CN115851463A - Saccharomyces boulardii and application thereof - Google Patents

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a saccharomyces boulardii separated from fermented grains of Maotai-flavor liquor and application thereof. The strain is specifically Saccharomyces boulardii BD-2 with the preservation number of CGMCC No.24930. The Saccharomyces boulardii BD-2 is derived from fermented grains in the traditional fermentation process of fermented food Maotai-flavor liquor, and belongs to safe strains which can be used for food; the product has strong acid resistance, cholate resistance, high temperature resistance and gastrointestinal juice resistance, high self-agglomeration property, hydrophobicity, antioxidant activity and helicobacter pylori inhibition activity, good in-vivo survival ability and excellent probiotic property, and can be used in the fields of food, medicine and the like, such as wine making, and development of related functional food and medicine.

Description

Saccharomyces boulardii and application thereof

The technical field is as follows:

the invention belongs to the technical field of microorganisms, and particularly relates to a saccharomyces boulardii separated from fermented grains of Maotai-flavor liquor and application thereof.

Background art:

maotai-flavor liquor is one of three major flavors of Chinese liquor and is widely popular with drinking consumers. The brewing process is an application process of various microorganisms, and the types and the quantity of aroma substances can be directly influenced, so that the microorganisms are important factors for forming the quality and the style of the Maotai-flavor liquor, and the saccharomyces cerevisiae is a main functional bacterium in the liquor brewing process. The Saccharomyces boulardii is a nonpathogenic yeast, not only has the characteristic that common yeast can provide nutrient substances, but also has the probiotic effects of improving the activity of beneficial microorganisms in the intestinal tract, inhibiting the growth of pathogenic bacteria, improving the immunologic function of the intestinal mucosa and the like, and is the only yeast clinically used as a probiotic medicament for treating intestinal diseases at present. In addition, the saccharomyces boulardii can also be used as a microecological preparation, a feed additive and the like, and has wide application prospects.

The saccharomyces boulardii is originally a yeast separated from tropical fruits in India, and compared with yeast screening sources, the saccharomyces boulardii with high quality is easier to obtain in the natural fermentation process of Maotai-flavor liquor.

In view of the above, the present invention is particularly proposed.

The invention content is as follows:

the invention aims to enrich the existing strain resources, overcome the defects of the prior art and provide a strain of saccharomyces boulardii with excellent probiotic characteristics.

One of the technical schemes provided by the invention is a strain of Saccharomyces boulardii with excellent probiotic characteristics, which is characterized in that the strain is selected from fermented grains of Maotai-flavor liquor, in particular to Saccharomyces boulardii (Saccharomyces boulardii) BD-2, the strain is preserved in the China general microbiological culture Collection center (address: west Lu 1 institute of microbiological research institute of China academy of sciences, north Kyork City, ministry of oriented south, ministry of China, zip 100101) in 5.19.2022, and the preservation number is CGMCC No. 930.

The BD-2 strain is determined to be Saccharomyces boulardii (Saccharomyces boulardii) through screening, separation and purification in fermented grains of Maotai-flavor liquor and molecular biological identification.

The Saccharomyces boulardii BD-2 has the following characteristics:

(1) The bacterial colony and the thallus are characterized in that: culturing on YPD medium for 24h to obtain white round colony, which is opaque, large and moist, has smooth surface, raised middle part, clear edge, and easy picking-up and emits light wine fragrance; observing the cell morphology under an optical microscope, wherein the cell individual is large and is in a nearly spherical shape, and the propagation mode is single-ended budding or multi-ended budding;

(2) High temperature resistance: culturing at 30-50 deg.C for 30min, with survival rate higher than 70%;

(3) Acid resistance: the strain can still normally grow after being cultured for 24 hours under the condition of pH 2.5, and the survival rate is 82.08%;

(4) Alkali resistance: the strain can still normally grow after being cultured for 24 hours under the condition of pH 9.0, and the survival rate is 84.37 percent;

(5) And (3) bile salt resistance: the survival rate of the YPD medium containing 1.0% of bile salt after being cultured for 24 hours still reaches 97.77%;

(6) Simulating the gastric juice viability: after being treated in simulated gastric fluid with pH of 3.0 for 3h, the survival rate is 193.33%

(7) Simulating intestinal fluid viability; after 3h of treatment in simulated intestinal fluid with pH of 8.0, the survival rate is 79.15%;

(8) In vitro adhesion capacity: after 3 hours of culture at 30 ℃, the self-aggregation rate is still high and reaches 88.4 percent;

(9) Hydrophobicity of organic solvent: the hydrophobic polyurethane resin has higher hydrophobicity on n-hexane, dichloromethane, dodecane and chloroform, and is 52.01%,54.13%,51.4% and 54.25% respectively;

(10) Antioxidant activity: has better antioxidant activity, the DPPH free radical clearance rate is 73.27 percent, the reducing capability is 62.40 percent, and the hydroxyl free radical clearance rate is 34.69 percent, which are both more than 30 percent;

(11) Antibiotic susceptibility: the antibiotic has drug resistance to 11 antibiotics, and is detected to be insensitive to 11 drug sensitive paper sheets including erythromycin, penicillin, chloramphenicol, cefotaxime, ceftriaxone, ciprofloxacin, tetracycline, kanamycin, streptomycin, gentamicin and vancomycin.

The second technical scheme provided by the invention is the application of the Saccharomyces boulardii BD-2, in particular to the application in the fields of food, medicine and the like, such as the application in white wine or beer fermentation, the development of foods or medicines for inhibiting helicobacter pylori and regulating intestinal flora;

further, the therapeutic drug against helicobacter pylori is a bacterial liquid of Saccharomyces boulardii BD-2 alone or in combination with a standard tetrad therapy drug;

more closely, the standard four-combination therapy drugs are: rabeprazole, amoxicillin, clarithromycin and bismuth potassium citrate;

further, the preparation of the four-combination therapy medicament: 20mg of rabeprazole, 1g of amoxicillin, 0.5g of clarithromycin and 0.6g of bismuth potassium citrate, and 100mL of liquid medicine is prepared by water;

furthermore, the four-combination therapy medicine and a bacterial liquid BD-2 of Saccharomyces boulardii (Saccharomyces boulardii) are prepared into a therapeutic medicine for resisting helicobacter pylori according to the volume ratio of 1;

further, the bacterial strain concentration of the Saccharomyces boulardii BD-2 is 1.0X 10 ⁶ CFU/mL。

The invention has the advantages and positive effects that:

1. the Saccharomyces boulardii BD-2 provided by the invention is derived from fermented grains in the traditional fermented food Maotai-flavor liquor fermentation process, and belongs to safe strains capable of being used for food.

2. The Saccharomyces boulardii BD-2 provided by the invention has strong acid resistance, cholate resistance, high temperature resistance and intestinal juice resistance, also has high self-aggregation, hydrophobicity, antioxidant activity and helicobacter pylori inhibition activity, has good in-vivo survival ability and excellent probiotic property, and can be used in the fields of food, medicine and the like, such as wine making, development of related functional food and medicine.

Description of the drawings:

FIG. 1 is a diagram showing the colony morphology and the cell morphology of the Saccharomyces boulardii BD-2 of the present invention;

FIG. 2 is a phylogenetic tree diagram of Saccharomyces boulardii BD-2 of the present invention.

The specific implementation mode is as follows:

for a better understanding and an implementation of the present invention, the following detailed description is given in conjunction with the examples. It is to be understood that the embodiments described are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the examples given herein without any inventive step, are within the scope of the present invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

The technical solution of the present invention is further illustrated by the following examples.

Example 1 screening and isolation of Saccharomyces boulardii BD-2

YPD medium composition: 20g/L of peptone, 10g/L of yeast powder, 20g/L of glucose, 1.5g/L of agar and the balance of water.

The preparation method comprises the following steps: dissolving the above components in 1L distilled water, packaging into 100mL conical flask, and sterilizing at 115 deg.C for 20min. To exclude bacterial interference during the screening process, 60. Mu.g/mL of chloramphenicol was added.

Taking 10g of Lutai spring Maotai-flavor liquor fermented grains into a 250mL sterile triangular flask, adding 90mL of sterilized normal saline, sealing the flask opening with a breathable sealing film, and activating at 30 ℃ for 30min; taking out the bacterial suspension and diluting the bacterial suspension with sterile water to obtain a diluent;

and uniformly coating the diluent on a YPD medium, culturing for 1-2d in a constant-temperature incubator at 30 ℃, selecting a single colony with typical yeast characteristics, streaking the colony on the YPD medium, further purifying the yeast (for 2-3 times according to the separation effect) until a single strain is separated, and performing molecular identification.

The process is to perform primary screening on the yeast, and the function is to screen out single bacterial colonies which have different appearance forms and generate fragrance in the culture medium. Wherein bacterial colony of the bacterial strain BD-2 is white round, non-transparent, large and moist, smooth in surface, raised in the middle, clear in edge, easy to pick up, and capable of emitting light wine fragrance; the cell morphology is observed under an optical microscope, the cell individual is large and is in a nearly spherical shape, and the propagation mode is single-ended budding or multi-ended budding. The colony morphology and the microscopic morphology are shown in FIG. 1.

Example 2 identification of Saccharomyces boulardii BD-2

Selecting pure BD-2 strain, inoculating to YPD liquid culture medium, and culturing at 30 deg.C for 24 hr for activation. Taking a proper amount of activated bacterial liquid, centrifugally collecting thalli, extracting the genome DNA of a pure culture target strain by a kit extraction method, and performing amplification by using an upstream primer NL1:5'-GCATATCAATAAGCGGAGGAAAAG-3', downstream primer NL4:5'-GGTCCGTGTTTCAAGACGG-3' amplified its conserved region of the 26S rDNA gene and sent to sequencing company for sequencing analysis.

The PCR reaction conditions were: denaturation at 95 ℃ for 15s; annealing at 55 ℃ for 15s; extension at 72 ℃ for 15s;30 cycles, extension at 72 ℃ for 10min.

Sequence alignments were performed in the GenBank database using the BLAST function of NCBI and the phylogenetic tree is shown in figure 2. Analysis determined the classification of the strains as: saccharomyces boulardii, therefore named as Saccharomyces boulardii BD-2, was deposited in China general microbiological culture Collection center (CGMCC) No.24930.

The 26S rDNA gene sequence is as follows (SEQ ID NO. 1):

AGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGA。

example 3 measurement of tolerance and probiotic Properties of Saccharomyces boulardii BD-2

And (3) measuring the tolerance and probiotic characteristics of the Saccharomyces boulardii BD-2 separated from the fermented grains of the white spirit, and measuring the acid resistance, the bile salt resistance, the high temperature resistance, the intestinal and gastric juice resistance, the self-aggregation property, the hydrophobicity, the antioxidant activity, the antibacterial property and the antibiotic sensitivity of the Saccharomyces boulardii BD-2.

Preparing a saccharomyces boulardii suspension: activating the strain in YPD liquid culture medium at 30 deg.C for two generations, centrifuging, removing supernatant to obtain thallus, washing with normal saline for three times to remove residual culture medium, adding normal saline to obtain thallus suspension, and adjusting thallus concentration to 1.0 × 10 ⁶ CFU/mL(OD _595nm = 1.0), the bacterial suspension prepared in this way is used for the subsequent performance measurements.

1. Tolerance assay for Saccharomyces boulardii BD-2

(1) Determination of high temperature resistance

100 mu L of BD-2 suspension of Saccharomyces boulardii was applied to YPD solid medium, and cultured in incubator at 35 deg.C, 37 deg.C, 40 deg.C, 45 deg.C, 50 deg.C, and 55 deg.C for 30min, and at the same time, cultured at conventional temperature (30 deg.C) as negative control, and the plate was observed to see if colonies were formed and counted to compare the growth status.

TABLE 1 relative survival rates of Saccharomyces boulardii at different temperatures

The growth of strain BD-2 is shown in Table 1. The survival rate of the strain can reach more than 70 percent when the growth temperature is between 30 ℃ and 50 ℃, the survival rate can reach 86.67 percent when the temperature of a human body is 37 ℃, the survival rate can reach 70 percent when the temperature is 50 ℃, and the viable count of BD-2 is rapidly reduced to 16.67 percent when the treatment temperature is higher than 50 ℃. The strain BD-2 shows strong heat resistance.

(2) Determination of acid resistance

Saccharomyces boulardiiInoculating the bacterial suspension into YPD liquid culture medium with pH of 2.5, 3.0, and 3.5 at 2%, respectively, culturing at 30 deg.C in a shaker at 180r/min for 24 hr, and measuring OD with ultraviolet spectrophotometer by using YPD liquid culture medium with conventional pH (pH 5.3) as negative control _595nm And comparing the growth conditions.

TABLE 2 growth of Saccharomyces boulardii at different pH values

As can be seen from Table 2, the strain BD-2 can grow normally at pH 3.5 and pH 3.0, and can still grow even though the OD value is slightly reduced at pH 2.5, and the survival rate reaches 82.08%, which indicates that the strain BD-2 has better acid resistance. The pH value of the gastric juice of the human body is changed according to the environment and is generally kept at about 3.0, so that the strain BD-2 can survive in the gastric juice of the human body and play a probiotic role.

(3) Determination of alkali resistance Performance

Inoculating 2% Saccharomyces boulardii suspension into YPD liquid culture medium with pH of 7.5, 8.0, 8.5, and 9.0, respectively, culturing at 30 deg.C in a shaker at 180r/min for 24h, and measuring OD with ultraviolet spectrophotometer using YPD liquid culture medium with conventional pH (pH 5.3) as negative control _595nm And comparing the growth conditions.

TABLE 3 growth of Saccharomyces boulardii at different pH values

As can be seen from Table 3, the strain BD-2 can grow normally at pH 7.5 and pH 8.0, but the OD value begins to decrease at pH8.5, but the strain BD-2 can still grow, and the survival rate reaches 87.70%, which indicates that the strain BD-2 has better alkali resistance. The pH of the intestinal juice of the human body is usually kept at about 8.0, so that the strain BD-2 can survive in the intestinal juice of the human body and play a probiotic role.

(4) Determination of the bile salt resistance

Taking 100 mu L of the saccharomyces boulardii suspension, respectively coating the suspension on YPD solid culture media with the content of bile salts of 0.3%, 0.5%, 1.0%, 1.2%, 1.5%, 1.8% and 2.0%, culturing for 24h in an incubator at the constant temperature of 30 ℃, simultaneously taking the conventional YPD culture medium without the bile salts as a negative control, observing whether the plate has the colony generation and counting, and comparing the growth conditions.

TABLE 4 survival rate of Saccharomyces boulardii at different bile salt contents

As intestinal probiotics, the intestinal probiotics need to have certain cholate resistance so as to ensure that the intestinal probiotics can successfully pass through the digestive tract and can survive and colonize in the intestinal tract to exert the probiotic activity. The results of the bile salt resistance test of strain BD-2 are shown in Table 4. When the content of bile salt is between 0 and 1.0 percent, the viable count of the strain BD-2 is basically unchanged, and the survival rate is higher; when the bile salt content exceeds 1.0%, the survival rate is slightly reduced, but still exceeds 60%. Therefore, the strain BD-2 has higher bile salt resistance. While the normal bile salt content in the human body is only 0.3% -0.5%, the bacterial strain BD-2 can be well survived in the human body and can play a probiotic role.

2. Determination of probiotic Properties of Saccharomyces boulardii BD-2

(1) Determination of the gastric juice resistance of the intestine

Simulated artificial gastric fluid: 8g of sodium chloride, 1.15g of disodium hydrogen phosphate, 0.2g of potassium dihydrogen phosphate, 3.5g of pepsin and 1000mL of distilled water, adjusting the pH value to 3.0 by using 1mol/L hydrochloric acid, and sterilizing at 115 ℃ for 20min.

Simulating artificial intestinal juice: 8g of sodium chloride, 1.15g of disodium hydrogen phosphate, 0.2g of potassium dihydrogen phosphate, 1g of trypsin, 3g of bile salt and 1000mL of distilled water, adjusting the pH value to 8.0 by using 1mol/L of sodium hydroxide, and sterilizing at 115 ℃ for 20min.

(1) Adding 1mL of saccharomyces boulardii suspension into 9mL of simulated artificial gastric juice, placing in an incubator at 30 ℃, sampling and diluting in a gradient manner after 0h and 3h respectively, coating on a YPD solid plate, and calculating the survival rate.

(2) Adding 1mL of saccharomyces boulardii suspension into 9mL of simulated artificial intestinal fluid, placing in an incubator at 30 ℃, sampling and diluting in a gradient manner after 0h and 3h respectively, coating on a YPD solid plate, and calculating the survival rate.

TABLE 5 simulated survival rates of Saccharomyces boulardii in artificial intestinal gastric juice

The growth conditions of the bacterial strain after simulated artificial intestines and gastric juice treatment are shown in table 5, after the bacterial strain BD-2 is treated in simulated gastric juice with the pH value of 3.0 for 3 hours, the survival rate of the bacterial strain BD-2 in gastric juice is 193.33 percent, and the bacterial strain BD-2 shows excellent tolerance; after the strain BD-2 is treated in simulated intestinal fluid with the pH value of 8.0 for 3 hours, the survival rate of the strain BD-2 in the intestinal fluid is 79.15 percent, and the strain also has better tolerance capability.

(2) Determination of self-aggregation

Culturing Saccharomyces boulardii suspension at 30 deg.C for 0h, and measuring OD of the suspension with spectrophotometer _595nm The value is obtained. The solution was then incubated at 30 ℃ for 3 hours in an incubator, the supernatant carefully aspirated, and the OD again determined _595nm The value is obtained. The self-cohesion force was calculated as follows:

self-aggregation% = [1- (A) _j /A _i )×100]

Wherein A is _i For 0h OD _595nm Value, A _j For OD after 3h of culture _595nm The value is obtained.

The evaluation of the self-aggregation ability of strains has been used as an in vitro method for screening strains with probiotic potential, and the formation of self-aggregation can shield central cells from the external harmful environment. By measuring OD _595nm The self-aggregation rate of the strain BD-2 was found to be high, reaching 88.4%.

(3) Measurement of hydrophobicity

Adding 3mL of saccharomyces boulardii suspension into 1mL of solvent (n-hexane, dichloromethane, ethyl acetate, dodecane, chloroform), reacting at 30 ℃ for 10min, shaking, mixing uniformly, balancing temperature, and continuously culturing at 30 ℃ for 3h. Take 0h andOD measured in 1mL aqueous phase at 3h _595nm The value is obtained. The hydrophobicity was calculated as follows:

hydrophobicity% = [1- (A) _j /A _i )×100]

Wherein A is _i For 0h OD _595nm Value, A _j For 3h OD _595nm The value is obtained.

Hydrophobicity is widely used to evaluate adhesion of probiotics, and specific adhesion of probiotics to intestinal epithelial cells helps to colonize in the intestinal tract, inhibit pathogenic bacteria from colonizing in the intestinal tract and improve immunity of the organism. The measurement result shows that the strain BD-2 has higher hydrophobicity for n-hexane, dichloromethane, dodecane and chloroform, which are 52.01%,54.13%,51.4% and 54.25%, respectively, and has lower hydrophobicity for ethyl acetate, which is 19.52%.

(4) Determination of antioxidant Activity

(1) Determination of reducing ability

The reduction capacity was determined by potassium ferricyanide method. Respectively taking 0.5mL of each of the saccharomyces boulardii suspension, 0.2mol/L PBS and 1g/100mL of potassium ferricyanide solution, uniformly mixing in an EP tube, carrying out water bath reaction at 50 ℃ for 20min, and placing in ice for quenching. Then 0.5mL of 10g/100mL of trichloroacetic acid solution is added, the mixture is centrifuged at 4000r/min for 5min, 1mL of supernatant is taken, and the supernatant is uniformly mixed with 1mL of ultrapure water and 1mL of 0.1g/100mL of ferric chloride solution, and the mixture is kept stand for 10min. Replacing bacterial suspension with PBS buffer solution as blank control, and measuring OD by ultraviolet spectrophotometry _700nm Numerical values, reduction capacity were calculated as follows:

reduction ability (%) = (a) ₁ -A ₀ )/A ₀ ×100

Wherein, A ₀ Blank absorbance values; a. The ₁ Is the absorbance of the sample.

(2) Ability to scavenge hydroxyl radicals

Respectively taking 1mL of each of 5mmol/L ferrous sulfate solution, 5mmol/L salicylic acid ethanol solution and 3mmol/L hydrogen peroxide solution into a centrifuge tube, adding 2mL of Saccharomyces boulardii suspension, adding 5mL of distilled water, reacting in a water bath kettle at 30 ℃ for 15min, centrifuging at 6000r/min for 10min, taking supernate, and measuring OD (optical density) by using an ultraviolet spectrophotometer _{510 nm} The absorbance values were measured and distilled water was used as a blank. Clearance was calculated as follows:

clearance (%) = (a) ₀ -A ₁ )/A ₀ ×100

Wherein A is ₀ The OD value of the control group is obtained; a. The ₁ The OD value of the sample is shown.

(3) DPPH radical scavenging ability

Adding 2mL of Saccharomyces boulardii suspension into 1mL of 0.2mmol/L DPPH solution, mixing, reacting at 30 deg.C in dark environment for 30min, centrifuging at 6000r/min for 10min to obtain supernatant, replacing DPPH with equal volume of anhydrous ethanol as blank, using distilled water as control, and determining OD _517nm And (4) processing the absorbance value. Clearance was calculated as follows:

clearance (%) = [1- (a) ₀ -A ₁ )/A ₂ ]×100

Wherein, A ₀ Is a blank set of OD values, A ₁ OD values of the sample groups, A ₂ The OD value is the control group OD value.

The calculation shows that the strain BD-2 has the highest DPPH free radical scavenging activity of 73.27 percent, the reducing capacity of 62.40 percent and the hydroxyl free radical scavenging activity of 34.69 percent which are both more than 30 percent, and the result shows that the saccharomyces boulardii has better antioxidant activity.

(5) Antibiotic susceptibility assay

100 μ L of Saccharomyces boulardii suspension was applied to YPD solid medium. Antibiotic paper sheets were attached to the surface, and after 24h of incubation at 30 ℃, the diameter of the zone of inhibition was measured with a vernier caliper and the results were compared to the CLSI (american clinical laboratory standards institute) 2012 standard for evaluation.

TABLE 6 antibiotic susceptibility of Saccharomyces boulardii

Note: "R" represents drug resistance.

The result of antibiotic susceptibility experiment shows that the Blakebi yeast BD-2 is not susceptible to 11 drug-sensitive paper sheets of erythromycin, penicillin, chloramphenicol, cefotaxime, ceftriaxone, ciprofloxacin, tetracycline, kanamycin, streptomycin, gentamicin and vancomycin, and has strong drug resistance to the 11 antibiotics.

Example 4 inhibition of helicobacter pylori by Blattella BD-2

The helicobacter pylori inhibiting activity of the Saccharomyces boulardii BD-2 is measured, and the bacteriostatic ability of the Saccharomyces boulardii BD-2 and the inhibiting ability of the Saccharomyces boulardii BD-2 to helicobacter pylori are measured in combination with a medicine for four-combination therapy for treating helicobacter pylori in medicine.

Preparing a saccharomyces boulardii suspension: activating strain in YPD liquid culture medium at 30 deg.C for two generations, centrifuging, removing supernatant to obtain thallus, washing with normal saline for three times to remove residual culture medium, adding normal saline to obtain thallus suspension, and adjusting thallus concentration to 1.0 × 10 ⁶ CFU/mL(OD _595nm ＝1.0)。

Preparation of the four-combination therapy medicament: 20mg of rabeprazole, 1g of amoxicillin, 0.5g of clarithromycin and 0.6g of bismuth potassium citrate, and 100mL of liquid medicine is prepared by water.

The antibacterial activity of the strain of saccharomyces boulardii was determined by the double-layer agar diffusion method. Adding 10mL of 2% (w/v) water agar culture medium into a sterilized flat plate, placing into a sterilized Oxford cup after the water agar is solidified, and adding helicobacter pylori (1 × 10) into 20mL of Combia blood agar culture medium at proper temperature ⁸ CFU/mL, add 1 mL), pour into the plate after the intensive mixing, after the upper culture medium solidifies, take out the oxford cup, add each sample in the different downthehole respectively: 180 mu L of BD-2 bacterial suspension, 180 mu L of quadruplex drug, 120 mu L of quadruplex drug + 60 mu L of BD-2 bacterial suspension (1.

TABLE 7 inhibitory Activity of Saccharomyces boulardii on helicobacter pylori

The experimental result shows that the strain BD-2 has certain inhibitory activity on helicobacter pylori, and although the inhibition zone diameter of the quadruple drug is large without a positive control, when the quadruple drug: when the BD-2 ratio was 1.5 or 1:1, the effects similar to those of the positive control were almost achieved. Therefore, the preliminary conclusion that the blakeda can be used for replacing a part of the tetrad drug to treat the helicobacter pylori, and the result of the antibiotic sensitivity shows that the blakeda has drug resistance to the antibiotic and can be used together with the antibiotic, so that the imbalance of the proportion of the intestinal flora caused by the antibiotic treatment can be relieved. Therefore, the saccharomyces boulardii can be tried to be applied to the treatment of the helicobacter pylori by combining with the quadruple therapy, so that the adverse reaction rate caused by the medicine is reduced, and the safety of the helicobacter pylori treatment therapy is improved.

The above description is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above-described embodiments. It will be understood by those skilled in the art that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention.

Claims (7)

1. A Saccharomyces boulardii BD-2 is CGMCC No.24930.

2. Use of Saccharomyces boulardii (BD-2) according to claim 1.

3. Use according to claim 2, in the field of food or pharmaceutical preparation.

4. The use according to claim 2, in the preparation of a food or a medicament for inhibiting helicobacter pylori, for modulating the intestinal flora.

5. The use of claim 4, wherein the agent for inhibiting helicobacter pylori is Saccharomyces boulardii BD-2 bacterial liquid.

6. The use according to claim 4, wherein the helicobacter pylori inhibiting drug is a combination of a strain of Saccharomyces boulardii BD-2 with a standard tetrad therapy drug;

the standard four-combination therapy drugs are: rabeprazole, amoxicillin, clarithromycin and bismuth potassium citrate.

7. The use as claimed in claim 6, wherein the tetrad therapy medicament and the bacterial liquid of the saccharomyces boulardii BD-2 are prepared into the anti-helicobacter pylori therapeutic medicament according to a volume ratio of 1;

the preparation of the tetrad therapy medicament comprises the following steps: 20mg of rabeprazole, 1g of amoxicillin, 0.5g of clarithromycin and 0.6g of bismuth potassium citrate, and 100mL of liquid medicine is prepared by water;

the BD-2 bacterial liquid concentration of the Saccharomyces boulardii is 1.0 × 10 ⁶ CFU/mL。

Images