaccatttctacagttcaagaaaagcaacaaaatatttctcccctagtgagagaaagaggtcctcagagagtagcagctcacataactgggaccagaggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctctgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagggttttactacatctattcccaaacatactttcgatttcaggaggaaataaaagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatacacaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgttggtctaaagatgcagaatatggactctattccatctatcaagggggaatatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgagcacttgatagacatggaccatgaagccagtttttttggggcctttttagttggctaa
TRAIL-5(SEQ ID NO:2)：gag gaa ttc gcc acc atg gct atg atg gag gtc cag
TRAIL-3(SEQ ID NO:3)：gag tct aga tta gcc aac taa aaa ggc ccc aaa aaa
NKG2D EcoRI/XbaI PCR fragment(SEQ ID NO:4)：
atggggtggattcgtggtcggaggtctcgacacagctgggagatgagtgaatttcataattataacttggatctgaagaagagtgatttttcaacacgatggcaaaagcaaagatgtccagtagtcaaaagcaaatgtagagaaaatgcatctccattttttttctgctgcttcatcgctgtagccatgggaatccgtttcattattatggtagcaatatggagtgctgtattcctaaactcattattcaaccaagaagttcaaattcccttgaccgaaagttactgtggcccatgtcctaaaaactggatatgttacaaaaataactgctaccaattttttgatgagagtaaaaactggtatgagagccaggcttcttgtatgtctcaaaatgccagccttctgaaagtatacagcaaagaggaccaggatttacttaaactggtgaagtcatatcattggatgggactagtacacattccaacaaatggatcttggcagtgggaagatggctccattctctcacccaacctactaacaataattgaaatgcagaagggagactgtgcactctatgcctcgagctttaaaggctatatagaaaactgttcaactccaaatacatacatctgcatgcaaaggactgtgtaa
NKG2D-5(SEQ ID NO:5)：gag gaa ttc gcc acc atg ggg tgg att cgt ggt cgg
NKG2D-3(SEQ ID NO:6)：gag tct aga tta cac agt cct ttg cat gca gat gta
DAP10EcoRI/XbaI PCR fragment(SEQ ID NO:7)：
atgatccatctgggtcacatcctcttcctgcttttgctcccagtggctgcagctcagacgactccaggagagagatcatcactccctgccttttaccctggcacttcaggctcttgttccggatgtgggtccctctctctgccgctcctggcaggcctcgtggctgctgatgcggtggcatcgctgctcatcgtgggggcggtgttcctgtgcgcacgcccacgccgcagccccgcccaagatggcaaagtctacatcaacatgccaggcaggggctga
DAP10-5(SEQ ID NO:8)：gag gaa ttc gcc acc atg atc cat ctg ggt cac atc
DAP10-3(SEQ ID NO:9)：gag tct aga tta gcc cct gcc tgg cat gtt gat gta
MICA EcoRI/XbaI PCR fragment(SEQ ID NO:10)：
atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgctgtgacaggcagaaatgcagggcaaagccccagggacagtgggcagaagatgtcctgggaaataagacatgggacagagagaccagagacttgacagggaacggaaaggacctcaggatgaccctggctcatatcaaggaccagaaagaaggcttgcattccctccaggagattagggtctgtgagatccatgaagacaacagcaccaggagctcccagcatttctactacgatggggagctcttcctctcccaaaacctggagactaaggaatggacaatgccccagtcctccagagctcagaccttggccatgaacgtcaggaatttcttgaaggaagatgccatgaagaccaagacacactatcacgctatgcatgcagactgcctgcaggaactacggcgatatctaaaatccggcgtagtcctgaggagaacagtgccccccatggtgaatgtcacccgcagcgaggcctcagagggcaacattaccgtgacatgcagggcttctggcttctatccctggaatatcacactgagctggcgtcaggatggggtatctttgagccacgacacccagcagtggggggatgtcctgcctgatgggaatggaacctaccagacctgggtggccaccaggatttgccaaggagaggagcagaggttcacctgctacatggaacacagcgggaatcacagcactcaccctgtgccctctgggaaagtgctggtgcttcagagtcattggcagacattccatgtttctgctgttgctgctgctgctatttttgttattattattttctatgtccgttgttgtaagaagaaaacatcagctgcagagggtccagagctcgtgagcctgcaggtcctggatcaacacccagttgggacgagtgaccacagggatgccacacagctcggatttcagcctctgatgtcagatcttgggtccactggctccactgagggcgcctag
MICA-5(SEQ ID NO:11)：GCGAATTCGCCACCatggggctgggcccggtcttc
MICA-3(SEQ ID NO:12)：GCTCTAGActaggcgccctcagtggagccagt。
2. TRAIL, NKG2D, DAP, MICA molecular lentivirus package
(1) Recovering 293 cells, culturing for passage, and performing transfection according to 5 × 10 6 The cells/dish were plated in a petri dish and incubated overnight at 37 ℃.
(2) Transfection: the lentivirus packaging plasmid and the target plasmid are mixed, 500ul of serum-free RPMI1640 medium is added, and the mixture is prepared according to the mass ratio of the plasmid: the transfection reagent PEI20000 (mass: volume) ratio 1:3 was allowed to stand at room temperature for 15min. The 293 cells were replaced with fresh RPMI1640 medium in advance, and the transfection mixture was added dropwise gently into the petri dish, and cultured at 37 ℃.
(3) The virus was collected at 24h, 48h, 72h respectively.
(4) Adding the virus concentrated solution, uniformly mixing, and standing overnight in a refrigerator at 4 ℃.
(5) Centrifuging the next day, removing supernatant, adding fresh culture medium according to 1/10 of the original volume, resuspending virus, subpackaging, and storing in-80 deg.C refrigerator for use.
3. DC cell-loaded TRAIL, NKG2D and DAP10 molecules and target cell-loaded MICA molecules
(1) Take 1X 10 6 Individual DC cells were seeded in 6-well plates. Preparing a concentrated TRAIL virus mixed solution, adding the mixed solution into cells for culturing, and replacing a fresh 1640 complete culture medium after 6 hours.
(2) Repeating the step (2) 4 times, and culturing the cells to a sufficient number.
(3) DC cells after lentiviral infection were collected for flow cytometry detection.
(4) And (4) inoculating the DC cells obtained in the step (3) into a 6-well plate, preparing a concentrated NKG2D and DAP10 virus mixed solution, adding the mixed solution into the cells for culture, and replacing a fresh 1640 complete culture medium after 6 hours.
(5) Repeating the step (4) 4 times, and culturing the cells to a sufficient number.
(6) DC cells after lentivirus infection were collected for flow cytometry detection.
(7) NHF, A549, PC3, PANC1, A375, hela, U2OS, hepG2, DP61 cells at 5x10 5 The individual cells were seeded in 6-well plates and attached to the wall for 3 hours. Preparing concentrated luciferase virus solution (containing 10ug/ml polybrene), adding into cells, culturing, and after 6 hr, replacing fresh 1640 complete culture medium.
(8) And (5) repeating the step (7) and carrying out secondary transfection on the luciferase virus liquid.
(9) According to 5X10 5 The cells are inoculated into a 6-pore plate, transferred into MICA virus liquid, transfected for 4 times and then the expression condition of MICA molecules is detected by a flow method.
(10) Data collation and analysis
In this example, the expression results of TRAIL and NKG2D molecules in DC cells are shown in fig. 1, and after lentivirus transfection, positive expression TRAIL and NKG2D molecules in DC cells can be detected, which can be used in subsequent experiments.
In this example, the expression of MICA molecules in target cells is shown in fig. 2, and each target cell expresses MICA molecules at a comparable level, which can be used in subsequent experiments.
Example 2: killing effect of exogenous high expression TRAIL BD2.1B cell on tumor cell
In this example, BD2.1B exogenously expresses TRAIL and then flows backward to detect the expression, co-cultures with target cells after expansion culture, and detects the killing of target cells, the procedure is as follows:
(1) Target cells were digested, counted and counted at 7X 10 4 Inoculating each cell/hole in a 24-hole plate, wherein each group has three parallel holes, and the adherence lasts for about 3 hours;
(2) Taking BD2.1B and BD2.1B cells loaded with TRAIL, counting, and according to the effective target ratio of 10:1, adding DC cells into target cells, and performing mixed culture at 37 ℃ for 5 hours;
(3) The suspended DC cells were aspirated, the plate was gently washed five times with PBS, and the wells were blotted dry;
(4) Adding 100ul of cell lysate into each well, and cracking on ice for 10min to release the Luciferase protein from living cells;
(5) The lysate was pipetted into a 1.5ml EP tube, 12000g,30s;
(6) 10ul of lysate supernatant was taken separately in 96 wells and 50ul of substrate was added per well:
(7) And (4) detecting by using a microplate reader, and calculating the cell killing rate according to the fluorescence intensity.
BD2.1B results in target cell killing as shown in fig. 3, BD2.1B of high expression TRAIL has an effective target ratio of 10:1 has weak killing effect on NHF and strong killing effect on other tumor cells, wherein the killing effect on A375 is higher than 90%, the killing effect on DP61 is about 85%, the killing effect on A549, hela, hepG2 and U2OS is more than 50%, the statistical difference (mean value +/-SD) is shown, P is less than 0.05 (figure 3), the killing effect on PC3 and PANC1 is weak, the statistical difference (mean value +/-SD) is still shown, and P is less than 0.05 (figure 3), which shows that BD2.1B cells of high expression TRAIL have direct killing effect on the tumor cells.
Example 3: killing effect of exogenous high-expression TRAIL and NKG2D BJ4.2.1 cells on tumor cells
In this example, BJ4.2.1 exogenously expressed TRAIL (BJ4.2C) and simultaneously expressed TRAIL and NKG2D (BJ4.2D) were followed by flow-through to detect expression, co-cultured with target cells after expansion culture, and detected killing of target cells, and the procedure was as follows:
(1) Target cells were digested, counted and counted at 7X 10 4 Inoculating each cell/hole in a 24-hole plate, wherein each group has three parallel holes, and the adherence lasts for about 3 hours;
(2) And (3) taking BJ4.2.1, BJ4.2C and BJ4.2D cells, counting, and respectively taking the number of the cells as 2:1 and 5:1, adding DC cells into target cells, and performing mixed culture at 37 ℃ for 5 hours;
(3) The suspended DC cells were aspirated, the plate was gently washed five times with PBS, and the wells were blotted dry;
(4) Adding 100ul of cell lysate into each well, and cracking on ice for 10min to release the Luciferase protein from living cells;
(5) The lysate was pipetted into a 1.5ml EP tube, 12000g,30s;
(6) 10ul of lysate supernatant was placed in 96 wells, 50ul of substrate was added per well:
(7) And (4) detecting by using a microplate reader, and calculating the cell killing rate according to the fluorescence intensity.
BJ4.2.1 the results of killing target cells by high expression TRAIL and NKG2D are shown in fig. 4, and the cells with high expression TRAIL and NKG2D have the strongest killing effect on target cells with high expression MICA, and the effective-to-target ratio is 2:1, the composition is weaker in killing on NHF cells and stronger in killing effect on other tumor cells, wherein the killing effect on A375 is higher than 90%, the killing effect on PANC1 is about 70%, the killing effect on A549, hela and HepG2 is greater than 50%, the statistics shows significant differences (mean value +/-SD), P is less than 0.05 (picture A in figure 4), and the effective target ratio is 5: the killing effect of 1 on target cells is slightly higher than 2:1 (mean ± SD), P <0.05 (panel B in fig. 4), which indicates that BJ4.2C cells highly expressing TRAIL have direct killing effect on tumor cells, while highly expressing NKG2D further enhances killing effect of DC cells on tumor cells by interacting with MICA.
Example 4: antigen presentation of DC cells after exogenous high expression TRAIL and NKG2D
In this example, to verify whether TRAIL and NKG2D molecules affect antigen presentation in DC cells, CMV pp65C antigen was loaded on BJ4.2.1 and BJ4.2D, which are DC cells, and then amplification of autologous PBMCs was induced. The preparation process comprises the following operations:
(1) The pp65 antigen-loaded DC cells and corresponding PBMCs were counted.
(2) Taking 2.5X 10 6 PBMC cells, according to DC cell: PBMC =1:200 and DC were mixed and cultured in X-VIVO +5% autologous serum at 37 ℃ overnight.
(3) From the next day, interleukin 2 (200 Unit/ml) was added daily, and the culture was continued after gentle mixing.
(4) According to the growth condition of the cells, adding a proper amount of fresh culture medium to maintain the growth of the cells, and recording the growth condition.
(5) On days 14-21 of cell culture, a portion of the cells were collected as appropriate for immunophenotypic analysis, and when the proportion of CD3-CD56+ cells in the culture system was less than 5%, a target cell killing test was performed.
The result of killing target cells by autologous CTLs induced by DC-pp65C is shown in FIG. 5, and the control group BJ4.2.1 does not induce CMV pp65 antigen-specific T cells and hardly kills the target cells specifically; BJ4.2.1 and BJ4.2D both induced pp 65-specific T cells when loaded with the antigen and the ratio of effective targets was 10:1, the tumor cells are specifically killed by about 60 percent, the statistics shows that the differences (mean value +/-SD) are significant, and P is less than 0.05 (figure 5), which shows that the antigen presentation effect of the DC cells is not influenced by high-expression TRAIL and NKG2D, and the tumor cells can be directly killed in a targeted manner under the condition of not influencing normal cells, thereby indicating that the tumor cells have great application value in clinic.
Example 5: t cell specific killing effect mediated by DC cell loaded with WT1 and HPV virus antigen
In this example, the specific killing effect of T cells mediated by loading WT1 and HPV viral antigen into DC cells was examined. The experimental procedure was as follows:
(1) WT1, HPV16E6-E7, and HPV18E6-E7 lentiviruses were prepared according to the method of step 2 in example 1 and loaded onto BJ4.2.1 cells for co-culture with autologous PBMC cells.
(2) Take 2.5X 10 6 PBMC cells, according to DC cell: PBMC =1:200 and DC were mixed and cultured in X-VIVO +5% autologous serum at 37 ℃ overnight.
(3) Interleukin 2 (200 Unit/ml) was added daily the next day, and the culture was continued after gentle mixing.
(4) According to the growth condition of the cells, adding a proper amount of fresh culture medium to maintain the growth of the cells, and recording the growth condition.
(5) On days 14-21 of cell culture, a portion of the cells were collected as appropriate for immunophenotypic analysis, and when the proportion of CD3-CD56+ cells in the culture system was less than 5%, a target cell killing test was performed.
The results of killing target cells by autologous CTLs induced by DC-WT1 are shown in fig. 6, and the effective target ratio is 10: the T cells have specific killing effect of about 20% on target cells at 1 hour, and have stronger killing effect on the target cells under the condition of 2 HLA matches, and statistically have significant difference (average value +/-SD), and P is less than 0.05.
10 days after sorting of the HPV antigen-loaded DC-induced T cell magnetic beads, the ratio of effective targets is 10:1 kills HeLa series target cells, and experimental results show that the killing rates of DC induced CTLs loaded with HPV16 and HPV18 to corresponding target cells are 40% and 46%, and meanwhile, the two have about 20% background killing to HelaL224 of a control group, but the two have obvious killing effects compared with the control group (figure 7).
In conclusion, the DC cell with high expression TRAIL and NKG2D can directly kill tumor cells and induce specific T cells, and can be applied to treatment of clinical patients based on the DC cell.
Claims (10)
1. A DC cell, wherein the DC cell highly expresses TRAIL.
2. The DC cell according to claim 1, wherein the DC cell further highly expresses NKG2D.
3. A method of preparing the DC cell of claim 1 or 2, comprising: and (3) infecting the DC cell after packaging the target gene by using a lentivirus vector to prepare the DC cell.
4. Use of the DC cells of claim 1 or 2 in the preparation of a formulation for killing tumor cells.
5. Use of a DC cell according to claim 1 or 2 in the preparation of a cell preparation for the presentation of an antigen.
6. An antigen-loaded DC cell obtained by further loading the DC cell of claim 1 or 2 with an antigen.
7. The antigen-loaded DC cell according to claim 6, wherein said antigen is a tumor antigen or a viral antigen.
8. Use of the antigen loaded DC cells of claim 6 or 7 in the manufacture of a formulation for killing tumor cells and/or combating viral infections.
9. The use according to claim 4 or 8, wherein the DC cells are used for killing the following tumor cells or virus-infected target cells, or for treating the following cancers or viral infections:
one or more of human lung cancer cells, human pancreatic cancer cells, human melanoma cells, human cervical cancer cells, human liver cancer cells, human osteosarcoma cells and human prostate cancer cells;
tumors expressing CMV pp65 protein (e.g., glioblastoma) and CMV-infected target cells (e.g., CMV infection after bone marrow or organ transplantation);
tumor cells highly expressing WT1 antigen, such as one or more of glioblastoma, breast cancer, lung cancer, pancreatic cancer, ovarian cancer, colorectal cancer, etc.;
HPV infection and cancer caused by HPV infection, such as cervical cancer, oral cancer, vulvar cancer, penile cancer, laryngeal cancer, lung cancer and other tumor cells.
10. A kit, comprising: the DC cell of claim 1 or 2, and/or the antigen-loaded DC cell of claim 6 or 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211048421.2A CN115851601A (en) | 2022-08-30 | 2022-08-30 | Anti-tumor DC cell and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211048421.2A CN115851601A (en) | 2022-08-30 | 2022-08-30 | Anti-tumor DC cell and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115851601A true CN115851601A (en) | 2023-03-28 |
Family
ID=85660673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211048421.2A Pending CN115851601A (en) | 2022-08-30 | 2022-08-30 | Anti-tumor DC cell and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115851601A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970562A (en) * | 2023-09-22 | 2023-10-31 | 北京翊博生物集团有限公司 | Preparation method of antigen-specific T cells and application of antigen-specific T cells in immunotherapy |
| CN117384859A (en) * | 2023-12-13 | 2024-01-12 | 北京翊博生物集团有限公司 | Preparation method and application of exosome from dendritic cells |
| CN117402831A (en) * | 2023-12-15 | 2024-01-16 | 北京翊博生物集团有限公司 | Application of large-scale customized dendritic cell exosomes in resisting tumor |
-
2022
- 2022-08-30 CN CN202211048421.2A patent/CN115851601A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116970562A (en) * | 2023-09-22 | 2023-10-31 | 北京翊博生物集团有限公司 | Preparation method of antigen-specific T cells and application of antigen-specific T cells in immunotherapy |
| CN116970562B (en) * | 2023-09-22 | 2024-01-02 | 北京翊博生物集团有限公司 | Preparation method of antigen-specific T cells and application of antigen-specific T cells in immunotherapy |
| CN117384859A (en) * | 2023-12-13 | 2024-01-12 | 北京翊博生物集团有限公司 | Preparation method and application of exosome from dendritic cells |
| CN117384859B (en) * | 2023-12-13 | 2024-03-22 | 北京翊博生物集团有限公司 | Preparation method and application of exosome from dendritic cells |
| CN117402831A (en) * | 2023-12-15 | 2024-01-16 | 北京翊博生物集团有限公司 | Application of large-scale customized dendritic cell exosomes in resisting tumor |
| CN117402831B (en) * | 2023-12-15 | 2024-03-26 | 北京翊博生物集团有限公司 | Application of large-scale customized dendritic cell exosomes in resisting tumor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115851601A (en) | Anti-tumor DC cell and preparation method and application thereof | |
| JP2020012000A (en) | Engineering and delivery of therapeutic compositions of freshly isolated cells | |
| CN105949318B (en) | Anti- HER2 Chimeric antigen receptor, encoding gene, recombinant expression carrier and its construction method and application | |
| CN105820255B (en) | Anti-CD 33 Chimeric antigen receptor, encoding gene, recombinant expression carrier and its construction method and application | |
| CN105949316B (en) | Anti- EGFRvIII Chimeric antigen receptor, encoding gene, recombinant expression carrier and its construction method and application | |
| CN112142854A (en) | Immune regulation specific chimeric antigen receptor cell and preparation method and application thereof | |
| CN105820254B (en) | Anti- CD138 Chimeric antigen receptor, encoding gene, recombinant expression carrier and its construction method and application | |
| CN115851603A (en) | DC cell for targeting and broad-spectrum killing tumor cell and preparation method and application thereof | |
| WO2019062518A1 (en) | New dual chimeric antigen receptor-t cell which can be regulated, construction method therefor and use thereof | |
| WO2009139413A1 (en) | Method for production of cell mass containing cytokine-induced killer cell | |
| CN113416260B (en) | Claudin18.2-targeted specific chimeric antigen receptor cell and preparation method and application thereof | |
| WO2024164797A1 (en) | Chimeric antigen receptor nk cell, preparation method and use thereof | |
| CN111205361A (en) | Interleukin 21 protein (IL21) mutant and application thereof | |
| CN112522208A (en) | Transgenic tumor infiltrating lymphocyte and application thereof | |
| CN105950662B (en) | A kind of replication defective recombinant slow virus CAR-T transgene carrier targeting CD22 and its construction method and application | |
| JP2022501067A (en) | Chimeric antigen receptors targeting BCMA and CD19, and their use | |
| CN114729320B (en) | Compositions, methods and uses for reprogramming cells to dendritic cell type 2 capable of presenting antigen | |
| WO2018205343A1 (en) | Car.il-33-t and preparation and application thereof | |
| CN115094035B (en) | Method for in-vitro expansion induction of T cells into tissue colonisation memory T cells | |
| EP2345428B1 (en) | Preparation method of prostate tumor-targeted double-regulated oncolytic adenovirus expressing superantigen gene | |
| US11718827B2 (en) | LRFFT2 cell | |
| CN109294997B (en) | LRFFT1 cell | |
| WO2018032619A1 (en) | Applications of soluble protein baff in b cell in-vitro culture and proliferation | |
| WO2018205344A1 (en) | Cea.car-t, preparation method therefor and use thereof | |
| CN110093375B (en) | Construction method of MRFFT2 cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |