CN115820746A - Application of kinase gene in regulation of filamentous fungus hypha morphology - Google Patents

Abstract

The invention discloses application of a kinase gene in regulation of filamentous fungi hypha morphology. The invention constructs the RNP gene editing system in the filamentous fungi for the first time, and the constructed RNP system can edit the genes of the Aspergillus niger. Gene editing is carried out by combining with an RNP system, and the results show that when the MpkA gene is knocked out, the Aspergillus niger colony is small and slow in growth, and hyphae are short rod-shaped and basically have no branches. Meanwhile, when the Aspergillus niger MpkA gene is knocked out, the secretion amount of the protein can be promoted. The invention provides good materials and theoretical basis for genetic manipulation of filamentous fungi and application of high-throughput technology, and provides a research idea for development of filamentous fungi in the field of industrial enzyme preparations.

Description

Application of kinase gene in regulation of filamentous fungus hypha morphology

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of a kinase gene in regulation of hypha morphology of filamentous fungi. The gene is utilized to regulate the hypha structure of the aspergillus niger in a simplified manner, and the application of the gene in the aspect of secretion of the aspergillus niger total protein provides a reliable method and basis for the morphological regulation of filamentous fungi and the field of molecular genetics operation.

Background

Filamentous fungi are widely used in the field of bio-manufacturing as an efficient cell factory. It can be used for producing industrial enzyme preparations (protease, amylase, cellulase, lipase), polysaccharides, organic acids, antibiotics, biomembranes and other primary or secondary metabolites. In particular, the ability to express native or recombinant proteins. For example, aspergillus niger (Aspergillus niger) is commercially available for the production of citric acid and glucose oxidase, among others. Filamentous fungi are used as highly efficient cell factories, closely related to their unique morphological structure.

The main characteristic of filamentous fungi is the hyphal structure, e.g. the typical filamentous fungus aspergillus niger, in the form of tubular hyphae, i.e. one hyphae comprising long, rod-like main, branched, conidia aggregates. In many filamentous fungi, the hyphae of an individual can fuse with other hyphae of the same individual to form a hyphal network. In submerged culture, the macroscopic morphology ranges from discrete mycelia, to clustered aggregates of hyphae, to nearly spherical compact hyphal particles of a few millimeters in diameter. The dispersed hyphae can increase the production of certain acids (fumaric acid), proteins (amylase, neofructotransferase, phytase) and secondary metabolites (penicillin). However, the particulate macroscopic morphology facilitates the production of certain molecules, including citric acid, saccharifying enzymes, or polygalacturonases. Hypha growth provides a means for substrate colonization, hydrolase secretion, nutrient assimilation, morphogenesis regulation and environmental signal recognition. Hyphal growth and differentiation is a complex process requiring control of cell wall synthesis, polarized vesicle trafficking, endocytosis, phagocytosis, turgor pressure, organelle localization, and cytoplasmic translocation and fusion. In addition, filamentous fungi, unlike other multicellular organisms, are non-homokaryotic filamentous fungi whose nuclei are free to move throughout the mycelial network through septal pores, resulting in a multi-nuclear structure in the filamentous fungus. The special structure of the filamentous fungi increases the difficulty of genetic modification of the filamentous fungi, on one hand, genetic materials are difficult to penetrate through a complex cell network and a cell wall to enter cells, and on the other hand, relatively pure homonuclear mutants are difficult to obtain. Meanwhile, the complicated hypha structure of the filamentous fungi is not beneficial to the use of a high-throughput technology, and the genetic modification difficulty of the filamentous fungi is increased. Therefore, the difficulties of genetic manipulation and high-throughput screening caused by the complex structure of the filamentous fungi are overcome, and the understanding and the industrial application of the filamentous fungi are facilitated. In view of the above, it is important to find a simple method for controlling the mycelial junction of a filamentous fungus for research and application of the filamentous fungus.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide the application of a kinase gene in the regulation of the hyphal morphology of filamentous fungi. The method provided by the invention can regulate and control the hypha structure of the filamentous fungi to be in a simple short rod shape, and provides materials and basis for genetic operation and high-throughput screening of the filamentous fungi.

The invention also aims to provide an Aspergillus niger mutant strain which can improve the capability of secreting total protein and can be used in the field of industrial fermentation.

The purpose of the invention is realized by the following technical scheme:

use of a kinase gene in modulating filamentous fungal hyphal morphology, wherein the kinase gene is a kinase gene in the filamentous fungal MAPK pathway and/or the cAMP-PKA pathway.

The MAPK pathway is at least one of a cell integrity pathway, a high osmotic pressure glycerol kinase pathway, a low pressure/external hormone stimulation kinase pathway and a sporulation kinase pathway; preferably, the MAPK pathway is a cascade kinase pathway in the cellular integrity pathway.

The kinase gene is at least one of genes Bck, mkk2, mpkA, steC and PkaC; preferably, the kinase gene is the gene MpkA.

The FungiDB database sequence accession number of the nucleotide sequence of the gene Bck is An02g06830, the FungiDB database sequence accession number of the nucleotide sequence of the gene Mkk2 is An18g03740, the NCBI database sequence accession number of the nucleotide sequence of the gene MpkA is XM 025594238.1, and the NCBI database sequence accession number of the nucleotide sequence of the gene SteC is XM 025594636.1, the NCBI database sequence accession number of the nucleotide sequence of the gene MpkA is XM 025603413.1.

The amino acid sequence of the protein encoded by the gene Bck has a FungiDB database sequence accession number of An02g06830, the amino acid sequence of the protein encoded by the gene Mkk2 has a FungiDB database sequence accession number of An18g03740, the amino acid sequence of the protein encoded by the gene MpkA has a FungiDB database sequence accession number of An01g09520, the amino acid sequence of the protein encoded by the gene SteC has a FungiDB database sequence accession number of An17g01280, and the amino acid sequence of the protein encoded by the gene PkaC has a FungiDB database sequence accession number of An02g04270.

The filamentous fungi is at least one of aspergillus niger, aspergillus oryzae, aspergillus terreus, aspergillus nidulans and aspergillus fumigatus; preferably, the filamentous fungus is aspergillus niger; more preferably Aspergillus niger CBS 513.88.

After the kinase gene is knocked out or silenced, the hypha structure of the filamentous fungi is in a short rod shape, the branches are few, the polarization growth period is short, no conidium or other phenotypes are produced, and the capability of secreting total protein is enhanced.

The knocking out or silencing is to knock out or edit/mutate/silence the nucleotide sequence of the kinase gene by using technologies such as CRISPR, siRNA, base mutation and the like so as to ensure that the kinase gene is not expressed; preferably, the knockout or silencing is performed using CRISPR technology; more preferably, RNP gene editing system knockout or silencing is used.

The application of the invention specifically comprises the following steps:

(1) Preparing protoplasts of the filamentous fungi;

(2) Knock-out or silencing of a kinase gene;

(3) And screening on a screening plate to obtain the filamentous fungi with changed hypha forms.

The step of knocking out or silencing is to use an RNP gene editing system, and the specific steps are as follows:

(a) Designing sgRNA and repair fragments according to kinase genes needing to be knocked out or silenced;

(b) Assembling sgRNA and Cas9 enzyme, and incubating to obtain an RNP gene editing system;

(c) And adding sgRNA and the repair fragment into the filamentous fungus protoplast, and incubating to knock out or silence the kinase gene.

The sgRNA is obtained by sequentially assembling a promoter, spacer RNA and a sgRNA framework.

The promoter is at least one of a T7 promoter or a U6 promoter; preferably the T7 promoter.

When the gene MpkA needs to be knocked out, the spacer RNA is the forward 12 th to 31 th sequence in the nucleotide sequence.

When the gene SteC is required to be knocked out, the spacer RNA is the forward 28 th to 47 th sequence in the nucleotide sequence.

When the gene PkaC needs to be knocked out, the spacer RNA is the forward 262 th to 281 th sequence in the nucleotide sequence.

The repair segment comprises a screening label and upstream and downstream homology arms, and the length of the upstream and downstream homology arms is 39 bp-1500 bp.

The repair fragment is obtained by sequentially assembling the first 39bp upstream homologous sequence of the spacer RNA locus, the screening label and the second 39bp downstream homologous sequence of the spacer RNA locus.

The screening label is an ANpyrG screening label.

An Aspergillus niger mutant strain is obtained by knocking out the kinase gene of Aspergillus niger, and improves the capability of secreting total protein of the strain.

Compared with the prior art, the invention has the following advantages and effects:

a. the invention utilizes the genes on the MAPK approach to regulate and control the hypha structure of the filamentous fungi, has innovativeness and provides a theoretical basis for the hypha regulation mechanism of the filamentous fungi.

b. By knocking out genes on MAPK pathway, the invention can cause complex hyphae to present short rod shape, less branches, short polarization growth period and no conidium isophenotype. These phenotypes facilitate the genetic manipulation of filamentous fungi and the implementation of high-throughput technologies.

c. The mutant strain obtained by the invention does not produce spores, and the secretion of total protein is increased, so that the mutant strain can be directly used in the field of industrial fermentation.

d. The invention adopts a ribonucleoprotein complex formed by Cas9 and sgRNA, RNP for short, in filamentous fungi for the first time, and the method of combining repair fragments is used for editing genes in the filamentous fungi, thereby having reference significance for efficiently editing the genes of the filamentous fungi.

Drawings

FIG. 1 is a schematic diagram of a method for combining short repair fragments with RNP for gene knock-out in filamentous fungi.

FIG. 2 is a diagram showing the RNP cleavage site, repair fragment homologous recombination.

Fig. 3 is a graph of the results of the identification of sgrnas in example 1 after in vitro cleavage; wherein (A) is a nucleic acid gel diagram after PCR amplification of the repair template; (B) A nucleic acid gel picture after the sgRNA cuts a template in vitro, and (C) a nucleic acid gel picture identified by PCR of a kinase gene knockout strain.

FIG. 4 is a colony morphology chart and a hyphal morphology chart of the wild strain and the gene-knocked-out mutant in example 2; respectively as follows: a colony map (A) of a wild strain WT, a hyphal morphology map (B) of the wild strain WT, a colony map (C) of a mutant in which an MpkA gene on a filamentous fungus MAPK pathway is knocked out, a colony map (D) of a mutant in which an MpkA gene is knocked out, a colony map (E) of a mutant in which a SteC gene on the filamentous fungus MAPK pathway is knocked out, a colony map (F) of a mutant in which a SteC gene is knocked out, a colony map (G) of a mutant in which a PkaC gene on a cAMP-PKA pathway is knocked out, and a colony map (H) of a mutant in which a PkaC gene is knocked out.

FIG. 5 is a graph comparing the colony diameters of the wild strain WT and the kinase gene knock-out strain.

FIG. 6 is a graph showing the total protein secretion of filamentous fungi as well as mutants.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

In the following embodiments, if the specific test conditions are not specified, the test conditions are generally determined according to conventional test conditions or according to the test conditions recommended by the reagent company. The materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

The invention relates to strains, raw materials, reagents and instruments: aspergillus niger (Aspergillus niger CBS 513.88) is disclosed in the document "Dong Hongzhi. Aspergillus niger CRISPR Gene editing technology establishment and the study of the endoplasmic reticulum phospholipid regulatory mechanism [ D ]. Southern China university of technology", as a material deposited in this laboratory; the invention relates to chemical reagents: skim milk powder, snailase, cellulase (Beijing national Changsheng biotechnology company), peptone, yeast powder (OXOID company, UK), polyethylene glycol (PEG 4000), tris-base, sorbitol, anhydrous calcium chloride, ampicillin, lysozyme, uridine, triton X-100 (Sigma company, USA), agarose, restriction enzyme, dream Taq PCR Master Mix (Thermo Fisher company, USA), primeStar HS DNApolymerase, DNA Ligation Kit, DNA marker, fastAP dephosphorylation Kit, RNAi plus, 6 XLoading buffer, RNase free water, RNase inhibitor, SYBR Premix TM (TaKa Ka corporation), gelRed nucleic acid dye (Biotum company, USA), miracloth filter cloth (German corporation), PCR product purification, plasmid extraction Kit (U.S. Yeast extraction Kit), kimber Taq Kit (Kimber fusion Kit), hisefut Kit (Ki fusion Kit), hiilK 9 grade DNA Kit, or more reagent for in vitro analysis, such as the above chemical Cloning Kit, and so on. The invention relates to main equipment which comprises the following parts: nanoDrop1000 Bio-spectrophotometer (Thermo Fisher, USA), autoclave (MLS-3750, SANYO, japan), DNA gel electrophoresis apparatus (Bio-Rad, USA), DNA gel imager (CareStream Health, USA), mold incubator (SHP-450D, shanghai Sensin instruments, inc.), constant temperature air bath shaker (Suzhou Peying instruments, inc.), small bench centrifuge (Eppendorf, germany), clean bench (SW-CJ-1 FD, suzhou purification, inc.), IMS-20 ice maker (Guangzhou Shenhua Biotech, inc.), ultrapure water apparatus (Shanghai Lingde instruments, inc.), electric tissue grinder (Beijing Tiangen science, inc.), high precision balance (Germany Sedoristis, inc.), vortex oscillator (SCIGOX, USA), ultrasonic wave cleaner (Ningbo instruments, NZ.), vacuum pump (DOA-P70-BN, PALL, USA).

Example 1

In order to verify the function of a kinase gene in filamentous fungi, screening and verifying after experimental knockout/silencing of the kinase gene are designed, the kinase gene can be silenced or edited by selecting methods such as siRNA, plasmid editing, error-prone PCR and the like according to actual needs, the CRISPR editing method used below is a technical method commonly used by a person skilled in the art and is a better experimental method selected by the inventor, and the sequence and materials used by the person skilled in the art can be obtained from a public channel as required, but the embodiment of the invention is not limited to the method.

The construction method of the Aspergillus niger RNP gene editing system comprises the following steps:

(1) And (5) obtaining a gene sequence. The gene sequence to be edited is found according to the analysis, and the gene library is NCBI or FungiDB. For example, the sequence of the MpkA gene (ID: an01g 09520), the sequence of the SteC gene (ID: an17g 01280), and the sequence of the PkaC gene (ID: an02g 04270) were found by the FungiDB gene library.

(3) Design of the spacer RNA. Prior to designing the spacer RNA, the gene sequences to be acted upon, for example the specific genes MpkA, steC, pkaC, to which the invention relates, are first organized. The gene action target is designed on the exon, and the length of the gene is less than 1000bp. The selected online design platform is as follows: http:// www.rgenome.net/cas-designer/. And after entering the online platform, selecting the Cas-Designer. The Cas9 species was first selected, typically the first SpCas9 from Streptococcus pyogenes (5-NGG-3-terminus). Species and genomes were selected. For example, the gene to be acted upon is from Aspergillus niger, so the species Aspergillus niger is selected and the trimmed gene sequence, less than 1000bp, is entered in the frame used for this. After the sequence was entered, a 20nt spacer RNA sequence library was generated and all results were downloaded. All results were analyzed by the Python program, scoring standard references (John G Doench et al, radial design of high active sgrNAs for CrIsPr-Cas 9-functionalized gene activation.2014.Nature Biotechnology.), and the high scoring sequence could be used as the pre-spacer, i.e., the spacer RNA sequence. The nucleic acid sequence of the spacer RNA selected in the present invention is shown below.

Wherein the 20nt spacer RNA sequence (GCAGGGTCGCAAGATCTTCA) of the MpkA gene is the 12 th to 31 th sequence in the NCBI database with the sequence ID of XM 025594238.1 in the forward direction, the 20nt spacer RNA sequence (TGGGTTGCAGACACACCCAA) of the SteC gene is the 28 th to 47 th sequence in the NCBI database with the sequence ID of XM 025594636.1 in the forward direction, and the 20nt spacer RNA sequence (GGAGCAGAAAAATCCTCCGA) of the PkaC gene is the 262 th to 281 th sequence in the NCBI database with the sequence ID of XM 025603413.1 in the forward direction.

(4) Analysis of in vitro targeting of the spacer RNA. In order to verify that the designed spacer RNA has targeting property, in vitro excision analysis is firstly carried out. The in vitro cleavage system mainly comprises a Cas9 enzyme, sgRNAs, cleaved DNA templates and a buffer solution. Wherein, the Cas9 enzyme and the buffer solution are purchased from commercial sources, the sgRNA needs to be transcribed by itself, the sgRNA is prepared by adopting T7 transcriptase, and the T7 transcription system is a template of 10 mu L, T enzyme 2 mu L, buffer 10 mu L, H ₂ O8. Mu.L, total volume 30. Mu.L, transcription conditions 37 ℃ for 16h.

Sequences of spacer RNA transcribed by T7 and sgRNA frameworks are shown below, wherein the sgRNA is obtained by sequentially assembling a T7 transcription sequence, the corresponding spacer RNA and the sgRNA frameworks, a sequence with lower case letters is the T7 transcription sequence, a sequence without upper case letters is the 20nt spacer RNA sequence, and a sequence with lower case letters and marked lines is the sequence of the sgRNA frameworks.

MpkA-sgRNA：

taatacgactcactatagggGCAGGGTCGCAAGATCTTCAgttttagagctagaaatagcaagttaaa ataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc；

SteC-sgRNA：

taatacgactcactatagggTGGGTTGCAGACACACCCAAgttttagagctagaaatagcaagttaaa ataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc；

PkaC-sgRNA：

taatacgactcactatagggGGAGCAGAAAAATCCTCCGAgttttagagctagaaatagcaagttaaa ataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc。

The T7 transcription sequence, and the sequence of the sgRNA backbone, can be derived from the references "Yu Leyi et al, A Special genotype of acidic Aspergillus niger SH2 and Its Mechanism of Formation via CRISPR. 2022.Journal of Fungi.") "

The T7-spacer RNA-sgRNA framework sequence is obtained by PCR. The method comprises the steps of firstly synthesizing an sgRNA framework sequence by a biological company, and then designing a primer to amplify the sgRNA framework sequence synthesized by the biological company as a template. The designed forward primer (T7-MpkA spacer RNA-sgRNA backbone-F, T-SteC spacer RNA-sgRNA backbone-F, T-PkaC spacer RNA-sgRNA backbone-F) comprises a T7 transcription sequence, a spacer RNA sequence and a sequence of 22 bases at the head of the sgRNA backbone, and the reverse primer is a sequence of 17 bases at the tail end of the sgRNA backbone (sgRNA backbone-R).

The T7-spacer RNA-sgRNA framework sequence is obtained by PCR reaction, and the PCR reaction system is as follows: primeSTAR Max DNA Polymerase 25. Mu.L, primer F (20. Mu.M) 1. Mu.L, primer R (20. Mu.M) 1. Mu.L, template 1. Mu. L, ddH ₂ O22. Mu.L, total volume 50. Mu.L. The reaction condition is pre-denaturation at 98 ℃ for 10min; 35 cycles of 30s at 98 ℃, 30s at 58 ℃ and 7s at 72 ℃; extension at 72 ℃ for 7min.

The PCR products were analyzed by agarose gel and recovered by PCR reaction product purification kit. The recovered sequences are transcribed by a T7 transcription kit, the transcription method is specifically described previously, and the PCR primer sequences of the sgRNA sequences transcribed by T7 are shown as follows.

T7-MpkA spacer RNA-sgRNA backbone-F:

taatacgactcactatagggGCAGGGTCGCAAGATCTTCAgttttagagctagaaatagcaa；

T7-SteC spacer RNA-sgRNA backbone-F:

taatacgactcactatagggTGGGTTGCAGACACACCCAAgttttagagctagaaatagcaa；

T7-PkaC spacer RNA-sgRNA backbone-F:

taatacgactcactatagggGGAGCAGAAAAATCCTCCGAgttttagagctagaaatagcaa；

sgRNA backbone-R:

GCACCGACTCGGTGCCA。

the sgRNA after T7 transcription is purified and collected by an isopropanol precipitation method, wherein the isopropanol precipitation system is a product of 30 mu L and isopropanol of 300 mu L, H ₂ 120 mu L of O, the total volume is 450 mu L, and the precipitation condition is-20 ℃ and 2h. Then, 13000g was centrifuged at 4 ℃ for 15min. Removing supernatant, washing with 500 μ L of 75% glacial ethanol for 2 times, drying at room temperature for 15-20 min, and finally using 50 μ L of RNase free H ₂ And dissolving O to obtain the sgRNA.

The total length of the gene-cut fragment is 1020bp, the 5 end of the cut fragment is positioned in front of 300bp of a 20nt spacer RNA site, and the 3 end of the cut fragment is positioned behind the 20nt spacer RNA site by 700bp, so that the difference of the sizes of the two fragments cut by the CRISPR-Cas9 is ensured, and the bands can be distinguished through nucleic acid gel electrophoresis.

The in vitro cutting system is a Cas9 enzyme 1 mu L, buffer 2 mu L, DNA template 5 mu L, sgRNA mu L, H ₂ O10. Mu.L, total volume 20. Mu.L, cleavage conditions 37 ℃ for 6h or overnight. The result of sgRNA in vitro cutting is shown in FIG. 3A, and the experimental result proves that the designed spacer RNA can effectively cut the target.

(5) In vitro assembly of RNPs. And (3) carrying out in-vitro assembly on the sgRNA with the cleavage function obtained in the step (4) and the Cas9 enzyme in a buffer solution, and incubating in a PCR instrument. The RNP assembly system is a Cas9 enzyme 6 mu L, buffer 4.4.4 mu L, sgRNA 10 mu L, H ₂ O23.6 mu L and total volume of 44 mu L, and the incubation condition is incubation for 15 min-30 min at 37 ℃ to obtain the RNP gene editing system.

Among them, a system capable of editing the MpkA gene is designated as RNP-MpkA, a system capable of editing the SteC gene is designated as RNP-SteC, and a system capable of editing the PkaC gene is designated as RNP-PkaC. RNP assembly can be directly used for transformation of filamentous fungi, and RNP assembly is performed on the day of transformation.

(6) Amplification of the repair fragment. The screening label (pyrG) and 39bp of the upstream and downstream short repair fragments of the spacer RNA gene site with RNP targeting function are used as homology arms and obtained by PCR amplification, and the amplified fragments are collected by an ethanol precipitation method. The sequence number of the gene of ANpyrG in the NCBI database is BN001301.1, and the sequence thereof is synthesized by bio-companies as a template for PCR amplification of a repair template. The forward primer (MpkA repair fragment-F, steC repair fragment-F, pkaC repair fragment-F) amplified by the repair fragment PCR is the upstream 39bp homologous arm sequence of the RNAP targeting spacer RNA gene site, the reverse primer (MpkA repair fragment-R, steC repair fragment-R, pkaC repair fragment-R) is the downstream 39bp homologous arm sequence of the RNP targeting spacer RNA gene site, and the primer sequences are synthesized by biological companies.

The repair template is obtained by performing PCR reaction with reference to the system in the step (4), the template required for amplification is a vector containing the ANpyrG gene synthesized by a biological company, and the reaction condition is pre-denaturation at 98 ℃ for 10min; 35 cycles of 98 ℃ 30s,58 ℃ 30s,72 ℃ 7 s; extension at 72 ℃ for 7min. PCR products were analyzed by agarose gel and recovered by PCR reaction product purification kit, and the sequences of repair fragment PCR primers are shown below, wherein capital letters are homology arm sequences.

MpkA repair fragment-F:

TGTTTTCTTCTTTGTACGAGTGTTTATCATGGCCGACTTgcaacttcctcgagaacgcgc；

MpkA repair fragment-R:

TGTAGCGCTCATCGACGATAAAGTCCTGGTTGAAGACCTcccttttagtcaataccgttaca；

SteC repair fragment-F:

TATCTCGCAGCCATGCTTGCAAAAGCAACCTACAACCCGgcaacttcctcgagaacgcgc；

SteC repair fragment-R:

TTCTGCGAGGACCCAGTGTAGTAGGAAGTTGTAGGGGTCcccttttagtcaataccgttaca；

PkaC repair fragment-F:

CCTCAAGATTCCGTGCCTCAACAGTCCAATCGGTCTTCGgcaacttcctcgagaacgcgc；

the PkaC repair fragment-R:

GCTTGCGTCACAGCGGATTGCATGGAGGCTACCTGACCGcccttttagtcaataccgttaca。

collecting DNA fragments by ethanol precipitation: mu.L of PCR reaction product is added with 50. Mu.L of sodium acetate solution (3M, pH5.2) and 1.25mL of absolute ethanol, mixed evenly, and kept stand at-20 ℃ for 2-4 h or overnight. Then, the mixture was centrifuged at 12000g at 4 ℃ for 10min, and the supernatant was removed to leave a precipitate. The precipitate was washed 2 times with 1mL of 70% ethanol, each time at 12000g, centrifuged at 4 ℃ for 10min and the supernatant removed. And after washing with ethanol, drying in a 50 ℃ oven. And finally, adding 30-60 mu L of sterile water heavy suspension product, and uniformly mixing to obtain the repair segment for subsequent experiments.

The nucleotide sequence of the repair fragment is shown as follows, the repair fragment is obtained by sequentially assembling the first 39bp upstream homologous sequence of the spacer RNA site, the screening label and the second 39bp downstream homologous sequence of the spacer RNA site, wherein the capital letters and the underlined sequence are the first 39bp upstream homologous sequence of the 20nt spacer RNA site, the lowercase letters are the sequence of the ANpyrG screening label, and the capital letters and the unpainted sequence are the second 39bp downstream homologous sequence of the 20nt spacer RNA site.

The repair sequence for knocking out the MpkA gene is shown as SEQ ID NO.14, the repair sequence for knocking out the SteC gene is shown as SEQ ID NO.15, and the repair sequence for knocking out the PkaC gene is shown as SEQ ID NO. 16.

The schematic diagram of the working principle of the RNP gene editing system constructed in the embodiment is shown in FIG. 1, the in vitro cutting effect of the obtained RNP gene editing system is shown in FIG. 3B, and the experimental result proves that the RNP gene editing system can effectively cut the target fragment. Therefore, the RNP of the embodiment can act in Aspergillus niger, can well edit the genes of Aspergillus niger, avoids the complicated procedure of constructing a recombinant vector, is simple to operate, and can be efficiently used for the gene editing of Aspergillus niger.

Example 2

The related culture medium and solution formula are as follows:

PDA culture medium: 300g/L of potato extract powder, 20g/L of glucose, 0.1g/L of chloramphenicol and 2g/L of agar; CD medium: 20g/L of anhydrous glucose, 2g/L of potassium chloride, 1g/L of monopotassium phosphate, 3g/L of sodium nitrate, 0.5g/L of sulfuric acid heptahydrate and 0.01g/L of ferrous sulfate heptahydrate.

Hypertonic CD medium: 342.3g/L of sucrose, 2g/L of potassium chloride, 1g/L of monopotassium phosphate, 3g/L of sodium nitrate, 0.5g/L of heptahydrate sulfuric acid and 0.01g/L of heptahydrate ferrous sulfate.

General CD medium: 20g/L of anhydrous glucose, 2g/L of potassium chloride, 1g/L of monopotassium phosphate, 3g/L of sodium nitrate, 0.5g/L of sulfuric acid heptahydrate and 0.01g/L of ferrous sulfate heptahydrate.

DPY medium: 20g/L of anhydrous glucose, 5g/L of yeast powder, 10g/L of peptone and 10g/L of sodium chloride.

Starch fermentation medium: 50g/L of corn starch, 30g/L of corn steep liquor and 20g/L of soybean meal. Sterilizing at 115 deg.C for 20min.

STC solution: 10mM Tris-HCl,1.2M sorbitol, 50mM calcium chloride, pH7.5, volume fixing, pH adjusting, and membrane filtration sterilization of 0.22. Mu.L.

PEG solution: 60% (w: v) PEG4000, 50mM calcium chloride, 10mM Tris-HCl, pH7.5, adjusting pH after capacity setting, and sterilizing at high temperature and high pressure.

The method for regulating and controlling the aspergillus niger hypha morphological structure comprises the following steps:

(1) And (4) collecting aspergillus niger spores. The Aspergillus niger CBS513.88 with the pyrG screening label knocked out is transferred to a PDA (potato dextrose medium) solid culture medium and placed in an incubator at 30 ℃ for static culture for 7d. A strain of Aspergillus niger CBS513.88 with a pyrG screening tag knocked out is disclosed in the document Dong Hongzhi, the research on establishment of Aspergillus niger CRISPR gene editing technology and endoplasmic reticulum phospholipid regulation mechanism [ D ]. Southern China university of technology ], and is a material deposited in the laboratory. After the culture is finished, 10mL of sterile water is added to the solid culture medium, and the added sterile water is repeatedly smeared in a coating mode by using a sterile coating rod, so that spores growing on the solid culture medium are dissolved in the sterile water, and the spore liquid can be obtained.

(2) And (4) enrichment culture of aspergillus niger hyphae. The collected spores were inoculated into DPY (Yeast powder peptone glucose medium) and cultured in a shaker at 30 ℃ and 220rpm for 2 days. The mycelium was obtained by suction filtration using a buchner funnel, washed 2 times with sterile water, then 2 times with 0.8M sodium chloride, and weighed.

(3) And (4) transformation of Aspergillus niger. Black koji by PEG-mediated protoplast methodAnd (4) transforming the mildew. Transferring the filtered mycelium into the protoplast enzymolysis solution, wherein the enzymolysis solution system comprises 1% (w: v) cellulase, 1% (w: v) helicase, 0.5% (w: v) lywallzyme, 1 Xsodium phosphate buffer solution and 0.8M sodium chloride. The enzyme solution was digested at 30 ℃ at 120rpm, calculated by adding 1.5g of mycelia to 20mL of the enzyme solution. The concentration of protoplasts was measured by a hemocytometer for 1.5 h. Performing microscopic examination every 30min until the concentration of protoplast reaches 10 ⁶ And stopping enzymolysis at CFU/mL. This process takes roughly 3 hours or so. After completion of the enzymatic hydrolysis, the protoplasts were collected by filtration through 4 layers of Milipore, and then the bottle of the enzymatic hydrolysate and the Milipore were washed with 20mL of 0.8M sodium chloride. Protoplasts were centrifuged at 900g for 10min at 4 ℃ and the supernatant was discarded. Adding 5mL of STC buffer solution to resuspend the protoplast, adding 25mL of STC buffer solution to resuspend after uniform dispersion, and then centrifugally collecting the protoplast for 10min at 900g under the condition of 4 ℃. The protoplasts were resuspended in 800. Mu.L of STC buffer to obtain a protoplast suspension for subsequent transformation. According to different knockout genes, 44 mu L of the RNP gene editing system assembled in the step (5) in the example 1 and 100 mu L of the repair fragment obtained in the step (6) in the example 1 are added into 160 mu L of protoplast, PEG solution is added, the mixture is evenly blown and beaten by a tip-removing gun head and is placed on ice for 30min. After adding 1.5mL of PEG solution, the centrifuge tube cap was closed and turned upside down to mix well, and the mixture was left at room temperature for 25min. During this period, the lower plate, i.e., the hypertonic CD medium (containing 2% agar), was poured. Finally, the transformation mixture is poured into a 15mL sterile centrifuge tube containing 6mL soft agar hypertonic CD culture medium (containing 0.5% agar) at the temperature of 30-45 ℃ and 3mL STC buffer solution, and the mixture is evenly mixed by turning upside down. Finally, the mixture (upper plate, containing 0.5% hypertonic CD medium) was poured evenly onto sucrose CD hypertonic solid medium (lower plate, containing 2% hypertonic CD medium) and cultured at 30 ℃.

(4) And (4) selecting and verifying transformants. After 6 days of culture, the upper medium (containing 0.5% of hypertonic CD medium) is solidified, the transformants emerging from the transformation plate are selected to be a new common CD medium (containing 2% of agar), and the culture is kept still for 4 days in an incubator at 30 ℃, because the pyrG gene is knocked out by the host, the thalli grow only after the strain is supplemented with the pyrG gene or other nutrient substances, and positive transformants can be obtained by using pyrG as a screening label. And (4) selecting hyphae to extract DNA, and carrying out PCR verification and sequencing analysis to obtain a positive transformant. The principle of PCR validation design is shown in FIG. 2. The genes on the genome are cut by RNP, and then repair fragments (39 bp upstream homology arms, 1398bp pyrG screening labels and 39bp downstream homology arms) are recombined to cut sites through the upstream/downstream 39bp homology arms and the 1398bp pyrG screening labels, so that the genes are damaged, and the purpose of knocking out the genes is achieved. When the gene is knocked out successfully, 1398bp of fragment can be amplified more by PCR amplification through the designed primer, thereby achieving the aim of identification. The primer sequences identified by PCR were synthesized by Biotech, inc., as shown below.

Identification of the MpkA knockout-F: ATAACTTCCCCTTTACCTCCCC;

identification of the MpkA knockout-R: GTCAAACCTACCAGACAATGCC;

SteC knockout identification-F: AGTGGCGATAGCCCAGCCTTTA;

SteC knockout identification-R: CGAGGACCCAGTGTAGTAGGAA;

the PkaC knockout identified-F: AGCAAACACCCCCTCTCAGC;

the PkaC knockout identified-R: AGGTATGATGGGCAGACGGC.

(5) Colony morphology analysis and hyphal morphology analysis were performed on positive transformants.

(6) The transformant was transferred to a starch fermentation medium and placed in a shaker at 30 ℃ and 250rpm for fermentation culture. After 5 days of fermentation culture, taking a fermentation supernatant every day, measuring the content of total protein by using a BCA kit, and continuously culturing for 14 days.

The MpkA gene, steC gene and PkaC gene in this example were all knocked out as shown in FIG. 3C, and they were all knocked out efficiently.

The colony morphology map, the hyphal morphology map, the colony morphology map of the aspergillus niger wild strain and the hyphal morphology map of the aspergillus niger wild strain successfully knocked out related to the aspergillus niger hyphal morphology control in the embodiment are shown in fig. 4, wherein a is the colony map of the wild strain WT, B is the hyphal morphology map of the wild strain WT, C is the colony map of the mutant with the MpkA gene knocked out in the MAPK pathway of the filamentous fungus, D is the mutant hyphal morphology map with the MpkA gene knocked out in the MAPK pathway of the filamentous fungus, E is the mutant colony map with the stepc gene knocked out in the MAPK pathway of the filamentous fungus, G is the mutant colony map with the PkaC gene knocked out in the cAMP-PKA pathway, and H is the mutant hyphal morphology map with the PkaC gene knocked out. As can be seen, compared with the other three groups, the Aspergillus niger colonies with the MpkA gene knocked out are smaller, grow slowly, and have short rod-shaped hyphae and basically no branches.

The colony diameters of the mutants in which the genes involved in the regulation of the hyphal morphology of Aspergillus niger were successfully knocked out and the colony diameters of the wild strains are shown in FIG. 5. The colony diameter of the kinase knocked-out strain is significantly smaller than that of the wild control strain, and particularly, the colony diameter of the MpkA gene knocked-out strain is smaller.

In addition, the secretion of total protein by the A.niger mutant, host, and wild strain of this example is shown in FIG. 6. The secretion amount of the total protein of the Aspergillus niger with the MpkA gene knocked out is obviously higher than that of a host and a wild strain.

The above experimental results were combined to draw the following conclusions:

(1) The RNP gene editing system can act in the Aspergillus niger and can well edit the gene of the Aspergillus niger, the method omits the complicated procedure of constructing a recombinant vector, the operation is simple, and the method can be used for the gene editing of the Aspergillus niger.

(2) Compared with an Aspergillus niger wild strain, a SteC gene on an Aspergillus niger MAPK pathway and a PkaC gene on a Camp-PKA pathway, the MpkA gene on the Aspergillus niger MAPK pathway can regulate and control the hypha form, and when the MpkA gene is knocked out, an Aspergillus niger colony is small and grows slowly, and the hypha is in a short rod shape and basically has no branch. The MpkA gene of Aspergillus niger is shown to be specific for the regulation of hyphal morphology. Because the strains with the removed MpkA grow slowly and are not branched, high-throughput technologies such as micro-fluidic technology can be considered, and thus the Aspergillus niger can be ensured to avoid oil drop rupture caused by overlarge hyphae in a micro-fluidic oil drop system, and the Aspergillus niger cannot use the micro-fluidic technology. Meanwhile, the hypha is simple in shape, and the application of aspergillus niger in a flow cytometry system can be promoted. Therefore, this morphology can facilitate the development of high throughput technology for aspergillus niger, complementing the short panel that aspergillus niger cannot use high throughput technology.

(3) When the Aspergillus niger MpkA gene is knocked out, the secretion amount of the protein is obviously higher than that of Aspergillus niger wild strains, steC gene knockout strains on the Aspergillus niger MAPK pathway and PkaC gene knockout strains on the cAMP-PKA pathway. The fact that the deletion of the MpkA gene of the Aspergillus niger can promote the secretion of mycoprotein is demonstrated. Probably because the hypha structure is simplified, the growth pressure of the strain and the output of the strain in energy are reduced, and the thallus is improved in protein secretion.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Claims (10)

1. The application of the kinase gene in the regulation of the hyphal morphology of the filamentous fungi is characterized in that:

the kinase gene is a kinase gene on a filamentous fungus MAPK pathway and/or cAMP-PKA pathway.

2. Use according to claim 1, characterized in that:

the kinase gene is at least one of genes Bck, mkk2, mpkA, steC and PkaC.

3. Use according to claim 1, characterized in that:

the nucleotide sequence of the gene Bck has a FungiDB database sequence accession number of An02g06830, the nucleotide sequence of the gene Mkk2 has a FungiDB database sequence accession number of An18g03740, the nucleotide sequence of the gene MpkA has An NCBI database sequence accession number of XM 025594238.1, and the nucleotide sequence of the gene SteC has An NCBI database sequence accession number of XM 025594636.1, and the nucleotide sequence of the gene MpkA has An NCBI database sequence accession number of XM 025603413.1.

4. Use according to claim 1, characterized in that:

the amino acid sequence of the protein encoded by Bck is at the accession number An02g06830, the amino acid sequence of the protein encoded by Mkk2 is at the accession number An18g03740, the amino acid sequence of the protein encoded by MpkA is at the accession number An01g09520, the amino acid sequence of the protein encoded by SteC is at the accession number An17g01280, and the amino acid sequence of the protein encoded by PkaC is at the accession number An02g04270.

5. Use according to claim 1, characterized in that:

the filamentous fungi is at least one of Aspergillus niger, aspergillus oryzae, aspergillus terreus, aspergillus nidulans and Aspergillus fumigatus.

6. Use according to claim 1, characterized in that:

after the kinase gene is knocked out or silenced, the hyphal structure of the filamentous fungi is in a short rod shape, the branches are few, the polarization growth cycle is short, no conidium or other phenotypes appear, and the capability of secreting total protein becomes strong;

the knocking-out or silencing is that the nucleotide sequence of the kinase gene is knocked-out or edited/mutated/silenced by using technologies such as CRISPR, siRNA, base mutation and the like, so that the kinase gene is not expressed.

7. The use according to any one of claims 1 to 6, characterized in that it comprises in particular the following steps:

(1) Preparing protoplasts of the filamentous fungi;

(2) Knock-out or silencing of a kinase gene;

(3) Screening on a screening plate to obtain the filamentous fungi with changed hypha forms.

8. The use according to claim 7, wherein said knockout or silencing is performed using the RNP gene editing system by the steps of:

(a) Designing sgRNA and repair fragments according to kinase genes needing to be knocked out or silenced;

(b) Assembling sgRNA and Cas9 enzyme, and incubating to obtain an RNP gene editing system;

(c) Adding sgRNA and repair fragments into filamentous fungus protoplasts, and incubating to knock out or silence kinase genes.

9. Use according to claim 8, characterized in that:

the sgRNA is obtained by assembling a promoter, spacer RNA and a sgRNA framework in sequence;

the promoter is at least one of a T7 promoter or a U6 promoter;

when the gene MpkA needs to be knocked out, the spacer RNA is a forward 12 th to 31 th sequence in the nucleotide sequence;

when the gene SteC is required to be knocked out, the spacer RNA is a forward 28 th to 47 th sequence in the nucleotide sequence of the spacer RNA;

when the gene PkaC needs to be knocked out, the spacer RNA is a forward 262 th to 281 th sequence in the nucleotide sequence;

the repair fragment is obtained by sequentially assembling the first 39bp upstream homologous sequence of the spacer RNA site, the screening label and the second 39bp downstream homologous sequence of the spacer RNA site;

the screening label is an ANpyrG screening label.

10. An Aspergillus niger mutant strain obtained by knocking out the kinase gene according to claim 1.

Images