CN115820932B - Nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor - Google Patents
Nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor Download PDFInfo
- Publication number
- CN115820932B CN115820932B CN202211275598.6A CN202211275598A CN115820932B CN 115820932 B CN115820932 B CN 115820932B CN 202211275598 A CN202211275598 A CN 202211275598A CN 115820932 B CN115820932 B CN 115820932B
- Authority
- CN
- China
- Prior art keywords
- field effect
- effect transistor
- nucleic acid
- graphene field
- graphene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 title claims abstract description 71
- 229910021389 graphene Inorganic materials 0.000 title claims abstract description 71
- 150000007523 nucleic acids Chemical class 0.000 title claims abstract description 57
- 238000001514 detection method Methods 0.000 title claims abstract description 55
- 108020004707 nucleic acids Proteins 0.000 title claims abstract description 52
- 102000039446 nucleic acids Human genes 0.000 title claims abstract description 52
- 230000005669 field effect Effects 0.000 title claims abstract description 49
- 108091033409 CRISPR Proteins 0.000 title description 4
- 238000010354 CRISPR gene editing Methods 0.000 title description 4
- 238000003776 cleavage reaction Methods 0.000 claims abstract description 26
- 241000700627 Monkeypox virus Species 0.000 claims abstract description 24
- 238000000034 method Methods 0.000 claims abstract description 23
- 108091027544 Subgenomic mRNA Proteins 0.000 claims description 34
- 108020004414 DNA Proteins 0.000 claims description 18
- 239000007788 liquid Substances 0.000 claims description 16
- 238000006243 chemical reaction Methods 0.000 claims description 15
- 101150115175 B6R gene Proteins 0.000 claims description 14
- 101150029214 F3L gene Proteins 0.000 claims description 11
- 238000007789 sealing Methods 0.000 claims description 11
- 230000008859 change Effects 0.000 claims description 10
- 239000003292 glue Substances 0.000 claims description 10
- 238000012986 modification Methods 0.000 claims description 10
- 230000004048 modification Effects 0.000 claims description 10
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 8
- 230000007017 scission Effects 0.000 claims description 7
- 238000012546 transfer Methods 0.000 claims description 7
- HZAXFHJVJLSVMW-UHFFFAOYSA-N 2-Aminoethan-1-ol Chemical compound NCCO HZAXFHJVJLSVMW-UHFFFAOYSA-N 0.000 claims description 6
- 102000053602 DNA Human genes 0.000 claims description 6
- 239000004205 dimethyl polysiloxane Substances 0.000 claims description 6
- 238000002156 mixing Methods 0.000 claims description 6
- 229920000435 poly(dimethylsiloxane) Polymers 0.000 claims description 6
- -1 polydimethylsiloxane Polymers 0.000 claims description 6
- 238000002360 preparation method Methods 0.000 claims description 6
- 239000003822 epoxy resin Substances 0.000 claims description 5
- 229920000647 polyepoxide Polymers 0.000 claims description 5
- 230000000903 blocking effect Effects 0.000 claims description 2
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 239000000203 mixture Substances 0.000 claims description 2
- 239000002904 solvent Substances 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 12
- 230000000694 effects Effects 0.000 abstract description 10
- 239000012634 fragment Substances 0.000 abstract description 9
- 238000012216 screening Methods 0.000 abstract description 5
- 208000005871 monkeypox Diseases 0.000 description 14
- 239000000243 solution Substances 0.000 description 13
- 108700004991 Cas12a Proteins 0.000 description 8
- 241000700605 Viruses Species 0.000 description 7
- 238000000338 in vitro Methods 0.000 description 7
- 239000000523 sample Substances 0.000 description 7
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 6
- 241001112090 Pseudovirus Species 0.000 description 6
- 102200145627 rs3734675 Human genes 0.000 description 5
- 101100385358 Alicyclobacillus acidoterrestris (strain ATCC 49025 / DSM 3922 / CIP 106132 / NCIMB 13137 / GD3B) cas12b gene Proteins 0.000 description 4
- 238000011529 RT qPCR Methods 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 102100035102 E3 ubiquitin-protein ligase MYCBP2 Human genes 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 3
- 230000000875 corresponding effect Effects 0.000 description 3
- 238000001952 enzyme assay Methods 0.000 description 3
- 238000001917 fluorescence detection Methods 0.000 description 3
- 229910052757 nitrogen Inorganic materials 0.000 description 3
- 102000004169 proteins and genes Human genes 0.000 description 3
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 3
- 241000700629 Orthopoxvirus Species 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 230000027455 binding Effects 0.000 description 2
- 150000001875 compounds Chemical class 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 239000004065 semiconductor Substances 0.000 description 2
- 230000008685 targeting Effects 0.000 description 2
- 230000003612 virological effect Effects 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- 241001063273 Alicyclobacillus acidiphilus Species 0.000 description 1
- 208000008035 Back Pain Diseases 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 108020004635 Complementary DNA Proteins 0.000 description 1
- 239000003298 DNA probe Substances 0.000 description 1
- 108010042407 Endonucleases Proteins 0.000 description 1
- 102000004533 Endonucleases Human genes 0.000 description 1
- 206010019233 Headaches Diseases 0.000 description 1
- 241000341655 Human papillomavirus type 16 Species 0.000 description 1
- 208000006083 Hypokinesia Diseases 0.000 description 1
- 208000008771 Lymphadenopathy Diseases 0.000 description 1
- 208000000112 Myalgia Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 206010037660 Pyrexia Diseases 0.000 description 1
- 101100316897 Severe acute respiratory syndrome coronavirus 2 E gene Proteins 0.000 description 1
- 101100240079 Severe acute respiratory syndrome coronavirus 2 N gene Proteins 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 208000032140 Sleepiness Diseases 0.000 description 1
- 206010041349 Somnolence Diseases 0.000 description 1
- 206010046865 Vaccinia virus infection Diseases 0.000 description 1
- 241000700647 Variola virus Species 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000002981 blocking agent Substances 0.000 description 1
- 238000000861 blow drying Methods 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000010804 cDNA synthesis Methods 0.000 description 1
- 101150059443 cas12a gene Proteins 0.000 description 1
- 101150098304 cas13a gene Proteins 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 238000010362 genome editing Methods 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical group [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 231100000869 headache Toxicity 0.000 description 1
- 230000010354 integration Effects 0.000 description 1
- 238000011901 isothermal amplification Methods 0.000 description 1
- 208000018555 lymphatic system disease Diseases 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 239000003068 molecular probe Substances 0.000 description 1
- 230000009871 nonspecific binding Effects 0.000 description 1
- 239000002243 precursor Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 238000004557 single molecule detection Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 239000013076 target substance Substances 0.000 description 1
- 229960005486 vaccine Drugs 0.000 description 1
- 208000007089 vaccinia Diseases 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleic acid detection method based on CRISPR-Cas trans-cleavage and a graphene field effect transistor. The method comprises the following steps: and amplifying the detection signal of the trans-cleavage of the Cas12b in the solution by using a graphene field effect transistor, and detecting the monkey poxvirus nucleic acid. The Cas12b-sgRNA has higher activity and specificity on DNA fragments, and the detection signal is amplified based on the graphene field effect transistor, so that the ultrasensitive detection of target DNA is realized, the detection time is short, the sensitivity is high, and the method can be better applied to the rapid screening of monkey pox viruses.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and relates to a nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor.
Background
Infectious diseases are a clinically important disease with highest incidence rate, such as monkey pox virus (MPXV) which is a double-stranded DNA virus with a full length of about 197kb, belonging to the genus orthopoxvirus of the family Poxvidae, and the early onset of precursor symptoms such as fever, chills, headache, somnolence, hypodynamia, back pain and myalgia of the monkey poxvirus, and obvious superficial lymphadenopathy of 90% of patients. RT-qPCR is a gold standard for current nucleic acid detection, and the method has high sensitivity and strong specificity. However, the RT-qPCR detection time is long, the instrument and the equipment are complex, the multi-step operation of a professional is needed, and the rapid detection of the RT-qPCR detection device on site is limited.
In recent years, as a genetic manipulation tool, gene editing technology has been rapidly developed, and is favored by a large number of scientific researchers, and has also demonstrated great potential in molecular diagnosis. Among them, cas12 protein has a unique trans-cleavage activity and has been widely used in the field of biosensing in recent years. At present, a high-sensitivity nucleic acid detection mode based on Cas12 mainly depends on a nucleic acid isothermal amplification technology, but has the problems of complex reaction system, long detection time, easy sample pollution and the like. Therefore, development of a single-molecule detection method without amplification and with high sensitivity is needed.
The field effect transistor sensor has the functions of signal conversion and signal amplification, realizes quantitative detection of a target substance through current signal change caused by combination of a target molecule and a semiconductor channel material, and has the advantages of high sensitivity, good selectivity, easiness in integration and the like. The graphene has the characteristics of large specific surface area, no dangling bond, high carrier concentration and carrier mobility, easy adjustment of energy band structure and the like, so that the surface of the graphene is easy to perceive tiny charge change. The graphene field effect transistor (gFET) sensor is a field effect transistor device manufactured by taking graphene as a channel material, target DNA is hybridized with complementary DNA fixed on the surface of the graphene to realize nucleic acid detection, and the detection time is short, the sensitivity is high, the sensor has great application value in the aspect of quick screening of microorganisms, for example, CN114150089A discloses a nucleic acid detection method based on CRISPR-Cas13a/Cas12a trans-cleavage and the graphene field effect transistor, cas13a/Cas12a is fixed on the surface of the graphene or combined with crRNA of targeted different viral nucleic acids in a solution to construct a Cas13a/Cas12a-crRNA compound, the Cas13a/Cas12a-crRNA compound is used for quickly cutting the ssRNA/ssDNA modified on the gFET, so that the change of a transfer characteristic curve is caused, and the response to SARS-CoV-2N gene, SARS-CoV-2E gene, SARS-CoV-2Orf1ab gene, HPV-16 or HPV-18 nucleic acid is realized. The detection is affected by a variety of complications, and challenges remain in how to design a corresponding efficient detection method for different target viruses.
In summary, developing a method based on CRISPR-Cas trans-cleavage and gFET nucleic acid detection against monkey poxvirus is of great significance to the field of monkey poxvirus detection.
Disclosure of Invention
Aiming at the defects and actual demands of the prior art, the invention provides a nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor, which utilizes Cas12b-sgRNA to have higher activity and specificity on DNA fragments, realizes ultrasensitive detection of target DNA, has short detection time and high sensitivity, and can be better applied to rapid screening of monkey pox viruses.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a method for detecting nucleic acid based on CRISPR-Cas trans-cleavage and graphene field effect transistors, the method comprising:
and amplifying the detection signal of the trans-cleavage of the Cas12b in the solution by using a graphene field effect transistor, and detecting the monkey poxvirus nucleic acid.
In the invention, the Cas12b protein is derived from Alicyclobacillus acidiphilus bacteria, cas12b has trans-cleavage activity, and the characteristic of Cas12b endonuclease is activated through the recognition of sgRNA on a target fragment, so that single-stranded nucleic acid (ssDNA) fixed on a graphene layer can be nonspecifically cleaved, the current between a source electrode and a drain electrode in a graphene field effect transistor (gFET) is rapidly changed, the ultrasensitive detection of the target DNA is realized, compared with Cas12a in the same family, cas12b recognizes a PAM sequence of 5'-TTN (Cas 12aPAM sequence is 5' -TTTN), and monkey pox and other orthopoxviruses with extremely high homology can be better distinguished, so that the detection of monkey pox viruses with high specificity and sensitivity is realized.
Preferably, the method comprises a graphene field effect transistor preparation step, a reporter modification step and a nucleic acid detection step.
Preferably, the graphene field effect transistor preparation step includes:
and customizing a commercial graphene field effect transistor chip, constructing a polydimethylsiloxane micro-fluidic chamber after the chip is led, fixing the micro-fluidic chamber on the chip by epoxy resin glue, inserting a liquid inlet pipe and a liquid outlet pipe into the chamber and performing glue sealing, and connecting the other end of the liquid outlet pipe with a pump to obtain the graphene field effect transistor.
Preferably, the reporter modification step comprises:
and incubating the PBASE solution on the surface of a graphene channel of the graphene field effect transistor, incubating the amino-modified ssDNA on the surface of the graphene, and sealing.
Preferably, the ssDNA is a random sequence of 20 to 40 nt.
Preferably, the reporter modification step comprises:
incubating the PBASE solution on the graphene channel surface of the graphene field effect transistor for 1-3 h, incubating the amino-modified ssDNA on the graphene surface for 3-9 h (for example, 4h, 5h, 6h, 7h or 8 h), and sealing for 1-3 h.
Preferably, the solvent of the PBASE solution is selected from ethanol and/or DMF.
In the present invention, the concentration of the PBASE solution is 1 mM-3 mM.
Preferably, the blocking agent comprises ethanolamine.
Preferably, the concentration of ethanolamine is 100 mM-200 mM, including but not limited to 101mM (mmol/L), 102mM, 103mM, 105mM, 106mM, 110mM, 120mM, 130mM, 150mM, 160mM, 180mM, 190mM, 192mM, 193mM, 195mM, 196mM, 197mM, 198mM or 199mM.
Preferably, the ssDNA is at a concentration of 1. Mu.M to 5. Mu.M, including but not limited to 2. Mu.M (μmol/L), 3. Mu.M, or 4. Mu.M.
Preferably, the nucleic acid detecting step includes:
and forming a Cas12b-sgRNA complex by the Cas12b and the sgRNA, mixing a sample to be detected and the Cas12b-sgRNA complex, adding the mixed sample into a graphene field effect transistor for reaction, and recording the change of a transfer characteristic curve after the reaction.
Preferably, the target of the sgRNA comprises the monkey poxvirus B6R gene and/or the F3L gene.
Preferably, the target point of the sgRNA is selected from any one or a combination of at least two of the nucleic acid sequences shown in SEQ ID NO. 1-SEQ ID NO. 4.
SEQ ID NO.1：5’-TGGGTGTCATATTTCTAATC-3’。
SEQ ID NO.2：5’-TATATGATAAGCCATTATAC-3’。
SEQ ID NO.3：5’-TGACAGGGTTAACACCTTTC-3’。
SEQ ID NO.4：5’-CTATTATAGCATCAGCATCA-3’。
Preferably, the sgRNA is selected from any one or a combination of at least two of the nucleic acid sequences shown in SEQ ID NO. 5-SEQ ID NO. 8.
SEQ ID NO.5：
GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUGGGUGUCAUAUUUCUAAUC。
SEQ ID NO.6：
GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACGUAUAAUGGCUUAUCAUAUA。
SEQ ID NO.7：
GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACGAAAGGUGUUAACCCUGUCA。
SEQ ID NO.8：
GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUGAUGCUGAUGCUAUAAUAG。
In the invention, specific sequence sgRNA is designed and screened aiming at monkey poxvirus to further improve detection specificity and sensitivity.
Preferably, the concentration ratio of Cas12b to sgRNA is 1 (1-5), including but not limited to 1:2, 1:3, or 1:4.
Preferably, the Cas12b has a concentration of 100nM to 500nM, including but not limited to 102nM, 104nM, 106nM, 108nM, 109nM, 150nM, 200nM, 250nM, 280nM, 320nM, 350nM, 380nM, 400nM, 410nM, 420nM, 450nM, 460nM, 480nM, 490nM, 492nM, 494nM, 496nM, 498nM, or 499nM.
Preferably, the sgRNA has a concentration of 100nM to 500nM, including but not limited to 102nM, 104nM, 106nM, 108nM, 109nM, 150nM, 200nM, 250nM, 280nM, 320nM, 350nM, 380nM, 400nM, 410nM, 420nM, 450nM, 460nM, 480nM, 490nM, 492nM, 494nM, 496nM, 498nM or 499nM.
Preferably, the temperature of the reaction is 40-60 ℃, including but not limited to 41 ℃, 42 ℃, 43 ℃, 44 ℃, 45 ℃, 46 ℃, 47 ℃, 48 ℃,50 ℃, 52 ℃, 54 ℃, 56 ℃, 58 ℃ or 59 ℃ for 30-50 min, including but not limited to 31min, 32min, 33min, 34min, 35min, 36min, 37min, 38min, 39min, 42min, 44min, 45min, 46min or 48min.
As a preferred technical scheme, the CRISPR-Cas trans-cleavage and graphene field effect transistor-based nucleic acid detection method comprises the following steps:
(1) Customizing a commercial graphene field effect transistor chip, constructing a polydimethylsiloxane micro-fluidic chamber after wire leading, fixing the micro-fluidic chamber on the chip by epoxy resin glue, inserting a liquid inlet pipe and a liquid outlet pipe into the chamber and performing glue sealing, and connecting the other end of the liquid outlet pipe with a pump to obtain the graphene field effect transistor;
(2) Incubating a PBASE solution on the surface of a graphene channel of the graphene field effect transistor, incubating amino-modified ssDNA on the surface of graphene, and sealing;
(3) Forming a Cas12b-sgRNA complex by the Cas12b and the sgRNA, mixing a sample to be detected and the Cas12b-sgRNA complex, adding the mixture into the graphene field effect transistor treated in the step (2) for reaction, and recording the change of a transfer characteristic curve after the reaction;
the sgRNA is selected from any one or the combination of at least two of the nucleic acid sequences shown in SEQ ID NO. 5-SEQ ID NO. 8.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a method for detecting monkey pox virus based on CRISPR-Cas12b trans-cleavage and graphene field effect transistor nucleic acid, which utilizes Cas12b-sgRNA complex to have higher activity and specificity on DNA fragments, when sgRNA recognizes target DNA fragments to activate Cas12b, cas12b can rapidly cleave ssDNA fixed on the surface of graphene, so that current between a source electrode and a drain electrode in gFET is rapidly changed, thereby realizing ultrasensitive detection of the target DNA, and in addition, by designing specific sgRNA, the detection sensitivity and specificity are further improved.
Drawings
FIG. 1 is a graph of the results of in vitro cleavage fluorescence detection of two targets of the B6R gene;
FIG. 2 is a graph of the results of fluorescence detection of in vitro cleavage of two targets of the F3L gene;
FIG. 3 is a transfer characteristic diagram;
FIG. 4 is a graph showing the results of fluorescence detection of monkey pox nucleic acids at different concentrations by in vitro cleavage with F3L sgRNA1 and sgRNA 2;
FIG. 5 is a graph showing the results of detecting monkey pox nucleic acids at various concentrations using gFET;
FIG. 6 is a partial nucleic acid sequence of the B6R gene of the virus having high homology with monkey pox;
FIG. 7 is a graph of fluorescence results of detection of B6R gene by Cas12a/Cas 12B.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
In the specific embodiment of the invention, the B6R gene and the F3L gene of the monkey pox virus are taken as examples to verify the method for detecting the monkey pox virus based on the trans-cleavage of Cas12B and the gFET.
Example 1
This example detects the monkey poxvirus B6R gene.
1. Screening of specific Simian poxvirus B6R Gene sgRNA
Searching monkey pox, vaccinia, varicella, camelpox, vaccine and smallpox virus genome, comparing B6R gene sequences, and finding out a difference sequence, wherein two targets of B6R are respectively: 5'-TGGGTGTCATATTTCTAATC-3' (SEQ ID NO. 1); 5'-TATATGATAAGCCATTATAC-3' (SEQ ID NO. 2), designing corresponding sgRNAs (B6R-sgRNA 1 and B6R-sgRNA2 as shown in Table 1), performing in vitro enzyme assay to verify the activity and specificity of the sgRNAs, adding 2 μl of buffer solution, 500nM of Cas12B protein, 500nM of sgRNA, 10 μM of molecular probe and 10nM of target DNA into a 20 μl reaction system, taking the reaction system without the added sgRNAs as a negative control, incubating for 40min at 50 ℃, and measuring fluorescence values by an enzyme-labeled instrument, wherein the result is shown in FIG. 1, and shows that the sgRNAs of two targets B6R have higher efficiency.
gFET preparation.
And customizing a commercial gFET chip, constructing a polydimethylsiloxane micro-fluidic chamber after the chip is led, fixing the polydimethylsiloxane micro-fluidic chamber on the chip by using epoxy resin glue, inserting a liquid inlet pipe and a liquid outlet pipe into the chamber, sealing the chamber by using glue seal, and connecting the other end of the liquid outlet pipe with a pump so as to suck liquid.
3. Modification of the reporter molecule.
(1) Dropping 1 mu L of PBASE solution with the concentration of 1mM dissolved in ethanol to a gate electrode part of a gFET device, incubating for 2 hours at 25 ℃ to enable the PBASE to be bound to the surface of graphene, then fully cleaning the graphene with 100% ethanol and 1 XPBS solution, and finally drying the device by nitrogen for the next modification experiment;
(2) 1. Mu.L of supersaturated (1. Mu.M) NH 2 -ssDNA is dropped onto the gate electrode portion of the gFET device, incubated at 25 ℃ for 6h, allowing the ssDNA reporter molecule to attach to PBASE and thereby fix on the graphene surface, followed by extensive washing with 1 x PBS solution, finally rinsing with PBS solution and blow-drying with nitrogen;
(3) 1 mu L of blocking solution (100 mM MHA) is dripped on the gate electrode area, incubated for 2h at 25 ℃ and dripped on the gate electrode area to fill non-binding sites on the surface of the gate electrode of the device, reduce false positive signals caused by non-specific binding in the detection process, and finally the device is flushed with PBS solution and dried with nitrogen.
4. Detection of monkey poxvirus B6R gene.
(1) Taking a commercially purchased simian poxvirus-related pseudovirus (Optic: TSV4731, TSV4724 of Optic, praeparata) comprising B6R and F3L gene sequences, extracting the pseudovirus nucleic acid using a viral nucleic acid extraction kit, and absolute quantification of the pseudovirus copy number using qPCR;
(2) Cas12B and B6R-sgRNA1 or sgRNA2 are mixed at a concentration of 1:1 to form a Cas12B-sgRNA complex, the Cas12B-sgRNA complex and pseudoviral nucleic acid are mixed and added into gFET, the reaction is carried out for 40min at 50 ℃, and the transfer characteristic curve is analyzed, and the result is that after the graphene chip is connected with PBASE and a probe, the surface carrier mobility becomes large, which indicates that the probe is successfully connected with the chip, as shown in figure 3.
TABLE 1
Example 2
This example detects the monkey poxvirus F3L gene.
1. Screening for specific monkey poxvirus F3L gene sgRNA.
Comparing F3L gene sequences to find out a difference sequence, wherein two targets of F3L are respectively: 5'-TGACAGGGTTAACACCTTTC-3' (SEQ ID NO. 3); 5'-CTATTATAGCATCAGCATCA-3' (SEQ ID NO. 4), and designing corresponding sgRNAs (F3L-sgRNA 1 and F3L-sgRNA2 as shown in Table 1), performing in vitro enzyme assay to verify the activity and specificity of the sgRNAs, wherein the operation steps are as shown in FIG. 2, which shows that the sgRNAs of two targets of F3L have higher efficiency, and performing in vitro digestion on monkey pox nucleic acids with different concentrations of 1fM, 10fM, 100fM, 1pM, 10pM, 100pM, 1nM and 10nM respectively, and the detection results are as shown in FIG. 4, wherein the fluorescence intensity of F3L-sgRNA1 is hardly changed when the concentration of the monkey pox nucleic acids is lower than 100fM, which indicates that the sensitivity of F3L-sgRNA1 binding to Cas12b for detecting monkey pox nucleic acids is about 100fM; similarly, for F3L-sgRNA2, when the concentration of monkey pox nucleic acid was below 10fM, there was little change in fluorescence intensity, indicating that F3L-sgRNA2 bound Cas12b was about 10fM sensitive to detection of monkey pox nucleic acid, indicating that the targeting efficiency of sgRNA1 and sgRNA2 was higher and that the targeting efficiency of sgRNA2 was somewhat higher.
gFET preparation: the procedure is as in example 1.
3. Modification of reporter molecules: the procedure is as in example 1.
4. Detection of monkey poxvirus F3L gene.
Extracting monkey pox pseudovirus nucleic acid by using a kit, mixing Cas12b and F3L-sgRNA2 at a concentration of 1:1 to form a Cas12b-sgRNA complex, mixing the Cas12b-sgRNA complex with the pseudovirus nucleic acid, adding the mixed Cas12b-sgRNA complex and the pseudovirus nucleic acid into a gFET, judging whether the gFET has the effect that the Cas12b-sgRNA complex cleaves DNA fragments or not by observing signals of voltages through a 4200SCS semiconductor analyzer,when Cas12B-sgRNA complex recognizes and cleaves monkey pox nucleic acids, a voltage is generated, fig. 5 is the results of the detection of different concentrations of monkey pox nucleic acids F3L gene and B6R gene by the gFET, with the without ssDNA set indicating no probe added as a negative control, so no change in voltage is observed; with ssDNA (B6R) and with ssDNA (F3L) means that the single-stranded DNA probe is coated on gFET and then the B6R and F3L gene fragments are detected respectively, and the ordinate is delta I/I 0 For the difference value between the real-time voltage and the initial voltage/the initial voltage, the abscissa indicates time, and as can be known from the voltage change in the graph, the Cas12B-sgRNA can recognize and cleave the B6R and F3L nucleic acid fragments, the nucleic acid concentration is positively correlated with the time, and the minimum detection limit can reach 0.5fg/mL.
Comparative example 1
The comparison example adopts the Cas12a enzyme and the Cas12b enzyme for comparison of detection sensitivity, and because the PAM locus of the Cas12a enzyme is 5'-TTTN-3', certain limitation exists in the aspect of sgRNA design, and the PAM locus of the Cas12b enzyme is 5'-TTN-3', and the method has certain advantages for designing and distinguishing virus nucleic acid with higher homology. FIG. 6 shows that the partial sequence of B6R gene of virus nucleic acid with higher monkey pox homology is designed, B6R-sgRNA2 is designed for the partial sequence, B6R-crRNA1 related to Cas12a is designed (see Table 1 in detail), cas12a and B6R-crRNA1, cas12B and B6R-sgRNA2 are mixed at the concentration of 1:1, fluorescence values are detected through in vitro enzyme assay, and the cleavage efficiency of Cas12B and B6R-sgRNA2 complex is higher than that of Cas12a and B6R-crRNA1 complex for different homologous virus B6R sequences as shown in FIG. 7, so that the Cas12B used in the invention and the sgRNA matched with the designed for distinguishing other viruses with high monkey pox virus homology have certain advantages.
In summary, the invention provides a method for detecting monkey pox virus based on CRISPR-Cas12b trans-cleavage and graphene field effect transistor nucleic acid, which utilizes Cas12b-sgRNA complex to have higher activity and specificity on DNA fragments, when sgRNA recognizes target DNA fragments to activate Cas12b, cas12b can rapidly cleave ssDNA immobilized on the surface of graphene, so that current between a source electrode and a drain electrode in gFET is rapidly changed, thereby realizing ultrasensitive detection of the target DNA, and in addition, by designing specific sgRNA, the detection sensitivity and specificity are further improved.
The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.
Claims (9)
1. A method for detecting nucleic acid based on CRISPR-Cas trans-cleavage and graphene field effect transistors for non-diagnostic purposes, the method comprising:
amplifying a detection signal of the reverse cleavage of Cas12b in the solution by using a graphene field effect transistor, and detecting the monkey poxvirus nucleic acid;
the method comprises a graphene field effect transistor preparation step, a reporter molecule modification step and a nucleic acid detection step;
the nucleic acid detection step includes:
forming a Cas12b-sgRNA complex by the Cas12b and the sgRNA, mixing a sample to be detected and the Cas12b-sgRNA complex, adding the mixed sample into a graphene field effect transistor for reaction, and recording the change of a transfer characteristic curve after the reaction;
the target point of the sgRNA is selected from a monkey poxvirus B6R gene and an F3L gene;
the target point of the sgRNA is selected from SEQ ID NO.2 and SEQ ID NO.3;
the sgRNA is selected from SEQ ID NO.6 and SEQ ID NO.7.
2. The CRISPR-Cas trans-cleavage and graphene field effect transistor based nucleic acid detection method according to claim 1, wherein the graphene field effect transistor preparation step comprises:
and customizing a commercial graphene field effect transistor chip, constructing a polydimethylsiloxane micro-fluidic chamber after the chip is led, fixing the micro-fluidic chamber on the chip by epoxy resin glue, inserting a liquid inlet pipe and a liquid outlet pipe into the chamber and performing glue sealing, and connecting the other end of the liquid outlet pipe with a pump to obtain the graphene field effect transistor.
3. The CRISPR-Cas trans-cleavage and graphene field effect transistor based nucleic acid detection method according to claim 2, wherein the reporter modification step comprises:
and incubating the PBASE solution on the surface of a graphene channel of the graphene field effect transistor, incubating the amino-modified ssDNA on the surface of the graphene, and sealing.
4. The CRISPR-Cas trans-cleavage and graphene field effect transistor based nucleic acid detection method according to claim 3, wherein the ssDNA is a random sequence of 20-40 nt;
the reporter modification step includes:
incubating the PBASE solution on the surface of a graphene channel of the graphene field effect transistor for 1-3 hours, incubating the amino-modified ssDNA on the surface of the graphene for 3-9 hours, and sealing for 1-3 hours.
5. The CRISPR-Cas trans-cleavage and graphene field effect transistor based nucleic acid detection method according to claim 4, characterized in that the solvent of the PBASE solution is selected from ethanol and/or DMF.
6. The CRISPR-Cas trans cleavage and graphene field effect transistor based nucleic acid detection method according to claim 4, wherein the blocking reagent comprises ethanolamine.
7. The nucleic acid detection method based on CRISPR-Cas trans-cleavage and graphene field effect transistor according to claim 6, wherein the concentration ratio of Cas12b to sgRNA is 1 (1-5);
the concentration of the Cas12b is 100 nM-500 nM;
the concentration of the sgRNA is 100 nM-500 nM.
8. The CRISPR-Cas trans-cleavage and graphene field effect transistor based nucleic acid detection method according to claim 7, wherein the reaction temperature is 40-60 ℃ for 30-50 min.
9. The CRISPR-Cas trans cleavage and graphene field effect transistor based nucleic acid detection method according to any one of claims 1 to 8, characterized in that the method comprises the steps of:
(1) Customizing a commercial graphene field effect transistor chip, constructing a polydimethylsiloxane micro-fluidic chamber after wire leading, fixing the micro-fluidic chamber on the chip by epoxy resin glue, inserting a liquid inlet pipe and a liquid outlet pipe into the chamber and performing glue sealing, and connecting the other end of the liquid outlet pipe with a pump to obtain the graphene field effect transistor;
(2) Incubating a PBASE solution on the surface of a graphene channel of the graphene field effect transistor, incubating amino-modified ssDNA on the surface of graphene, and sealing;
(3) And (3) forming a Cas12b-sgRNA complex by the Cas12b and the sgRNA, mixing a sample to be detected and the Cas12b-sgRNA complex, adding the mixture into the graphene field effect transistor treated in the step (2) for reaction, and recording the change of a transfer characteristic curve after the reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211275598.6A CN115820932B (en) | 2022-10-18 | 2022-10-18 | Nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211275598.6A CN115820932B (en) | 2022-10-18 | 2022-10-18 | Nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115820932A CN115820932A (en) | 2023-03-21 |
| CN115820932B true CN115820932B (en) | 2023-12-22 |
Family
ID=85524941
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211275598.6A Active CN115820932B (en) | 2022-10-18 | 2022-10-18 | Nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820932B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110551800A (en) * | 2018-06-03 | 2019-12-10 | 上海吐露港生物科技有限公司 | Application of high-temperature-resistant Cas protein, and detection method and kit of target nucleic acid molecule |
| CN113355397A (en) * | 2021-06-24 | 2021-09-07 | 深圳市第二人民医院(深圳市转化医学研究院) | Field effect transistor chip, kit for detecting nucleic acid and method for detecting nucleic acid content |
| CN113684317A (en) * | 2021-09-09 | 2021-11-23 | 贵州中医药大学第二附属医院 | Ultra-sensitive rapid detection and identification system for B type and C type hepatitis B virus based on CRISPR-Cas12B |
| CN114150089A (en) * | 2021-12-16 | 2022-03-08 | 清华大学 | CRISPR-Cas-based trans-cleavage and gFET nucleic acid detection |
| CN115161414A (en) * | 2022-06-10 | 2022-10-11 | 艾康生物技术(杭州)有限公司 | Specificity detection target of monkeypox virus, oligonucleotide and kit thereof |
-
2022
- 2022-10-18 CN CN202211275598.6A patent/CN115820932B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110551800A (en) * | 2018-06-03 | 2019-12-10 | 上海吐露港生物科技有限公司 | Application of high-temperature-resistant Cas protein, and detection method and kit of target nucleic acid molecule |
| CN113355397A (en) * | 2021-06-24 | 2021-09-07 | 深圳市第二人民医院(深圳市转化医学研究院) | Field effect transistor chip, kit for detecting nucleic acid and method for detecting nucleic acid content |
| CN113684317A (en) * | 2021-09-09 | 2021-11-23 | 贵州中医药大学第二附属医院 | Ultra-sensitive rapid detection and identification system for B type and C type hepatitis B virus based on CRISPR-Cas12B |
| CN114150089A (en) * | 2021-12-16 | 2022-03-08 | 清华大学 | CRISPR-Cas-based trans-cleavage and gFET nucleic acid detection |
| CN115161414A (en) * | 2022-06-10 | 2022-10-11 | 艾康生物技术(杭州)有限公司 | Specificity detection target of monkeypox virus, oligonucleotide and kit thereof |
Non-Patent Citations (3)
| Title |
|---|
| Andrea Boninia等.Advances in biosensing: The CRISPR/Cas system as a new powerfultool for the detection of nucleic acids.《Journal of Pharmaceutical and Biomedical Analysis》.2021,第192卷第1-12页. * |
| Lingjing Mao等.Development and Characterization of Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of Monkeypox Virus.《Viruses》.2022,第14卷(第10期),第1-12页. * |
| Yu Li等.Detection of monkeypox virus with real-time PCR assays.《Journal of Clinical Virology》.2006,第36卷第194-203页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115820932A (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111560482B (en) | Detection method based on CRISPR/Cas and nucleic acid test paper and human papilloma virus detection kit | |
| WO2022077687A1 (en) | Novel crispr nucleic acid testing method and use | |
| Mukama et al. | Synergetic performance of isothermal amplification techniques and lateral flow approach for nucleic acid diagnostics | |
| CN108913812B (en) | Multiple liquid-phase chip detection method for porcine viral diarrhea pathogen and construction thereof | |
| CN112322705A (en) | Isothermal amplification fluorescence RMA method for multiple nucleic acid detection | |
| CN111286558A (en) | Novel coronavirus 2019-nCoV nucleic acid detection technology | |
| WO2022110335A1 (en) | Kit for rapidly detecting hepatitis b virus gene and detection method therefor | |
| US8841069B2 (en) | Dendron-mediated DNA virus detection | |
| CN115354070A (en) | Method for detecting nucleic acid based on microspheres | |
| CN115820932B (en) | Nucleic acid detection method based on CRISPR system trans-cutting and graphene field effect transistor | |
| Arkhis et al. | Capture of enveloped viruses using polymer tentacles containing magnetic latex particles | |
| CN115948614A (en) | Nucleic acid detection kit and detection method based on CRISPR/Cas12a system | |
| CN115505631A (en) | Recombinase-mediated nucleic acid isothermal amplification reaction system and application thereof | |
| CN1475576A (en) | Single chain DNA fast preparation technology and reagent box | |
| CN112359143A (en) | Isothermal index amplification method based on Y-type probe set and application thereof | |
| CN112779358A (en) | Immunochromatography method for detecting HPV16 type E6 gene mediated by dcas9 | |
| TW201802244A (en) | Methods of constructing circular template and detecting DNA molecules | |
| CN116162739A (en) | Primer group, microfluidic chip, kit and method for simultaneously detecting four pathogens of prawns | |
| Rasni et al. | Recombinase polymerase amplification and their application in phytopathogen detection | |
| CN115838834A (en) | Human rhinovirus type A and type C detection system based on RT-RAA and CRISPR/Cas12a | |
| CN112553374A (en) | RPA primer for detecting hepatitis E virus based on RPA-LFD method and application thereof | |
| CN112760422A (en) | Primer probe set and kit for multiple detection of avian influenza virus H5, H7 and H9 subtypes based on fluorescence RMA method | |
| CN115058493B (en) | DNA probe for multiple nucleic acid detection, CRISPR-reverse dot hybridization nucleic acid detection system and application | |
| CN113322353B (en) | RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus | |
| CN115747218A (en) | CrRNA and kit for detecting simian pox virus nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |