CN115820738A - Adenovirus recombinant rabies vaccine and preparation method and application thereof - Google Patents
Adenovirus recombinant rabies vaccine and preparation method and application thereof Download PDFInfo
- Publication number
- CN115820738A CN115820738A CN202211033272.2A CN202211033272A CN115820738A CN 115820738 A CN115820738 A CN 115820738A CN 202211033272 A CN202211033272 A CN 202211033272A CN 115820738 A CN115820738 A CN 115820738A
- Authority
- CN
- China
- Prior art keywords
- rabies
- adenovirus
- recombinant
- vaccine
- recombinant rabies
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the field of vaccine preparation, and particularly relates to an adenovirus recombinant rabies vaccine, a preparation method and application thereof, wherein the adenovirus recombinant rabies vaccine comprises recombinant rabies adenovirus carrier viruses; the recombinant rabies adenovirus vector virus comprises a human type 5 adenovirus vector and a coding sequence of rabies virus glycoprotein antigen connected between enzyme cutting sites of the human type 5 adenovirus vector; the rabies virus glycoprotein antigen is obtained by optimizing the I and/or II and/or III antigenic site amino acid sites of the glycoprotein sequence of the rabies virus ERA strain. The optimized antigen generates higher antibody titer, the adenovirus recombinant rabies vaccine prepared by recombining with the adenovirus is suitable for various action ways, the influence of the pre-stored immunity on the vaccine is reduced and eliminated, stronger protection effect on rabies is generated, and the constructed vaccine expresses an adjuvant in cells and is more beneficial to activating an immune channel.
Description
Technical Field
The invention belongs to the field of vaccine preparation, and particularly relates to an adenovirus recombinant rabies vaccine as well as a preparation method and application thereof.
Background
Rabies (rabies) is a highly lethal zoonotic infectious disease caused by rabies virus (RABV) infection. RABV encodes a total of 5 structural proteins, including nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase large protein (L), wherein RABV glycoprotein (rabbgg) is the only protein on the surface of virions, binds to receptors on the cell surface to facilitate invasion upon infection of a host by RABV, and also stimulates the organism to produce protective neutralizing antibodies (VNA).
There are at least 3 major neutralizing antibody binding sites on ravgg: antigenic sites I-III, and in addition, some minor linear epitopes. The antigenic site I of the glycoprotein is located in the region of amino acids 218-240, and is a minor linear neutralizing epitope, the minimal binding region of which is KLCGVL (positions 226-231), and the core residue is K-CGV-. The site II is a space epitope with high conservation formed by two sites of amino acids 34-42 and 198-200 through disulfide bonds C35-C207, wherein the amino acids 34-42, 147, 184 and 198-200 are important. Position III is located at amino acids 330-357, and is also a space epitope, wherein the 333-338 amino acid segment is the main binding site of the neutralizing antibody, the 342-343 a epitope is the minor neutralizing site, and the 330, 333, 336 and 338 amino acids are the key residues. Antigenic sites II and III are the main virus neutralizing epitopes, which are very close in space, and some of the key residue mutations can affect the virulence, host range or propagation speed of the virus. Experiments show that 260-267 (LHDFRSDE) on glycoprotein is a linear neutralizing epitope, and an anti-rabies antibody can be induced in a mouse body alone or together with a T cell epitope, so that the virus can be effectively resisted for attack.
Most of the existing rabies vaccines are inactivated vaccines and virus vector vaccines. The inactivated vaccine has very high safety, but the traditional rabies inactivated vaccine has low efficacy after immunization, short duration, multiple immunizations and relatively complicated immunization procedures. Poxviruses (vacciiaviruses) were developed into vectors expressing foreign genes in 1982, and subsequently recombinant poxvirus vector vaccines (V-RG) expressing ravbgg were developed and used in north america as live-vector vaccines for oral administration to wild animals for many years, which recombinant viruses had better heat stability, but the immune effect was not very desirable in some wild animals. Canarypox (canarypox) vector recombinant rabies vaccine (PUREVAX) can provide up to 3a immune protection for cats, but this vector is used in only a few laboratories. The adenovirus vector rabies vaccine ONRAB is an oral rabies vaccine for wild animals developed based on a human adenovirus type 5 (AdHu 5) vector. The patent with publication number CN103468743B provides a rabies vaccine and a preparation method thereof, and the patent constructs a novel rabies vaccine based on a chimpanzee adenovirus AdC68 vector; the patent with publication number CN108048483A provides a replication type recombinant adenovirus HAdV-5 vector system and application thereof, the replication type human 5 adenovirus vector is adopted, the immunogenicity is better, but because of the replication characteristics of the replication type adenovirus vector, the biological safety risk exists in the actual use process; the antigen adopts a rabies virus glycoprotein natural sequence, namely, the antigen glycoprotein amino acid sequence and an expression frame are not optimized, and the titer of the generated antibody is relatively low.
Disclosure of Invention
Aiming at the problems, the invention provides an adenovirus recombinant rabies vaccine, which comprises a recombinant rabies adenovirus carrier virus;
the recombinant rabies adenovirus vector virus comprises a human type 5 adenovirus vector and a coding sequence of rabies virus glycoprotein antigen connected between enzyme cutting sites of the human type 5 adenovirus vector;
wherein, the coding sequence of the rabies virus glycoprotein antigen is obtained by optimizing the I and/or II and/or III antigenic site amino acid sites of the rabies virus ERA strain glycoprotein sequence.
Further, the coding sequence of the rabies virus glycoprotein antigen comprises mutation of a single amino acid site and mutation combination of two or three amino acid sites.
Further, the amino acid sequence of the coding sequence of the rabies virus glycoprotein antigen is shown as SEQ 1.
Further, the adenovirus recombinant rabies vaccine also comprises an adjuvant, wherein the adjuvant comprises a TRL type adjuvant comprising TRL2, TRL3, TRL4 and TRL9.
Preferably, the adjuvant is TRL3, and the nucleotide sequence of the TRL3 is shown in SEQ 2.
The invention also provides a preparation method of the adenovirus recombinant rabies vaccine, which comprises the following steps:
obtaining a gene segment for coding a rabies virus glycoprotein antigen;
recombining gene segments for coding rabies virus glycoprotein antigens with a human type 5 adenovirus vector to form a recombinant adenovirus vector;
selecting enzyme cutting sites to linearize the recombinant adenovirus vector to obtain a linearized product;
precipitating the linearized product and then transfecting HEK293 cells to obtain recombinant rabies vaccine adenovirus vector viruses;
and preparing the adenovirus vector virus of the recombinant rabies vaccine to obtain the adenovirus recombinant rabies vaccine.
The adenovirus recombinant rabies vaccine provided by the invention can be applied to preparation of drugs for preventing and/or treating rabies.
The adenovirus recombinant rabies vaccine can be prepared into medicaments for nasal drip, subcutaneous injection or intramuscular injection.
The invention has the beneficial effects that:
the invention carries out mutation on the specific site of the rabies virus glycoprotein antigen sequence, the antibody titer generated by the optimized antigen is higher after the antigen is optimized, the adenovirus recombinant rabies vaccine prepared by recombining the optimized antigen and the adenovirus can be suitable for various action ways such as subcutaneous/nasal spray/oral administration and the like, the influence of the pre-stored immunity on the vaccine is reduced and eliminated, and stronger protection effect is generated on rabies, the constructed vaccine expresses the adjuvant in cells, and the adjuvant receptor is positioned in the cells, thereby being more beneficial to activating the immune channel.
Additional features and advantages of the invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objectives and other advantages of the invention will be realized and attained by the structure particularly pointed out in the written description and claims hereof as well as the appended drawings.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and those skilled in the art can also obtain other drawings according to the drawings without creative efforts.
FIG. 1 shows the results of the ELISA detection of bound antibodies in example 3 of the present invention;
FIG. 2 shows the detection results of neutralizing antibodies in example 3 of the present invention;
FIG. 3 shows the detection results of neutralizing antibodies in example 4 of the present invention;
FIG. 4 shows the results of the cellular immune response assay in example 4 of the present invention;
FIG. 5 shows the results of detection of neutralizing antibodies in example 5 of the present invention;
FIG. 6 shows the results of the ELISA detection of bound antibodies in example 6 of the present invention;
FIG. 7 shows the detection results of neutralizing antibodies in example 7 of the present invention;
FIG. 8 shows the results of the cellular immune response assay in example 7 of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention optimizes the amino acid sequence and expression frame of glycoprotein antigen by utilizing the characteristic that RABVGG is the only antigen of a RABV induced organism to generate a neutralizing antibody. The mutation of the amino acid sites of the I, II and/or III antigen sites of the glycoprotein sequence of the rabies virus ERA strain can be optimized mutation of a single site or mutation combination of two or three sites, and the antigen and the monoclonal antibody after the amino acid sequence optimization have advantages in combination. The I antigenic site of glycoprotein is located in the region of 218-240 amino acids, the II antigenic site is a space epitope with higher conservation formed by 34-42 th and 198-200 th amino acids through disulfide bond C35-C207, and the III antigenic site is located at 330-357 amino acids.
The embodiment of the invention selects a rabies virus ERA strain glycoprotein sequence, rabies virus glycoprotein is the only virus protein exposed outside a virus envelope, belongs to I-type transmembrane glycoprotein, is positioned on a rabies virus double-layer lipid membrane in a trimerization spinous process mode, and plays an important role in the cell adhesion, membrane fusion and axial plasma transportation processes of the virus.
The mature glycoprotein consists of 505 amino acids, divided into 3 regions:
amino acids 1-439 in the extracellular region are involved in the fusion reaction of the receptor and the membrane, and the spatial structure of the extracellular domain is maintained by 3 pairs of disulfide bonds (C35-C207, C169-C189 and C228-283); the amino acids 440-461 of the transmembrane region form a continuous hydrophobic region by 22 amino acids, which is related to the fixation of the viral lipid membrane of the glycoprotein; the amino acids 462-505 of the membrane inner region, located on the inner surface of the viral envelope, provide sites for matrix and nucleoprotein action, which have some effect on the stability of the trimeric spinous process.
The rabies virus ERA strain glycoprotein antigen is used in combination with an adjuvant, which adjuvant is expressed from a viral vector, including but not limited to a human adenovirus type 5 vector, preferably a human adenovirus type 5 vector; the adjuvant may be a TRL type adjuvant including, but not limited to, TRL2, TRL3, TRL4 and TRL9, preferably TRL3.
The adenovirus is packaged and constructed in HEK293 cells.
The rabies virus ERA strain, vector, enzyme and related reagents used in the following examples were all commercially available from commercial companies, and the primers used were synthesized by synthesis companies.
EXAMPLE 1 sample preparation (i.e., adenovirus vector recombinant rabies vaccine, (rAd 5-RGP), titer 5 x 10 8 TCID50.)
The preparation method comprises the following steps:
1.1 obtaining the Gene of interest
Optimizing the amino acid sites of the I and/or II and/or III antigenic sites of the glycoprotein sequence of the rabies virus ERA strain to obtain an optimized target gene (namely a gene segment for coding rabies virus glycoprotein antigens).
Specifically, an optimized target gene is synthesized according to the nucleic acid sequence of the coding region of the I and/or II and/or III antigenic site of rabies virus ERA strain in GenBank, and the amino acid sequence of the target gene is shown as SEQ 1:
SEQ1：
MVPQALLFVPLLVFPLCFGKFPIYTIPDKLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGYILAIKMNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDPRYEESLHNPYPDYRWLRTVKTTKESLVIISPSVADLDPYDRSLHSRVFPSGKCSGVAVSSTYCSTNHDYTIWMPENPRLGTSCDIFTNSRGKRASKGSETCGFVDERGLYKSLKGACKLKLCGVLGLRLMDGTWVAMQTSNETKWCPPDQLVNLHDFRSDEIEHLVVEELVRKREECLDALESIMTTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEADAHYKSVRTWNEILPSKGCLRVGGRCHPHVNGVFFNGIILGPDGNVLIPEMQSSLLQQHMELLESSVIPLVHPLADPSTVFKDGDEAEDFVEVHLPDVHNQVSGVDLGLPNWGKYVLLSAGALTALMLIIFLMTCCRRVNRSEPTQHNLRGTGREVSVTSQSGKIISSWESHKSGGETRL。
1.2 construction of recombinant adenovirus vectors:
the target gene (SEQ 1) is connected to a pENTR vector, and is recombined with a human adenovirus 5 vector under the action of LR recombinase to form a recombinant adenovirus vector (rAd 5-RGP).
1.3 preparation of recombinant rabies vaccine adenovirus vector virus:
and (3) selecting a PacI enzyme cutting site linearized rAd5-RGP adenovirus vector, precipitating a linearized product by ethanol, and transfecting HEK293 cells to obtain the recombinant rabies vaccine adenovirus vector virus.
In this example, HEK293 cells were self-prepared in this experiment, and the HEK293 suspension cells were serum-free suspension 293 cells acclimatized by ATCC adherent HEK293 cells, and any other 293 cells could achieve the purpose of this step.
1.4 virus culture:
(1) HEK293 suspension cells are inoculated in a shake flask until the density reaches 90 percent, and the prepared recombinant rabies vaccine adenovirus vector virus is added; 3-4d later, collecting all cells, centrifuging at the rotating speed of about 500g for 10min, removing supernatant, and collecting precipitate;
(2) Resuspending the precipitate in sterile 0.01M PBS solution, and freeze thawing for 4 times; centrifuging at 4 deg.C for 5min at 7000g, collecting supernatant, and making into virus solution;
(3) CsCl continuous gradient centrifugation purification: weighing 4.4g CsCl in a 50ml centrifuge tube, adding 8ml virus solution, and uniformly mixing to obtain 10ml; transfer to a 12ml ultracentrifuge tube (for SW41 rotor) covered with about 2ml mineral oil; after balancing, centrifuging at 30000rpm at 10 ℃ for 18-24h, and sucking and centrifuging out a virus band by using an injector;
(4) Virus dialysis desalting: preparing a dialysate (10mM Tris pH8.0, 2mM MgCl2 and 5% sucrose), and sterilizing; dialyzing the virus band at 4 deg.C, replacing dialysate for 3 times, removing CsCl to obtain virus, and storing at-70 deg.C.
(5) And sampling and detecting the viruses to be qualified to be used as a virus seed bank.
Example 2 bioreactor culture of viruses and production of vaccines
HEK293 cells and adenovirus vector viruses were cultured in suspension in a 5L reactor. Sterilizing a 5L bioreactor, adding serum-free culture medium, performing overnight sterile detection, setting reactor parameters to pH7.4, dissolved oxygen 50%, temperature 37 deg.C, balancing culture medium, inoculating cells with density of 3 × 10 the next day 6 ～4×10 6 The cell viability of the HEK293 cell is more than 95 percent, and when the cell density in a bioreactor reaches 3 multiplied by 10 6 In the above, the medium was added for subculture. When the cell density reaches 3X 10 6 ～4×10 6 Inoculating adenovirus according to the virus multiplicity of infection (MOI) of 0.001-0.1 when the culture volume is 4L and the cell viability is more than 90%; harvesting virus 72h after inoculation according to cytopathic conditionAnd (4) liquid. After clarification, tangential flow ultrafiltration and chromatographic purification, the vaccine stock solution is obtained.
After the vaccine stock solution is prepared, the vaccine stock solution can be stored at-70 ℃, 20 ℃, 2-8 ℃ or room temperature according to the subsequent experimental requirements, and the prepared vaccine preparation is named as adenovirus recombinant rabies vaccine, which is called recombinant rabies vaccine for short.
Example 3 experiment of the immune Effect of adenovirus recombinant rabies vaccine in mice
1. Grouping and processing experimental mice;
dividing 40 mice into five groups of A1, A2, A3, A4 and A5, wherein each group comprises 8 mice, and respectively taking blood before immunizing; after blood is taken, medicine immunization is respectively carried out on mice of each experimental group, and adenovirus recombinant rabies vaccines with the same virus titer total amount are respectively injected into the mice of groups A1, A2 and A3 by adopting a nose dropping, intramuscular injection and subcutaneous injection method; a4 and A5 groups of mice adopt an intramuscular injection method to immunize market rabies vaccines (the market rabies vaccines selected in the embodiment and the subsequent embodiments are canine/feline rabies inactivated vaccines of Netherlands International Inc); after immunization, each group of mice was bled. The specific grouping and handling of the experimental animals is shown in table 1:
TABLE 1 Experimental grouping of the immunization effect of adenovirus recombinant rabies vaccine in mice
| Group of | Number of | Immune front (D0) | Immunization (D0) | After immunization (D28) |
| A1 | 8 are | Blood sampling | Recombinant wild seedling, 0.02mL nose drops | Blood sampling |
| A2 | 8 are | Blood sampling | Recombined crazy seedlings, intramuscular injection 0.1mL | Blood sampling |
| A3 | 8 are | Blood sampling | Recombinant crazy-shoot, 0.1mL subcutaneous injection | Blood sampling |
| A4 | 8 are | Blood sampling | Commercial rabies vaccine, intramuscular injection 0.1mL | Blood sampling |
| A5 | 8 are | Blood sampling | Commercial rabies vaccine, intramuscular injection 0.05mL | Blood sampling |
2. Treating serum;
standing the pre-immune serum and the post-immune serum after blood taking at room temperature for 2h, and then transferring to 4 ℃ overnight; centrifuging at 4 deg.C and 3000rpm for 15min, and collecting supernatant. Each serum was aliquoted into 3 EP tubes on average, labeled and stored at-20 ℃ for testing. Enzyme-linked immunosorbent assay (ELISA) is adopted to detect the titer of the combined antibody, and a rapid fluorescence focus inhibition assay (RFFIT) is adopted to detect the neutralizing antibody.
The ELISA detection results of the bound antibody are shown in FIG. 1, and the detection results of the neutralizing antibody are shown in FIG. 2.
The results show that: the antibody of group A1 is higher than that of groups A2, A3, A4 and A5, which indicates that the nasal drip mode is more preferable.
Example 4 immune Effect of different immune pathways in Pet dogs with adenovirus recombinant rabies vaccine
1. Grouping and processing the experimental pet dogs;
dividing 15 pet dogs into three groups A1, A2 and A3, wherein each group comprises 5 pet dogs, and respectively taking blood before immunization; taking blood, and then respectively carrying out drug immunization on pet dogs of each experimental group, wherein the pet dogs of the A1 group are immunized in a nasal drip mode, each hole is 0.25mL, and the two holes are 0.5mL; group A2 pet dogs adopt subcutaneous injection immunization, and groups A1 and A2 are immunized with adenovirus recombinant rabies vaccines with the same virus titer; a3, a commercially available rabies vaccine is immunized by adopting a subcutaneous injection method; after immunization, each group of pet dogs was bled. The specific grouping and handling of the experimental animals is shown in table 2:
TABLE 2 immunization Effect grouping of different immunization pathways of adenovirus recombinant rabies vaccine in Pet dogs
| Group of | Number of | Blood sampling before immunization (D0) | Immunization (D0) | Blood sampling after immunization (D28) |
| A1 | 5 are | 2 ml/piece | Recombinant wild seedling, 0.5mL nose drops | 2 ml/piece |
| A2 | 5 are | 2 ml/piece | Recombinant crazy-shoot, 1mL |
2 ml/piece |
| A3 | 5 are | 2 ml/piece | Commercial rabies vaccine, 0.5mL |
2 ml/piece |
2. Treating serum;
and respectively preparing serum from the pre-immune serum and the post-immune serum after blood taking, collecting lymphocytes, and detecting after marking. The RFFIT method is adopted to detect neutralizing antibodies, the ELISPOT method is adopted to detect cellular immune reaction, and two cytokines of IFN-g and IL-2 are detected in the cellular immune reaction.
The results of the detection of the neutralizing antibody are shown in FIG. 3, and the results of the detection of the cellular immune response are shown in FIG. 4.
The results show that: the A1 group antibody and cellular immune response are higher than those of A2 and A3 groups.
Example 5 experiment of oral Effect of adenovirus recombinant rabies vaccine
1. Grouping and processing experimental mice;
dividing 16 mice into two groups A1 and A2, and taking blood before immunizing the two groups of mice respectively; after blood is taken, medicine immunization is respectively carried out on the mice of each experimental group, and the mice of the A1 group are immunized in a way of intragastric administration of 0.1mL adenovirus recombinant rabies vaccine; group A2 selected empty vector 0.1mL for immunization; after immunization, each group of mice was bled. The specific grouping and handling of the experimental animals is shown in table 3:
TABLE 3 Experimental groups for oral administration effect of adenovirus recombinant rabies vaccine
| Group of | Number of | Immune front (D0) | Immunization (D0) | After immunization (D28) |
| A1 | 8 are | Blood sampling | Recombinant crazy seedling, gavage 0.1mL | Blood sampling |
| A2 | 8 are | Blood sampling | Empty vector, 0.1mL | Blood sampling |
2. Serum treatment
Standing the blood serum before and after immunization at room temperature for 2h, and then transferring to 4 deg.C overnight; centrifuging at 4 deg.C and 3000rpm for 15min, and collecting supernatant. Each serum was aliquoted into 3 EP tubes on average, labeled and stored at-20 ℃ for testing. Neutralizing antibodies were detected using RFFIT and the results are shown in figure 5.
The results show that: the A1 group is higher than the A2 group, which shows that the adenovirus recombinant rabies vaccine mice can generate neutralizing antibodies after oral immunization.
Example 6 experiment of immune Effect of non-optimized antigen recombinant rabies vaccine and adenovirus recombinant rabies vaccine
1. Grouping and processing experimental mice;
dividing 32 mice into four groups of A1, A2, A3 and A4, wherein each group comprises 8 mice, and respectively taking blood before immunizing the mice; after blood is taken, medicine immunization is respectively carried out on mice of each experimental group, and 0.02mL of adenovirus recombinant rabies vaccine is injected into the mice of A1 and A2 groups by adopting a nose dropping method; injecting 0.1mL of recombinant crazy seedlings into the A3 and A4 groups of mice by adopting a subcutaneous injection method; each group was immunized with a vaccine of the same viral titer, and each group of mice was bled after immunization. The specific grouping and handling of the experimental animals is shown in table 4:
TABLE 4 Experimental groups of immunization effect of recombinant rabies vaccine and adenovirus recombinant rabies vaccine without optimized antigen
2. Serum treatment
Standing the blood serum before and after immunization at room temperature for 2h, and then transferring to 4 deg.C overnight; centrifuging at 4 deg.C and 3000rpm for 15min, and collecting supernatant. Each serum was aliquoted into 3 EP tubes on average, labeled and stored at-20 ℃ for testing. The antibody titer was measured by ELISA and the results are shown in FIG. 6.
The results show that: the A1 group is higher than the A2 group, and the A3 group is higher than the A4 group, which shows that the immunogenicity of the recombinant rabies vaccine after the antigen is optimized is better.
Example 7 experiment of the immune Effect of recombinant rabies vaccine containing adenovirus expressing TRL3 adjuvant and recombinant vaccine not expressing TRL3 adjuvant
Wherein, the sequence of TRL3 is shown in SEQ 2:
ccgggaaacgatatgggctgaatacctcgaggtattcagcccatatcgtttctttttg
1. grouping and processing experimental mice;
dividing 32 mice into four groups of A1, A2, A3 and A4, wherein each group comprises 8 mice, and taking blood before immunizing the mice respectively; after blood is taken, medicine immunization is respectively carried out on mice of each experimental group, and the mice of A1 group and A2 group are injected with 0.02mL in a nasal drip mode; injecting the A3 and A4 groups of mice into 0.1mL in a subcutaneous injection mode; after immunization, each group of mice was bled. The specific grouping and handling of the experimental animals is shown in table 5:
TABLE 5 immunization Effect test groups for recombinant vaccines containing TRL3 adjuvant and recombinant vaccines not expressing TRL3 adjuvant
| Group of | Number of | Pre-immune (D0) | Immunization (D0) | After immunization (D28) |
| A1 | 8 are | Blood sampling | Non-expression adjuvant crazy seedling, dripping into nose | Blood sampling |
| A2 | 8 are | Blood sampling | Express adjuvant crazy seedling, drip nose | Blood sampling |
| A3 | 8 are | Blood sampling | Subcutaneous injection without adjuvant expressed | Blood sampling |
| A4 | 8 are | Blood sampling | Expressing adjuvant crazy vaccine, subcutaneous injection | Blood sampling |
3. Treating serum;
and respectively preparing serum from the pre-immune serum and the post-immune serum after blood taking, collecting lymphocytes, and detecting after marking. The results of detection of neutralizing antibodies by RFFIT method and detection of cellular immune response by ELISPOT are shown in FIG. 7 and FIG. 8.
The results show that: the group A1 is higher than the groups A3 and A4.
Example 8 determination of infectious titer of recombinant adenovirus and genetic stability analysis
Virus titer (TCID 50) assay:
viral titers were calculated by rAd5-RGP adenovirus infected cells. With HEK293 cells at 10 per ml 5 Individual cells (100. Mu.L per well) were seeded into 96-well flat-bottomed cell culture dishes and maintained at 37 ℃ and 5% CO 2 The following steps. After 90% confluence was reached, 5% fetal bovine content was usedSerum (FBS) in Dulbecco's Modified Eagle Medium (DMEM) Medium was diluted according to 1. The diluted virus was then added 100uL to the first row of the plate and a 1:2 dilution was performed along the plate. The process is repeated. After 24 hours, the cytopathic effect was observed and half the tissue culture infectious dose (TCID 50) was calculated from the lesion well dilution.
After 10 generations of vaccine virus seeds, extracting genome and sequencing to observe target gene sequence, the result shows that the target gene sequence of the virus seeds of different generations has consistent result.
Example 9TRL3 receptor assay
Balb/c mice are used as animal models, and 6-8-week-old Balb/c mice are selected and divided into a Phosphate Buffered Saline (PBS) group and a vaccine group. The abdominal cavity immunization is carried out according to groups, mice are killed 24-72 hours, spleens are taken out, marked and stored. After total RNA is extracted from the preserved sample, transcriptome sequencing (a high-throughput sequencing system BGISEQ-500, huada gene) is carried out on the sample so as to verify whether the expression adjuvant can promote the expression of the TLR3 receptor. The mean value of the expression levels of the TLR3 receptors of each group was calculated from the results of each group, and the results are shown in table 6.
TABLE 6 TLR3 receptor expression levels in different experimental groups
| Grouping | Sample size | TLR3 Gene expression level (FPKM value) |
| |
4 | 11.93±1.98 |
| Adjuvant- |
4 | 12.15±2.05 |
| |
4 | 12.93±0.69 |
The differential expression fold was calculated from the known expression amount (FPKM value) of TLR3 gene in each group. Log2 (treatment FPKM/control FPKM) and Qvalue (treatment/control) values were used as references.
TABLE 7
As can be seen from Table 7, the expression level of TLR3 gene of the adjuvant vaccine group is up-regulated to reach a very significant level (P < 0.01).
Example 10 post-exposure immunization
Golden yellow hamster of 6-8 weeks old is selected, and 10 mice are selected per group. Divided into test, marketed control and PBS groups. At 5.0lgLD 50 The rabies CVS challenge virus with a concentration of 0.1mL was administered to each group of animals by intramuscular injection into the hind leg. After 5-8 hours, 10IU/kg of rabies human immunoglobulin is injected on the same side of the body weight, and the recombinant rabies vaccine, the rabies inactivated vaccine on the market and phosphate buffer salt in the example 1 are respectively injected on different sides according to different immunization programs. The results of comparing the post-exposure immunoprotection effect between each group of vaccines after 60 days of continuous observation are shown in table 8.
TABLE 8 post-exposure immunoprotection Effect between groups of vaccines
| Sample batch number | Number of deaths | Protective |
| Test group | ||
| 1/10 | 90％ | |
| Control group on |
2/10 | 80％ |
| PBS group | 5/10 | 50％ |
As can be seen from the above table, the protection rate of the PBS control group without immunoglobulin injection is 50%, the protection rate of the marketed control group is 80%, and the protection rate of the vaccine of the test group is 90%.
Although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Claims (10)
1. An adenovirus recombinant rabies vaccine is characterized by comprising recombinant rabies adenovirus vector viruses;
the recombinant rabies adenovirus vector virus comprises a human type 5 adenovirus vector and a coding sequence of rabies virus glycoprotein antigen connected between enzyme cutting sites of the human type 5 adenovirus vector;
the coding sequence of the rabies virus glycoprotein antigen is obtained by optimizing the antigenic site I and/or II and/or III of the rabies virus ERA strain glycoprotein sequence.
2. The adenoviral recombinant rabies vaccine of claim 1,
the coding sequence of the rabies virus glycoprotein antigen comprises mutation of a single amino acid site and mutation combination of two or three amino acid sites.
3. The adenoviral recombinant rabies vaccine according to claim 1 or 2,
the amino acid sequence of the coding sequence of the rabies virus glycoprotein antigen is shown as SEQ 1.
4. The adenoviral recombinant rabies vaccine according to claim 3,
the adenovirus recombinant rabies vaccine also comprises an adjuvant, wherein the adjuvant comprises a TRL type adjuvant which comprises TRL2, TRL3, TRL4 and TRL9.
5. The adenoviral recombinant rabies vaccine according to claim 4,
the adjuvant is TRL3, and the nucleotide sequence of the TRL3 is shown in SEQ 2.
6. A method for preparing the adenoviral recombinant rabies vaccine according to any one of claims 1-5, comprising:
obtaining a gene segment for coding a rabies virus glycoprotein antigen;
recombining a gene segment for coding a rabies virus glycoprotein antigen and a human type 5 adenovirus vector to form a recombinant adenovirus vector;
selecting enzyme cutting sites to linearize the recombinant adenovirus vector to obtain a linearized product;
precipitating the linearized product and then transfecting HEK293 cells to obtain recombinant rabies vaccine adenovirus vector viruses;
and preparing the recombinant rabies vaccine adenovirus vector virus to obtain the adenovirus recombinant rabies vaccine.
7. An adenovirus comprising the coding sequence for the rabies virus glycoprotein antigen according to claim 1 or 2.
8. The use of the adenoviral recombinant rabies vaccine according to claim 1 in the preparation of a medicament for the prevention and/or treatment of rabies.
9. The use of the adenoviral recombinant rabies vaccine prepared according to the preparation method of claim 6 in the preparation of a medicament for preventing and/or treating rabies.
10. The adenoviral recombinant rabies vaccine according to claim 1 or the adenoviral recombinant rabies vaccine prepared according to the preparation method of claim 6 can be prepared into a medicament in the dosage form of nasal drops, subcutaneous injection or intramuscular injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211033272.2A CN115820738A (en) | 2022-08-26 | 2022-08-26 | Adenovirus recombinant rabies vaccine and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211033272.2A CN115820738A (en) | 2022-08-26 | 2022-08-26 | Adenovirus recombinant rabies vaccine and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115820738A true CN115820738A (en) | 2023-03-21 |
Family
ID=85523243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211033272.2A Pending CN115820738A (en) | 2022-08-26 | 2022-08-26 | Adenovirus recombinant rabies vaccine and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820738A (en) |
-
2022
- 2022-08-26 CN CN202211033272.2A patent/CN115820738A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220118077A1 (en) | Immunogen for broad-spectrum influenza vaccine and application thereof | |
| Larsen et al. | Coadministration of DNA encoding interleukin-6 and hemagglutinin confers protection from influenza virus challenge in mice | |
| CN113186173B (en) | Novel coronavirus pneumonia vaccine based on attenuated influenza virus vector | |
| JP6951429B2 (en) | New swine flu vaccine | |
| EA011557B1 (en) | Nucleic acid constructs | |
| Zheng et al. | Construction and immunogenicity of a recombinant fowlpox virus containing the capsid and 3C protease coding regions of foot-and-mouth disease virus | |
| Sumirtanurdin et al. | Coronavirus disease 2019 vaccine development: an overview | |
| AU2016202693B2 (en) | Attenuated swine influenza vaccines and methods of making the use thereof | |
| CN113151196A (en) | Recombinant vaccinia virus, vaccinia virus vector vaccine, application and preparation method thereof | |
| EP2044947B1 (en) | MVA-based compositions and methods for inducing an immune response against influenza | |
| CN105695491A (en) | Preparing method for Newcastle disease glycoprotein viral antigen and product of preparing method | |
| KR101986071B1 (en) | Influenza h5 vaccines | |
| JP2014511119A (en) | New vaccine against H1N1 subtype influenza pandemic virus | |
| Kumar et al. | Mucosal immunization of calves with recombinant bovine adenovirus-3 coexpressing truncated form of bovine herpesvirus-1 gD and bovine IL-6 | |
| AU2017275663B2 (en) | Modification of engineered influenza hemagglutinin polypeptides | |
| CN115820738A (en) | Adenovirus recombinant rabies vaccine and preparation method and application thereof | |
| CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application | |
| WO2023023940A1 (en) | Immunogen for inducing broad-spectrum anti-coronavirus t cell vaccine and use thereof | |
| CN114381438A (en) | Influenza virus weakening method, influenza virus weakening strain and application | |
| CN107841513B (en) | Broad-spectrum influenza vaccine based on M2e epitope | |
| CN116144612B (en) | Recombinant influenza B virus and preparation method and application thereof | |
| CN117511969B (en) | mRNA, preparation method, application and vaccine | |
| CN116904489B (en) | Duck tembusu virus nucleic acid vaccine and application thereof | |
| WO2022195900A1 (en) | Recombinant measles virus | |
| RU2706191C1 (en) | Multivalent influenza vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |