CN115820739A - Construction method and application of single-copy VGF gene oncolytic vaccinia virus vector - Google Patents

Abstract

The invention relates to a construction method and application of a tumor targeting vaccinia virus vector WRDD-VGF, wherein the virus vector is a vaccinia virus WR strain, two original VGF genes and a J2R (TK) gene are deleted, a single-copy VGF gene sequence is inserted into a TK region, and the obtained oncolytic vaccinia virus vector of the single-copy VGF gene with TK gene deletion is obtained. The WRDD-VGF disclosed by the invention has the characteristics of targeting property, safety and effectiveness, has tumor targeting property and an anti-tumor effect, can be used for treating various tumors, and provides a novel tumor-targeted virus skeleton vector for research of oncolytic virus medicaments.

Description

Construction method and application of single-copy VGF gene oncolytic vaccinia virus vector

Technical Field

The invention relates to a construction method and application of a single-copy VGF gene oncolytic vaccinia virus vector, belonging to the fields of biotechnology and gene therapy.

Background

In recent years, vaccinia virus has been widely used as a tumor-targeting gene vector, and serious adverse reactions rarely occur because vaccinia virus has a strong and efficient replication transduction ability, a great ability to accommodate foreign genes, a broad spectrum of tumor cell infectivity, its genomic DNA does not integrate with host DNA, and it has an excellent safety record in smallpox eradication programs. Compared with other viruses, the vaccinia virus can be injected intravenously in the process of being used as an oncolytic agent for tumor, and can be remotely administered to solve the problem of difficult clinical administration.

The Vaccinia Virus (VV) WR strain shows strong toxicity in animal models and has inherent tumor selectivity. The WR strain contains two VGF gene (vaccinia virus growth factor) sequences, a TK (and a reporter gene is inserted to enhance green fluorescent protein EGFP) and a vv-DD vector (Cancer Research,2001,61,8751-7, named as WRDD) obtained by two copies of the VGF genes are deleted through a gene technology, the WR strain has a tumor killing effect similar to that of a wild strain, and shows a more remarkable tumor specific replication effect. vv-DD has already entered clinical trials, and the results show that the safety is very good and the anti-tumor capability needs to be improved. VGF is the product encoded by the C11R gene of vaccinia virus. The C11R gene is an early gene present in WR strains and other orthopoxviruses, and encodes a soluble secreted vaccinia virus growth factor, a protein that binds to and stimulates EGFR. Deletion of the C11R gene reduces vaccinia virus-induced activation of ERK2 and NF-. Kappa.B. Sequence analysis indicated that VGF is a processed form of the polypeptide encoded in the vaccinia virus genome, and is associated with Epidermal Growth Factor (EGF) and alpha transforming growth factor (alpha TGF). Unlike EGF or α TGF, VGF is glycosylated, which binds to the EGF receptor and stimulates its autophosphorylation. VGF plays an important role in stimulating the growth of uninfected cells to promote viral infection. Early techniques only deleted two copies of the VGF sequence of WR strain at the same time, and the deletion of the VGF gene reduced the ability of vaccinia virus to spread and cytopathize between cells. Therefore, there is a need to develop an oncolytic vaccinia virus vector that targets more efficiently.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a construction method and application of a single-copy VGF gene oncolytic vaccinia virus vector. The virus vector can enhance the anti-tumor capability in vivo and in vitro, and has the characteristics of targeting property, safety and effectiveness.

In order to achieve the purpose, the invention adopts the technical scheme that:

a construction method of a single-copy VGF gene oncolytic vaccinia virus vector is characterized in that the oncolytic vaccinia virus vector is a vaccinia virus WR strain, a TK gene is deleted on the basis of deletion of two original copies of VGF genes, and a single-copy VGF gene sequence is inserted into a TK region to obtain the TK gene deleted single-copy VGF gene oncolytic vaccinia virus vector.

The construction method of the oncolytic vaccinia virus vector, wherein the VGF gene is a natural VGF gene or a VGF gene variant.

The VGF gene variant is a variant obtained by genetic engineering or protein engineering and retains the activity of a native VGF gene.

The construction method of the oncolytic vaccinia virus vector comprises the following steps:

(1) Reference sequence: NCBI Reference Sequence NC-006998.1, designing shuttle vector which targets TK region and contains VGF Sequence; sequentially connecting an upstream sequence SEQ1 of a TK gene, a fluorescent protein RFP sequence SEQ3, an H5 promoter SEQ4, a VGF sequence SEQ5 and a downstream sequence SEQ2 of the TK gene to a plasmid vector through gene synthesis to construct a VGF shuttle vector pTK-VGF;

(2) Designing a gRNA sequence SEQ6 according to a TK gene sequence, and inserting the gRNA sequence into a PB-gRNA vector to construct a PB-gRNA-TK;

(3) Inoculating CV1 cells to a six-hole plate, transfecting Cas9 and PB-gRNA-TK mixed plasmids simultaneously when the cells reach the fusion degree of more than 90%, infecting WR delta VGF after 24 hours, and transfecting pTK-VGF after 2 hours; collecting the mixed solution of the supernatant and the cells after 48 hours, freeze thawing for 3 times, and adding the mixed solution into a six-hole plate which is fully paved with CV1 cells according to 5 microliters per hole; after 48 hours, red fluorescent monoclonal cells were picked under a fluorescence microscope; and (3) freezing and thawing the monoclonal solution, adding the frozen monoclonal solution into a six-hole plate which is fully paved with CV1 cells according to 5 microliters/hole, picking the monoclonal cells again after 48 hours until all red fluorescence is obtained under a fluorescence microscope, and thus obtaining the vaccinia virus vector WRDD-VGF.

The oncolytic vaccinia virus vector obtained by the construction method is applied to preparing a medicine for treating tumors.

The tumor is a solid tumor.

The solid tumor includes pancreatic cancer, colon cancer, liver cancer or gastric cancer.

The invention has the beneficial effects that:

the tumor targeting vaccinia virus vector WRDD-VGF provided by the invention deletes the TK gene on the basis of deleting the original two copies of VGF genes of WR strain vaccinia virus, and inserts a single copy of VGF gene sequence in the TK region through homologous recombination to obtain the TK gene-deleted single copy of VGF gene oncolytic vaccinia virus vector WRDD-VGF.

The method provided by the invention has the advantages that the TK gene is deleted, the copy VGF gene of the WR strain is kept, the high specificity of the vaccinia virus on tumor cells is kept, the infection replication capacity of the virus in the tumor cells and the propagation replication capacity of the virus among the tumor cells are enhanced, the killing effect on the tumor cells is improved, the influence on normal cells is reduced, and the virus vector with stronger anti-tumor capacity is obtained.

The oncolytic vaccinia virus vector WRDD-VGF has the characteristics of targeting, safety and effectiveness, has tumor targeting and anti-tumor effects, can carry various tumor treatment genes, is used for treating various solid tumors such as pancreatic cancer, liver cancer and colon cancer, and provides a novel tumor-targeted virus skeleton vector for research of oncolytic virus medicaments. Therefore, WRDD-VGF can be used as a gene therapy vector with effectiveness and safety for treating tumors.

Drawings

FIG. 1: structural schematic diagrams of tumor targeting vaccinia virus vectors WRDD-VGF, WRDD and WR-delta TK.

FIG. 2: schematic diagram of killing ability of tumor targeting vaccinia virus vectors WRDD-VGF, WRDD and WR-delta TK to different tumor cells.

FIG. 3: schematic representation of the effect of tumor-targeting vaccinia virus vectors WRDD-VGF, WRDD, and WR- Δ TK on vaccinia virus plaque formation.

FIG. 4: the tumor targeting vaccinia virus vectors WRDD-VGF, WRDD and WR-delta TK are used for treating the tumor-bearing C57BL/6 mice, and the curve of the tumor growth is shown.

FIG. 5 is a schematic view of: the tumor clearance of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-delta TK after treatment of tumor-bearing C57BL/6 mice is shown in a comparison graph.

FIG. 6: schematic representation of body weight changes following tumor-bearing C57BL/6 mice treated with tumor-targeting vaccinia virus vectors WRDD-VGF, WRDD, and WR- Δ TK and control group (PBS).

Detailed Description

The following examples further illustrate the embodiments of the present invention in detail.

The viral vector of the present embodiment is vaccinia virus WR (Western Reserve) strain.

Example 1 construction of tumor Targeted vaccinia Virus vector WRDD-VGF

(1) Reference sequence: NCBI Reference Sequence NC-006998.1, a shuttle vector targeting the TK region and containing a VGF Sequence is designed, wherein the upstream Sequence of the TK gene is called the left arm (SEQ 1), the downstream Sequence is called the right arm (SEQ 2), and the middle is, in Sequence, a red fluorescent protein RFP (SEQ 3), an H5 promoter (SEQ 4) and a VGF Sequence (SEQ 5). The VGF shuttle vector pTK-VGF was constructed by gene synthesis of the sequence and ligation of the sequence to a plasmid vector.

(2) A gRNA sequence (SEQ 6: AACGATAATAGATACGGAA) was designed from the TK gene sequence and inserted into a PB-gRNA vector (Nucleic Acids Res 2014,42, e155) to construct PB-gRNA-TK.

(3) CV1 cells are inoculated to a six-well plate, when the cells reach over 90 percent of fusion degree, cas9 and PB-gRNA-TK are transfected at the same time, WR delta VGF is infected after 24 hours (two original VGF genes are deleted on the basis of WR wild type), and pTK-VGF is transfected after 2 hours. After 48 hours, the mixture of the supernatant and the cells was collected, frozen and thawed 3 times, and added to a six-well plate filled with CV1 cells at 5. Mu.l/well. After 48 hours, red fluorescent monoclonals were picked under a fluorescence microscope. Freezing and thawing the monoclonal solution, adding into a six-well plate filled with CV1 cells at a volume of 5 microliters/well, picking out the monoclonal again after 48 hours until all red fluorescence is obtained under a fluorescence microscope, namely the vaccinia virus vector WRDD-VGF (the structure is shown in figure 1).

As can be seen from FIG. 1, WRDD has two VGF genes and J2R (TK) genes deleted, WR-. DELTA.TK has a J2R (TK) gene deleted, WRDD-VGF has two VGF genes and a J2R (TK) gene deleted and a VGF gene inserted into the TK region.

SEQ1

TTGTGCAAAGCTTTTGCGATCAATAAATGGATCACAACCAGTATCTCTTAAC

GATGTTCTTCGCAGATGATGATTCATTTTTTAAGTATTTGGCTAGTCAAGATG

ATGAATCTTCATTATCTGATATATTGCAAATCACTCAATATCTAGACTTTCTGT

TATTATTATTGATCCAATCAAAAAATAAATTAGAAGCCGTGGGTCATTGTTAT

GAATCTCTTTCAGAGGAATACAGACAATTGACAAAATTCACAGACTTTCAA

GATTTTAAAAAACTGTTTAACAAGGTCCCTATTGTTACAGATGGAAGGGTC

AAACTTAATAAAGGATATTTGTTCGACTTTGTGATTAGTTTGATGCGATTCA

AAAAAGAATCCTCTCTAGCTACCACCGCAATAGATCCTGTTAGATACATAGA

TCCTCGTCGCAATATCGCATTTTCTAACGTGATGGATATATTAAAGTCGAATA

AAGTGAACAATAATTAATTCTTTATTGTCATC

SEQ2

TATTATATTTTTTATCTAAAAAACTAAAAATAAACATTGATTAAATTTTAATAT

AATACTTAAAAATGGATGTTGTGTCGTTAGATAAACCGTTTATGTATTTTGAG

GAAATTGATAATGAGTTAGATTACGAACCAGAAAGTGCAAATGAGGTCGCA

AAAAAACTGCCGTATCAAGGACAGTTAAAACTATTACTAGGAGAATTATTTT

TTCTTAGTAAGTTACAGCGACACGGTATATTAGATGGTGCCACCGTAGTGTA

TATAGGATCTGCTCCCGGTACACATATACGTTATTTGAGAGATCATTTCTATA

ATTTAGGAGTGATCATCAAATGGATGCTAATTGACGGCCGCCATCATGATCC

TATTTTAAATGGATTGCGTGATGTGACTCTAGTGACTCGGTTCGTTGATGAG

GAATATCTACGATCCATCAAAAAACAACTGCATCCTTCTAAGATTATTTTAAT

TTCTGATGTGAGATCCAAACGAGGAGGAAATGAACCTAGTACGGCGGATTTSEQ3

ATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGC

ATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCG

AGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAA

GGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTA

CGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGA

AGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAG

GACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTTCAGGACGGCTC

CTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCC

CGTAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTGT

ACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTG

AAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAA

GAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACAT

CACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCCG

AGGGCCGCCACCACCTGTTCCTGTAG

SEQ4

AAAAATTGAAAATAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAG

CGAGAAATAATCATAAATA

SEQ5

ATGTCGATGAAATATCTGATGTTGTTGTTCGCTGCTATGATAATCAGATCATT

CGCCGATAGTGGTAACGCTATCGAAACGACATCGCCAGAAATTACAAACGC

TACAACAGATATTCCAGCTATCAGATTATGCGGTCCAGAGGGAGATGGATAT

TGTTTACACGGTGACTGTATCCACGCTAGAGATATTGACGGTATGTATTGTA

GATGCTCTCATGGTTATACAGGCATTAGATGTCAGCATGTAGTATTAGTAGAC

TATCAACGTTCAGAAAACCCAAACACTACAACGTCATATATCCCATCTCCCG

GTATTATGCTTGTATTAGTAGGCATTATTATTATTACGTGTTGTCTATTATCTGT

TTATAGGTTCACTCGACGAACTAAACTACCTATACAAGATATGGTTGTGCCA

TAA

SEQ6：AACGATAATAGATACGGAA

Example 2 detection of killing ability of tumor targeting vaccinia virus vectors WRDD-VGF, WRDD and WR- Δ TK to different tumor cells

Collecting Panc-1 (human pancreatic cancer), DT6606 (murine pancreatic cancer), MC38 (murine colon cancer), and Hepa1-6 (murine liver cancer) cells in logarithmic growth phase, counting, and inoculating 3000 cells/well in 96-well plate; SW620 (human colon cancer) cells are counted, inoculated into a 96-well plate according to 5000 cells/well, and after 10-12 hours, the cells adhere to the wall, WRDD-VGF, WRDD and WR-delta TK (WR strain with J2R (TK) gene deleted) virus liquid is subjected to gradient dilution, wherein the highest concentration is 1000 pfu/cell, the dilution is sequentially carried out by 10 times, and the 11 th column is a blank control group.

The amount of virus was measured on the sixth day using the CCK-8 (Cell Counting Kit-8) Kit and converted to EC50 (i.e., the lower the EC50, the stronger the killing ability of each virus, the amount of virus required to kill 50% of tumor cells). As shown in FIG. 2, it can be seen from FIG. 2 that WRDD-VGF has stronger killing ability to tumor cells compared with WRDD and WRDD- Δ TK.

Example 3 Effect of tumor-targeting vaccinia Virus vectors WRDD-VGF, WRDD, and WR- Δ TK on vaccinia Virus plaque formation

Inoculating CV1 cells into a six-well plate, diluting WRDD-VGF, WRDD and WRDELTA TK virus liquid to 1000pfu/mL by using a serum-free culture medium when the cells reach a fusion degree of more than 90% on the next day, adding 1mL into the six-well plate respectively, infecting for 2 hours after marking is done, slightly shaking for 1 minute every half hour during the infection, then uniformly mixing sterilized 3% carboxymethyl cellulose and the serum-free culture medium in the same proportion, slowly adding into the six-well plate, culturing for 48 hours, removing supernatant, washing twice by using PBS, adding 200ul of crystal violet staining solution for staining for 10 minutes, washing twice by using PBS, and taking pictures and recording under a white background.

As can be seen from FIG. 3, the plaque diameter was significantly larger in the WRDD-VGF, WR- Δ TK group than in the WRDD group, indicating that VGF affects spread infection of virus between tumor cells, which is required for vaccinia virus plaque formation.

Example 4 therapeutic Effect of tumor-targeting vaccinia Virus vectors WRDD-VGF, WRDD and WR- Δ TK on tumor-bearing C57BL/6 mice

Inoculating 6-7 week old male C57BL/6 mice with pancreatic cancer cell line DT6606 (mouse pancreatic cancer cell line) subcutaneously on right back side at 2 × 10 ⁶ One cell/one cell is inoculated to the subcutaneous part of the right back of the mouse, and the tumor reaches 80-100 mm after 5-7 days ³ At the same time, the treatment groups were divided into groups (4 groups of 7 patients each) of 2X 10 ⁸ pfu/WRDD-VGF, WRDD and WR-delta TK were treated, the blank control was Phosphate Buffered Saline (PBS), three times on days 1, 3 and 5, and the change of tumor volume and the change of mouse body weight were recorded twice per week, and the experimental results are shown in FIG. 4, FIG. 5 and FIG. 6.

As shown in FIG. 4, the changes of the tumor volumes, WRDD-VGF, WRDD- Δ TK, compared with blank control (PBS), showed that the tumors had a slow growth, WRDD-VGF, WRDD- Δ TK, compared with WRDD, WRDD- Δ TK, the tumors hardly increased within 33 days after treatment, and WRDD, WRDD- Δ TK increased slowly; WRDD-delta TK slowly increases after 33 days, while WRDD and WRDD-delta TK increase rapidly, which indicates that WRDD-VGF has the best treatment effect.

As shown in FIG. 5, the tumor-elimination rates of WRDD-VGF were found to be more inhibitory to tumor growth than WRDD and WRDD- Δ TK, the WRDD-VGF vaccinia virus vector eliminated tumors in 42.9% (3/7) of C57BL/6 mice, and the tumor-elimination rates of WRDD- Δ TK and WRDD in C57BL/6 mice were 28.6% (2/7) and 14.2% (1/7), respectively.

From FIG. 6, it can be seen that the body weight of mice changed, and the body weights of tumor-bearing mice of PBS of the tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR- Δ TK treatment group and the control group increased slowly during the treatment period, and did not fluctuate greatly, which indicates that WRDD-VGF, WR- Δ TK and WRDD have small influence on the body weight of mice.

Claims (7)

1. The construction method of the single-copy VGF gene oncolytic vaccinia virus vector is characterized in that the oncolytic vaccinia virus vector is a vaccinia virus WR strain, a TK gene is deleted on the basis of deleting two original copies of VGF genes, a single-copy VGF gene sequence is inserted into a TK region, and the oncolytic vaccinia virus vector of the single-copy VGF gene with the TK gene deleted is obtained.

2. The method of claim 1, wherein the VGF gene is a native VGF gene or a VGF gene variant.

3. The method of claim 2, wherein the VGF gene variant is a variant obtained by genetic engineering or protein engineering and retains the activity of a native VGF gene.

4. The method of constructing an oncolytic vaccinia virus vector according to any of claims 1-3, comprising the steps of:

(1) Reference sequence: NCBIReferenceSequence, NC-006998.1, a shuttle vector which is targeted to a TK region and contains a VGF sequence is designed; sequentially connecting an upstream sequence SEQ1 of a TK gene, a fluorescent protein RFP sequence SEQ3, an H5 promoter SEQ4, a VGF sequence SEQ5 and a downstream sequence SEQ2 of the TK gene to a plasmid vector through gene synthesis to construct a VGF shuttle vector pTK-VGF;

(2) Designing a gRNA sequence SEQ6 according to a TK gene sequence, and inserting the gRNA sequence into a PB-gRNA vector to construct a PB-gRNA-TK;

(3) Inoculating CV1 cells to a six-hole plate, transfecting Cas9 and PB-gRNA-TK mixed plasmids simultaneously when the cells reach the fusion degree of more than 90%, infecting WR delta VGF after 24 hours, and transfecting pTK-VGF after 2 hours; collecting mixed solution of the supernatant and the cells after 48 hours, freezing and thawing for 3 times, and adding the mixed solution into a six-hole plate which is fully paved with CV1 cells according to 5 microliter/hole; after 48 hours, red fluorescent monoclonal cells were picked under a fluorescence microscope; and (3) freezing and thawing the monoclonal solution, adding the frozen monoclonal solution into a six-hole plate which is fully paved with CV1 cells according to 5 microliters/hole, picking the monoclonal cells again after 48 hours until all red fluorescence is obtained under a fluorescence microscope, and thus obtaining the vaccinia virus vector WRDD-VGF.

5. Use of an oncolytic vaccinia virus vector constructed according to the method of claim 4 in the manufacture of a medicament for the treatment of a tumor.

6. The use of claim 5, wherein the tumor is a solid tumor.

7. The use of claim 6, wherein the solid tumor comprises pancreatic cancer, colon cancer, liver cancer or gastric cancer.

Images