CN115820722A

CN115820722A - Cotton verticillium wilt resistance related gene GhCBL3 and coding protein and application thereof

Info

Publication number: CN115820722A
Application number: CN202210897827.1A
Authority: CN
Inventors: 高升旗; 郝晓燕; 胡文冉; 黄全生; 李建平; 常晓春; 陈果; 赵准
Original assignee: Xinjiang Academy Of Agricultural Sciences Institute Of Nuclear Technology Biotechnology (xinjiang Uygur Autonomous Region Biotechnology Research Center)
Current assignee: Xinjiang Academy Of Agricultural Sciences Institute Of Nuclear Technology Biotechnology (xinjiang Uygur Autonomous Region Biotechnology Research Center)
Priority date: 2022-07-28
Filing date: 2022-07-28
Publication date: 2023-03-21

Abstract

The invention discloses a cotton verticillium wilt resistance related gene GhCBL3, and a coding protein and application thereof. The protein is any one of the following: b1 Protein of which the amino acid sequence is SEQ ID No. 1; b2 Protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 1), has more than 80 percent of identity with the protein shown in B1) and has the same function; b3 A fusion protein having the same function obtained by attaching a tag to the N-terminus and/or C-terminus of B1) or B2). The invention identifies the disease resistance of the transgenic cotton after GhCBL3 gene silencing, and the result shows that the morbidity and the disease index of the transgenic cotton are both obviously reduced, and the verticillium wilt resistance is obviously enhanced, so the GhCBL3 protein and the coding gene thereof can regulate and control the disease resistance of plants, and have important significance for cultivating the transgenic cotton with verticillium wilt resistance.

Description

Cotton verticillium wilt resistance related gene GhCBL3 and coding protein and application thereof

Technical Field

The invention relates to a cotton verticillium wilt resistant related gene GhCBL3 in the field of plant genetic engineering, and a coding protein and application thereof.

Background

Cotton is an important economic crop in the world, and upland cotton (Gossypium hirsutum l.) in the genus Gossypium is the most widely cultivated cotton seed at present due to its good fiber quality, high yield and short growth cycle, and the yield accounts for about 95% of the total yield of cotton in the world. The cotton Verticillium wilt (Verticillium wilt) is the most important disease in cotton production and is one of the national agricultural plant quarantine objects. The cotton Verticillium wilt is a destructive vascular bundle disease caused by a soil-borne pathogenic fungus, verticillium dahliae (Verticillium dahliae), seriously restricts the growth and development of cotton, becomes the first disease of cotton worldwide and is called as the cancer of cotton. To date, cotton verticillium wilt cannot be effectively controlled in upland cotton, and upland cotton varieties with high verticillium wilt resistance are still unavailable at present. Years of practice prove that the development of disease-resistant genes, the understanding of the reaction mechanism of cotton to verticillium wilt, the acceleration of the breeding process of cotton verticillium wilt resistance and the improvement of the disease resistance of cotton become the main approaches of cotton verticillium wilt resistance breeding work.

With the rapid development of molecular biology, people gradually deepen understanding of plant biotic stress response molecular mechanisms. Ca, a second messenger ubiquitous in plants ²⁺ Participate in regulating and controlling the growth and development of plants and the response of multiple adversity stress. The research shows that the adversity stress acts on the plant cells to first trigger the intracellular calcium ion concentrationChange in degree, ca ²⁺ The concentration appears to vary spatiotemporally and specifically, and this variation is influenced by the corresponding Ca ²⁺ The sensors sense and transmit signals to target proteins at the downstream, so that a series of physiological and biochemical reactions in cells are triggered to respond to the stress. Ca is currently found in plants ²⁺ Receptor proteins are mainly divided into three classes: calmodulin (CaM), calcineurin B-subunit proteins (CBL), and calcium-dependent protein kinase (CDPK). One of them is Ca specific to plant ²⁺ The receptor protein, calcineurin B-like protein (CBL), is able to regulate the expression of downstream early response genes by signaling through the proteins that interact with it. CBL-type calciners are small molecule proteins that are present only in plants, in close resemblance to animal Calcineurin B Subunits (CNBs) and central Nervous Calciners (NCSs), i.e., CBLs or CBL calciners. The protein kinase CIPK with which CBL receptors interact constitutes the CBL-CIPK signaling system to regulate response to calcium signaling and to regulate expression of downstream genes. In the genomes of dicotyledonous plants, namely arabidopsis thaliana, monocotyledonous plants, namely rice and corn, the CBL gene family comprises 10 members, the 10 CBL genes comprise 6 or 7 introns in coding regions, and the positions and the arrangement sequence of the 4 introns in the coding regions of the 10 genes are highly conserved. At present, researches on CBL genes mostly focus on plant response to adversity stress such as drought, salt, alkali, low temperature and the like, but researches on the resistance function of cotton verticillium wilt are not reported yet. The CBL protein is composed mainly of two globular domains at the N-and C-termini, each domain containing a pair of EF hand motifs, each consisting of 12 amino acid residues. The EF hand motif of CBL is more or less different than the amino acid sequence of the typical EF hand motif of CaM (DXD (N) XD (N) (S) GXI (V) D (N) (S) XXE), e.g., of the 10 members of the Arabidopsis CBL family, atCBL1 and AtCBL9 have 2 typical EF hand motifs, atCBL6, atCBL7, atCBL8 and AtCBL10 have only one typical EF hand motif, whereas AtCBL2, atCBL3, atCBL4 and AtCBL5 do not have the typical EF hand motifs. Cotton CBL3 has 4 EF hand motifs that can serve as calcium binding sites.

In view of the above, the verticillium wilt resistant gene is excavated and identified, the genetic basis of verticillium wilt resistance is analyzed, and the disease-resistant molecular design breeding is carried out by combining the biotechnology, so that the damage of the verticillium wilt of cotton can be fundamentally prevented and controlled, the breeding of the verticillium wilt resistant cotton variety is accelerated, the commercial cotton breeding process is promoted, and the problem of lack of the disease-resistant variety in production is effectively solved. The method for improving the verticillium wilt resistance of cotton by a genetic means is not only the most economic and effective solution, but also has important significance for ensuring the quality, high yield and stable yield of cotton, and has wide application value in the field of cotton molecular breeding.

Disclosure of Invention

The technical problem to be solved by the invention is how to regulate the disease resistance of plants (such as increasing or reducing the verticillium wilt resistance of plants). The technical problem to be solved is not limited to the technical subject described, and other technical subject not mentioned herein may be clearly understood by those skilled in the art through the following description.

In order to solve the above technical problems, the present invention provides, in a first aspect, an application of a protein or a substance that regulates an activity and/or a content of the protein, wherein the application may be any one of the following:

a1 Use of) a protein or a substance which regulates the activity and/or content of said protein for regulating disease resistance in plants;

a2 Use of) proteins or substances regulating the activity and/or content of said proteins for the preparation of products regulating the disease resistance of plants;

a3 Use of) proteins or substances regulating the activity and/or content of said proteins for the cultivation of disease-resistant plants;

a4 Use of) proteins or substances regulating the activity and/or content of said proteins for the preparation of products for the cultivation of disease-resistant plants;

a5 Use of a protein or a substance modulating the activity and/or content of said protein in plant breeding or in the improvement of germplasm resources of a plant;

a6 Use of) proteins or substances regulating the activity and/or content of said proteins for controlling cotton diseases;

the protein is named as GhCBL3 and can be any one of the following:

b1 Protein of which the amino acid sequence is SEQ ID No. 1;

b2 Protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 1), has more than 10 percent of identity with the protein shown in B1) and has the same function;

b3 A fusion protein having the same function obtained by attaching a tag to the N-terminus and/or C-terminus of B1) or B2).

In the above application, the protein GhCBL3 can be derived from cotton (Gossypium spp).

Further, the protein GhCBL3 may be derived from upland cotton (Gossypium hirsutum l.).

Further, the protein GhCBL3 can be involved in Ca ²⁺ A regulated cotton calcineurin B-subunit protein (CBL) GhCBL3.

Further, the protein GhCBL3 can be cotton disease resistance related protein GhCBL3, and specifically can be cotton verticillium wilt resistance related protein GhCBL3.

Further, the protein GhCBL3 can be cotton Verticillium wilt resistance (Verticillium wilt) related protein GhCBL3.

In order to facilitate purification or detection of the protein of B1), a tag protein may be attached to the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence represented by SEQ ID No.1 of the sequence Listing.

Such tag proteins include, but are not limited to: GST (glutathione mercaptotransferase) tag protein, his6 tag protein (His-tag), MBP (maltose binding protein) tag protein, flag tag protein, SUMO tag protein, HA tag protein, myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

The nucleotide sequence encoding the protein GhCBL3 of the present invention can be easily mutated by a person of ordinary skill in the art by using known methods, such as directed evolution or point mutation. The nucleotides which are artificially modified and have 75 percent or more than 75 percent of identity with the nucleotide sequence of the protein GhCBL3 obtained by the separation of the invention are derived from the nucleotide sequence of the invention and are identical with the sequence of the invention as long as the nucleotides encode the protein GhCBL3 and have the function of the protein GhCBL3.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

Herein, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, the Expect value is set to 10, all filters are set to OFF, BLOSUM62 is used as a Matrix, the Gap existence cost, the Per residual Gap cost, and the Lambda ratio are set to 11,1, and 0.85 (default values), respectively, and a search is performed to calculate the identity (%) of the amino acid sequence, and then the value (%) of identity can be obtained.

Herein, the 80% or greater identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

Herein, the substance regulating the activity and/or content of the protein may be a substance regulating the expression of a gene encoding the protein GhCBL3.

As above, the substance that regulates gene expression may be a substance that performs at least one of the following 6 controls: 1) Regulation at the level of transcription of said gene; 2) Regulation after transcription of the gene (i.e., regulation of splicing or processing of a primary transcript of the gene); 3) Regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (i.e., regulation of the activity of a protein translated from the gene).

The substance regulating gene expression may in particular be a biological material as described in any of E1) -B4) herein.

Further, the substance for regulating gene expression may be a substance (including a nucleic acid molecule or a vector) for inhibiting or reducing or down-regulating expression of a gene encoding the protein GhCBL3.

Further, the substance for regulating gene expression may be a substance (including a nucleic acid molecule or a vector) for increasing or up-regulating the expression of a gene encoding the protein GhCBL3.

The invention also provides an application of the biological material related to the protein GhCBL3, wherein the application can be any one of the following:

d1 Application of biological materials related to the protein GhCBL3 in regulation and control of plant disease resistance;

d2 Application of biological materials related to the protein GhCBL3 in preparing products for regulating and controlling plant disease resistance;

d3 Application of biological material related to the protein GhCBL3 in cultivating disease-resistant plants;

d4 Application of biological material related to the protein GhCBL3 in preparing products for cultivating disease-resistant plants;

d5 Application of biological materials related to the protein GhCBL3 in plant breeding or improvement of plant germplasm resources;

d6 Application of biological materials related to the protein GhCBL3 in prevention and control of cotton diseases;

the biomaterial may be any one of the following E1) to E8):

e1 Nucleic acid molecules encoding said protein GhCBL 3;

e2 Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the protein GhCBL 3;

e3 An expression cassette comprising the nucleic acid molecule according to E1) and/or E2);

e4 A recombinant vector containing the nucleic acid molecule according to E1) and/or E2), or a recombinant vector containing the expression cassette according to E3);

e5 A recombinant microorganism containing the nucleic acid molecule described in E1) and/or E2), or a recombinant microorganism containing the expression cassette described in E3), or a recombinant microorganism containing the recombinant vector described in E4);

e6 A transgenic plant cell line containing the nucleic acid molecule according to E1) and/or E2), or a transgenic plant cell line containing the expression cassette according to E3), or a transgenic plant cell line containing the recombinant vector according to B4);

e7 A transgenic plant tissue containing the nucleic acid molecule according to E1) and/or E2), or a transgenic plant tissue containing the expression cassette according to E3);

e8 Transgenic plant organs containing the nucleic acid molecules described in E1) and/or E2) or containing the expression cassettes described in E3).

In the above application, the nucleic acid molecule may be any one of:

f1 A DNA molecule whose coding sequence is SEQ ID No.2 or SEQ ID No. 3;

f2 A DNA molecule whose nucleotide sequence is SEQ ID No.2 or SEQ ID No. 3.

The DNA molecule (cotton verticillium wilt resistance related gene GhCBL 3) shown in SEQ ID No.2 encodes protein GhCBL3 with the amino acid sequence of SEQ ID No. 1.

The nucleotide sequence shown in SEQ ID NO.2 is the nucleotide sequence of a protein GhCBL3 coding gene (CDS).

E1 The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 2.

E1 The nucleic acid molecule also comprises the nucleic acid molecule which has more than 95 percent of identity with the nucleotide sequence shown in SEQ ID No.2 and is of the same species as the source.

The gene of the protein GhCBL3 (GhCBL 3 gene) can be any nucleotide sequence capable of coding the protein GhCBL3. Considering the degeneracy of codons and the preference of codons of different species, the skilled person can use codons suitable for the expression of a particular species as required.

The expression cassette comprises a promoter, a nucleic acid molecule for coding the protein GhCBL3 and a terminator, wherein the promoter can be a CaMV35S promoter, an NOS promoter or an OCS promoter, and the terminator can be an NOS terminator or an OCS polyA terminator.

The nucleic acid molecule described herein may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be an RNA, such as a gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

Vectors described herein are well known to those skilled in the art and include, but are not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. Specifically PYL156 vector and/or PYL156

-Blunt Zero Cloning Vector。

The microorganism described herein may be a yeast, bacterium, algae or fungus. Among them, the bacteria may be derived from the genera Escherichia (Escherichia), erwinia (Erwinia), agrobacterium (Agrobacterium), flavobacterium (Flavobacterium), alcaligenes (Alcaligenes), pseudomonas (Pseudomonas), bacillus (Bacillus), etc. Specifically, agrobacterium tumefaciens GV3101 and/or Escherichia coli DH 5. Alpha. May be mentioned.

The recombinant vector can be specifically a recombinant vector pEASY-GhCBL3 and/or a recombinant vector PYL156-GhCBL3.

The recombinant vector pEASY-GhCBL3 (namely pEASY-GhCBL3 plasmid) is a method using cohesive end cloning, and a DNA fragment with a nucleotide sequence of SEQ ID No.3 in a sequence table is connected

-Blunt Zero Cloning Vector, holding

-other sequences of Blunt Zero Cloning Vector were not changed to obtain a recombinant Vector.

The recombinant vector PYL156-GhCBL3 is obtained by replacing a fragment (small fragment) between EcoRI recognition sites and KpnI recognition sites of the PYL156 vector with a DNA fragment shown in SEQ ID No.3 in a sequence table and keeping other nucleotide sequences of the PYL156 vector unchanged.

The recombinant microorganism can be obtained by introducing the recombinant vector into the starting microorganism.

The recombinant vector carrying the GhCBL3 gene can transform plant cells or tissues by using a Ti plasmid, a Ri plasmid, a plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation and other conventional biological methods, and culture the transformed plant tissues into plants.

The recombinant microorganism can be specifically recombinant agrobacterium GV3101/PYL156-GhCBL3.

The recombinant agrobacterium GV3101/PYL156-GhCBL3 is a recombinant strain obtained by introducing the recombinant vector PYL156-GhCBL3 into agrobacterium tumefaciens GV 3101.

The invention also provides a method for cultivating disease-resistant plants, which can comprise the step of reducing the content and/or activity of the protein GhCBL3 in target plants to obtain the disease-resistant plants with higher disease resistance than the target plants.

In the above method, the reduction of the content and/or activity of the protein GhCBL3 in the target plant can be achieved by reducing the expression level of a gene encoding the protein GhCBL3 in the target plant.

In the above method, the reducing the expression level of the gene encoding the protein GhCBL3 in the target plant may be performed by reducing the expression level of the gene encoding the protein GhCBL3 in the genome of the target plant by using a gene mutation, gene knock-out, gene editing, or gene knock-down technique.

In the above method, the reduction of the expression level of the coding gene of the protein GhCBL3 in the target plant genome by the gene knockdown technique may be performed by using a virus-induced gene silencing vector constructed by forward integrating the nucleic acid molecule represented by SEQ ID No.3 into a Tobacco Rattle Virus (TRV) -based plasmid vector.

Further, the Tobacco Rattle Virus (TRV) -based plasmid vector may be a PYL156 vector.

The method for cultivating disease-resistant plants can comprise the following steps: inhibiting and expressing a nucleic acid molecule capable of expressing a GhCBL3 protein in a receptor plant (a target plant) to obtain a transgenic plant; the transgenic plant has increased disease resistance as compared to the recipient plant. Wherein, the inhibition of the expression of the nucleic acid molecule capable of expressing the GhCBL3 protein in the receptor plant can be realized by any technical means capable of realizing the purpose.

The method for cultivating disease-resistant plants of the invention can comprise the following steps:

m1) inserting the nucleic acid molecule shown in SEQ ID No.3 into a plasmid vector containing a tobacco rattle virus sequence to construct a recombinant plasmid (namely a gene silencing vector);

m2) introducing the recombinant plasmid into a target plant (such as a crop or cotton);

m3) obtaining the disease-resistant plant through screening and identification.

The introduction refers to transformation mediated by recombinant means, including but not limited to Agrobacterium, biolistic methods, electroporation or in planta techniques.

Herein, the plant may be a crop (e.g., a crop).

In the above-mentioned use and/or method, the plant may be any one of:

g1 A monocot or dicot;

g2 Malvaceae plants;

g3 Cotton plants;

g4 Cotton).

Further, the cotton may be, in particular, upland cotton (Gossypium hirsutum l.).

The protein GhCBL3, and/or the biological material are also in the protection scope of the invention.

The invention also provides application of the method for cultivating the disease-resistant plant in creating the disease-resistant plant and/or plant breeding and/or plant germplasm resource improvement.

Herein, the disease-resistant plant may be a plant with increased disease resistance (up-regulation).

In the present invention, the modulation may be up-regulation or attenuation or reduction. The modulation may also be down-regulation or enhancement or increase.

Modulating disease resistance in plants as described herein can be increasing (up-regulating) plant disease resistance or decreasing (down-regulating) plant disease resistance.

Herein, the disease resistance may be Verticillium wilt (Verticillium wilt) resistance.

Specifically, modulating disease resistance in plants as described herein can be modulating the disease resistance of a plant, including increasing (up-regulating) the disease resistance of a plant or decreasing (down-regulating) the disease resistance of a plant.

Any one of the above Verticillium wilt diseases may specifically be Verticillium wilt disease caused by Verticillium dahliae (Verticillium dahliae).

The plant breeding described herein may be crop disease resistance breeding, and may specifically be cotton verticillium wilt resistance breeding, the purpose of which is to breed cotton with improved verticillium wilt resistance.

The plant breeding method can be molecular breeding for improving the disease resistance of crops by using the GhCBL3 gene and/or the GhCBL3 protein.

The cotton disease can be a disease caused by Verticillium dahliae (Verticillium dahliae), and particularly can be a cotton Verticillium wilt disease.

Herein, the disease-resistant plant is understood to comprise not only the first generation transgenic plant obtained by silencing or knocking out the GhCBL3 gene, but also the progeny thereof. The transgenic plants include seeds, callus, whole plants and cells.

The invention provides a cotton calcineurin B subunit protein CBL3 gene and a coding protein thereof, wherein the gene is amplified by utilizing GhCBL3 gene sequence information, a VIGS plant expression vector is constructed to transform upland cotton TM-1, the obtained transgenic cotton is further subjected to disease resistance identification, after cotton verticillium wilt V991 is inoculated, the morbidity and disease index of the transgenic cotton are remarkably reduced, the resistance to verticillium wilt is shown, the disease resistance of the plant after the GhCBL3 gene is silenced is enhanced, the GhCBL3 gene participates in verticillium wilt induced anaphylactic reaction, and the GhCBL3 gene and the coding protein thereof participate in a cotton verticillium wilt resistant mechanism.

In conclusion, the inhibition (down regulation) of the expression of the GhCBL3 gene in plants (such as cotton) can obviously improve the disease resistance of the plants (such as the improvement of the verticillium wilt resistance of the cotton). The GhCBL3 protein and the coding gene GhCBL3 thereof can regulate and control the disease resistance (such as verticillium wilt resistance) of plants, and can obviously improve the disease resistance of target plants by reducing the content and/or activity (such as inhibiting, silencing or interfering the expression of the GhCBL3 gene) of the GhCBL3 protein in the target plants. Therefore, the cotton verticillium wilt resistance-related protein GhCBL3 and the coding gene thereof have important theoretical significance and practical value in regulating and controlling plant disease resistance, and the invention has important significance in cultivating transgenic cotton with verticillium wilt resistance.

Drawings

FIG. 1 shows the detection and disease resistance identification of the genetic transformation system of VIGS in example 2. Wherein A in FIG. 1 and B in FIG. 1 (control, TRV: 00) are phenotypic identification charts of successful establishment of TRV-mediated VIGS system in Gossypium hirsutum TM-1; FIG. 1C shows the growth of cotton plants inoculated with verticillium dahliae V9912 days after two weeks of VIGS infection compared to the control (TRV: 00);

FIG. 2 shows the expression level of GhCBL3 gene detected by fluorescent quantitative Real time-PCR.

FIG. 3 is a statistical analysis of the incidence and disease index of 16d and 21d after inoculation with Verticillium dahliae strain V991.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples were processed using Graphpad Prism8 statistical software and the results were expressed as mean ± standard deviation, with P < 0.05 (x) indicating a statistical difference, P < 0.01 (x) indicating a significant statistical difference and P < 0.001 (x) indicating a very significant statistical difference using the T-test method. The quantitative tests in the following examples, unless otherwise specified, were set up in triplicate and the results averaged.

The genetic standard line TM-1 (called upland cotton TM-1 for short) of upland cotton in the following examples was obtained from the Cotton research institute of Chinese academy of agricultural sciences and is described in the following documents: the method comprises the following steps of cultivating a 18 th chromosome segment replacement line of the island cotton in the background of upland cotton and positioning related agronomic characters QTL [ J ] in the academic newspaper of crops, 2013,39 (1): 21-28.

The plant VIGS expression vector PYL156 in the following examples was obtained from the zhou huahong teacher of Nanjing university of agriculture and is a TRV-mediated gene silencing vector described in the following documents: functional verification and bioinformatics analysis of cotton GhDMT3 [ J ] Biotechnology report, 2019,35 (1): 11-16 ], and the biological material can be obtained by the public from the applicant, is only used for repeating the experiment of the invention, and cannot be used for other purposes.

Agrobacterium tumefaciens GV3101 in the following examples was purchased from Kuruida, a Ulumpy advanced technology development area.

Verticillium dahliae (Verticillium dahliae) V991 in the following examples is described in the following documents: xinxin, jiangui Liang, linling, etc. molecular detection method of defoliating cotton verticillium wilt pathogen in soil [ J ] Jiangsu agricultural science, 2011,27 (5): 990-995. The biological material can be obtained from the applicant, is only used for repeating the experiment of the invention, and cannot be used for other purposes.

Example 1 acquisition of Cotton disease resistance-related protein GhCBL3 and encoding Gene thereof

The inventor of the present application has extensively and deeply studied and found a DNA coding sequence through the analysis of the cotton genome sequence, the nucleotide sequence of which is shown as SEQ ID No.2 of the sequence table, and the amino acid sequence of the encoded protein is shown as SEQ ID No.1 of the sequence table.

The nucleotide sequence shown in SEQ ID No.2 is named as GhCBL3 gene, the protein coded by the nucleotide sequence is named as GhCBL3 protein, and the amino acid sequence is shown in SEQ ID No. 1.

The GhCBL3 protein is cotton calcineurin B subunit protein GhCBL3.

Example 2 application of cotton disease resistance related protein GhCBL3 and coding gene thereof

1. Obtaining GhCBL3 gene fragment containing enzyme cutting site

Extracting total RNA of cotton (upland cotton genetic standard system TM-1), carrying out reverse transcription to obtain cDNA, carrying out PCR amplification by using the cDNA as a template and adopting a GhCBL3F/R primer, namely a primer pair consisting of a primer GhCBL3F and a primer GhCBL3R to obtain a PCR amplification product. Wherein the primer sequences are shown as follows:

primer GhCBL3F:5' -CGGAATTCTAGGTTTCGAAGAGTTTGCTC-3’；

Primer GhCBL3R:5' -GGGGTACCTCAGGTATCATCAACTTGAGAGT-3’。

In the primer GhCBL3F and the primer GhCBL3R, restriction enzyme EcoRI and KpnI sequences are underlined respectively, so that the subsequent connection with the plant expression vector PYL156 for cotton genetic transformation is facilitated.

The PCR amplification product (393bp, SEQ ID No. 3) is a GhCBL3 gene fragment containing enzyme cutting sites, namely EcoRI is added at the position of 305bp of the GhCBL3 gene shown in SEQ ID No.2 (681 bp) and the enzyme cutting sites of KpnI restriction enzyme are added at the position of 681 bp. The PCR amplification product (393bp, SEQ ID No. 3) was detected by 1% agarose gel electrophoresis and recovered and purified for use.

2. Construction of Virus-induced Gene silencing (VIGS) recombinant expression vector PYL156-GhCBL3

The PCR amplification product (393bp, SEQ ID No. 3) obtained in step 1 is mixed with

-Blunt Zero Cloning Vector(

-components of the Blunt Zero Cloning Kit,

-Blunt Zero Cloning Kit is a product of the complete gold biotechnology, inc., product No. CB 501-01), the ligation product transforms Escherichia coli DH5 alpha, and the positive transformants identified by PCR with GhCBL3F/R primer are sequenced. And (4) storing the colony with the correct sequence, extracting plasmids, and obtaining a plasmid with the correct sequence, wherein the plasmid is named as pEASY-GhCBL3. The pEASY-GhCBL3 plasmid contains a DNA fragment with a nucleotide sequence of SEQ ID No. 3.

The recombinant vector pEASY-GhCBL3 (i.e., pEASY-GhCBL3 plasmid) is a method using cohesive end cloning, and a DNA fragment with a nucleotide sequence of SEQ ID No.3 in the sequence table is connected

-Blunt Zero Cloning Vector, holding

The plant VIGS expression vector PYL156 (TRV-mediated gene silencing vector) is cut by restriction enzymes EcoRI and KpnI, and the cut skeleton vector is recovered.

The plasmid pEASY-GhCBL3 obtained above was digested with restriction enzymes EcoRI and KpnI, and the DNA fragment 1 (small fragment) after the digestion was recovered.

And connecting the DNA fragment 1 with the enzyme-digested backbone vector to obtain a virus-induced gene silencing (VIGS) recombinant expression vector PYL156-GhCBL3.

The recombinant vector PYL156-GhCBL3 is obtained by replacing a fragment (small fragment) between EcoRI recognition sites and KpnI recognition sites of the PYL156 vector with a DNA fragment shown by SEQ ID No.3 inserted in the forward direction of a sequence table and keeping other nucleotide sequences of the PYL156 vector unchanged.

3. Obtaining of recombinant Agrobacterium

Transforming the plant expression vector recombinant plasmid PYL156-GhCBL3 obtained in the step 2 into agrobacterium tumefaciens GV3101, selecting a single clone to carry out colony PCR screening and identification on the recombinant plasmid PYL156-GhCBL3 by using a GhCBL3F/R primer, and confirming to obtain an agrobacterium positive clone (namely the recombinant agrobacterium transformed with the PYL156-GhCBL 3) which is named as GV3101/PYL156-GhCBL3.

4. Obtaining transgenic cotton

4-1, the obtained recombinant Agrobacterium GV3101/PYL156-GhCBL3 was streaked on LB solid medium containing kanamycin (50 ug/ml) and gentamicin (20 ug/ml) resistance, and cultured at 28 ℃ for 2 days.

4-2, selecting the monoclonal obtained in the step 4-1, inoculating the monoclonal into 5ml LB liquid culture medium containing kanamycin (50 ug/ml) and gentamicin (20 ug/ml) resistance, and rotating 180 min at 28 DEG C ^-1 Culturing for 24h; transferring into 50mL LB liquid culture medium, and transferring at 28 deg.C for 180 min ^-1 Culturing for 12h,4000 rpm ^-1 The cells were collected by centrifugation for 5min and resuspended in an appropriate volume (10 mmol L) ^– ¹ MgCl ₂ ，10mmol L ^–1 2- (N-morpholine) ethanesulfonic acid (MES) and 200. Mu. Mol L ^–1 Acetosyringone) and adjusting OD _600nm A value of 1.5; and standing the re-suspension at room temperature for more than 3h to obtain the recombinant agrobacterium tumefaciens transformation suspension (namely GV3101/PYL156-GhCBL3 bacterial liquid).

The GhPLA 1gene (GenBank accession number KJ 123647) was cloned from the upland cotton genetic standard line TM-1. The amplification is carried out on 994-1414 bp gene fragments in the middle of the ORF of the cotton GhPLA 1gene, and the length of the target amplification fragment is 421bp. The amplified CLA 1gene fragment is connected with a PYL156 vector to construct a recombinant vector PYL156-CLA1. The recombinant vector PYL156-CLA1 is transformed into agrobacterium tumefaciens GV3101 to obtain a GV3101/PYL156-CLA1 bacterial solution.

The pTRV1 bacterial solution is a bacterial solution in which the GV3101/PYL156-GhCBL3 bacterial solution is added to complete gene silencing, and is described in the following documents: establishment and application of TRV virus mediated gene silencing system in cotton, wangxiyu, lukun, cailaiping, xujun, guo Wangzhen, etc. [ J ]. Proc. Crops, 2014,40 (8): 1356-1363.

The GV3101/PYL156-CLA1 bacterial liquid is used as positive control bacterial liquid.

The GV3101/PYL156 bacterial liquid is negative control bacterial liquid, namely PYL-156 transferred empty vector bacterial liquid obtained by transforming the PYL156 vector into Agrobacterium tumefaciens GV 3101.

The experiment was set up with three treatments:

1. and (3) uniformly mixing the pTRV1 bacterial liquid and the GV3101/PYL156-GhCBL3 bacterial liquid according to the volume ratio of 1: ghCBL3.

2. Uniformly mixing pTRV1 bacterial liquid and GV3101/PYL156-CLA1 bacterial liquid according to the volume ratio of 1: ghLA 1.

3. Uniformly mixing pTRV1 bacterial liquid and GV3101/PYL156 bacterial liquid according to the volume ratio of 1: 00.

4-3, sowing the upland cotton TM-1 seeds in nutrient soil, and culturing in the light at 26-28 ℃ for 12h in the dark. Keeping humidity at 60% or above, watering once for 4-5 days, and performing VIGS operation when two leaves are spread and true leaves are not developed.

4-4, infection by VIGS injection: firstly, slightly puncturing the back of a cotyledon by using a syringe needle to cause a micro wound, and injecting a 1:1 uniformly mixed heavy suspension into the wound by using the syringe with the needle to obtain the cotton GhCBL3 gene silencing transformant. After 2 weeks, the phenotype of the cotton treated by different treatments is observed, and the expression condition of the target gene is detected. 30 individuals were treated for each material.

Agrobacteria VIGS specific method reference: gao, X.Shan, L.functional genetic analysis of cotton genes with an agrobacterium-mediated virus-induced gene growing. Methods Mol Biol,2013, 97157-165.

5. Detection of VIGS genetic transformation System

5-1, adopting a upland cotton CLA 1gene (Cloroplasts alterados 1 gene), namely a GhPLA 1gene as a marker gene to carry out VIGS system detection. The gene participates in the development process of chloroplasts, encodes 1-deoxyxylulose 5-phosphate synthase (DXS) protein, is highly conserved in evolution, cotton plants have obvious albino phenotype after GhCLA 1gene silencing, and are easily recognized marker traits, and the result is shown in A in figure 1. After 2 weeks infection with VIGS injection, TRV: the true leaves of the plants in the GhPLA 1-treated group were almost completely whitened, while the leaves of the control (TRV: 00-treated group) were not changed at all (B in FIG. 1). The successful establishment of the TRV-mediated VIGS system in Gossypium hirsutum TM-1 is demonstrated.

5-2, fluorescent quantitative Real time-PCR detection

And extracting the Total RNA of the cotton Plant leaves after 2 weeks infection of VIGS by using a Plant Total RNA Extraction Kit. The expression condition of the silenced GhCBL3 gene after the silencing is detected by fluorescent quantitative Real time-PCR by using cotton UBQ7 as an internal reference gene, and the result is shown in figure 2. Compared with the control of an empty vector (TRV: 00), the expression quantity of the GhCBL3 gene is obviously reduced and the silencing effect is obvious in 1 randomly selected GhCBL3 gene VIGS infected plant.

The fluorescence quantitative PCR was performed using an apparatus of Applied Biosystems StepOne (Applied Biosystems, USA) and a reagent of SYBR Premix Ex Taq ^TM kit (TransGene, beijing). The reverse transcription cDNA was used as template, starting at 150ng, and each treatment was repeated 3 times. The reaction procedure is as follows: denaturation (95 ℃,30 s); (95 ℃,5s, 58 ℃,15s, 72 ℃,31 s) 40 cycles of amplification; dissolution (95 ℃,15s, 60 ℃,1min, 95 ℃,15 s). The fluorescent quantitative Real time-PCR detection primer sequence is as follows:

primer GhUBQ7-RT-F:5 'GAAGGCATTCCACCCTGACCAAC 3';

the primer GhUBQ7-RT-R:5 'CTTGACCTTCTTCTTCTTTGTGCTTG-doped 3'.

Primer GhCBL3-RT-F:5 'TACGATCTCAAGCAGCAAGGTT-3';

the primer GhCBL3-RT-R:5 'ATGTCGCAAAACAAAGGCTTCTC-doped 3'.

6. Inoculation and disease resistance identification for cotton verticillium wilt resistance

Resistance identification is carried out by artificially inoculating Verticillium dahliae (Verticillium dahliae) V991 (also called Verticillium dahliae V991 or Verticillium wilt strain V991 or V991 in the text), and the specific steps are as follows:

the stored verticillium wilt strain V991 is activated on PDA culture medium. Selecting thallus, culturing in Czapek's culture solution at 25 deg.C and 200r/min to obtain 3 to EAnd 5d. Filtering the pathogenic bacteria culture solution with 4 layers of gauze, counting the concentration of pathogenic bacteria with a hemocytometer, and adjusting the final concentration of pathogenic bacteria to 1.0 × 10 with sterilized double distilled water ⁷ Spores per mL, and Tween-20 was added to a final concentration of 0.001% (volume percent) to obtain a spore solution of Verticillium dahliae V991. Inoculating pathogenic bacteria V991 spore liquid to the obtained transformant after 2 weeks of VIGS gene silencing by a root soaking method, investigating and counting the disease condition of verticillium wilt after 12 days of inoculation, and counting the disease index by a 0-4 grade method. 30 individuals were treated for each material. Set 3 biological replicates.

Statistical reference of disease indices: xue-Zhi, zhu Long Pai, zhang Dong, research progress of anti-verticillium wilt mechanism of cotton, academic report of crops, 2012, 38; xu L, zhu L F, zhang X L. Research on resistance mechanism of cotton to Verticillium wilt. Acta Agron Sin,2012, 38.

Disease index = [ (number of diseased plants at each stage × corresponding disease stage)/total number of investigated plants × highest disease stage (4) ] × 100

TRV 2 weeks after infection with VIGS: the onset of verticillium wilt after inoculation of Verticillium dahliae strain V991, 12d in GhCBL3 treated silent and empty vector control (TRV: 00) plants is shown in FIG. 1, C. Through statistical analysis of 3 biological repeated observations, the results of the identification of disease resistance at 16d and 21d after inoculation of verticillium dahliae V991 are shown in fig. 3. The incidence of disease after 16d inoculation of the control plants injected with empty vector (transgenic plants treated with TRV: 00) was 50.55, the average disease index was 34.55, the incidence of disease after 21d inoculation was 72.05, the average disease index was 67.22, while the incidence of disease after GhCBL3 gene silencing (transgenic plants treated with TRV: ghCBL 3) was 36.54, the average disease index was 22.74, and the incidence of disease after 21d inoculation was 49.05, the average disease index was 39.97.

The result shows that the morbidity and disease index of the plant with the GhCBL3 gene silenced are both obviously reduced compared with the control, and the disease resistance of the plant with the GhCBL3 gene silenced is enhanced. The GhCBL3 gene is shown to participate in the allergic reaction induced by the verticillium wilt.

The experimental results fully prove that the expression level of the GhCBL3 gene is obviously reduced after VIGS infection, and the disease resistance of the plant after the GhCBL3 gene is silenced is enhanced. The experimental result shows that the inhibition (down regulation) of the GhCBL3 gene expression in plants (such as cotton) can obviously improve the disease resistance of the plants (such as the improvement of the verticillium wilt resistance of the cotton). The GhCBL3 protein and the coding gene GhCBL3 thereof can regulate and control the disease resistance (such as verticillium wilt resistance) of plants, and can obviously improve the disease resistance of target plants by reducing the content and/or activity (such as inhibiting, silencing or interfering the expression of the GhCBL3 gene) of the GhCBL3 protein in the target plants.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Claims

1. Use of a protein or a substance modulating the activity and/or content of said protein, wherein said use is any one of:

the protein is any one of the following proteins:

b1 Protein of which the amino acid sequence is SEQ ID No. 1;

2. Use according to claim 1, wherein the protein is derived from cotton.

3. Use of a biological material related to a protein as claimed in claim 1 or 2, wherein said use is any of the following:

d1 Use of a biological material related to a protein as defined in claim 1 or 2 for modulating disease resistance in plants;

d2 Use of a biological material related to a protein as defined in claim 1 or 2 for the preparation of a product for modulating disease resistance in plants;

d3 Use of a biological material related to a protein according to claim 1 or 2 for growing disease-resistant plants;

d4 Use of a biological material related to the protein of claim 1 or 2 for the preparation of a product for growing disease-resistant plants;

d5 Use of a biological material related to a protein according to claim 1 or 2 for plant breeding or for improvement of germplasm resources of a plant;

d6 Use of a biomaterial related to the protein of claim 1 or 2 for the control of cotton diseases;

the biological material is any one of the following E1) to E8):

e1 A nucleic acid molecule encoding the protein of claim 1 or 2;

e2 A nucleic acid molecule that inhibits or reduces the expression of a gene encoding a protein according to claim 1 or 2;

e5 A recombinant microorganism containing the nucleic acid molecule according to E1) and/or E2), or a recombinant microorganism containing the expression cassette according to E3), or a recombinant microorganism containing the recombinant vector according to E4);

e7 A transgenic plant tissue containing the nucleic acid molecule described in E1) and/or E2), or a transgenic plant tissue containing the expression cassette described in E3);

e8 A transgenic plant organ containing the nucleic acid molecule according to E1) and/or E2), or a transgenic plant organ containing the expression cassette according to E3).

4. The use according to claim 3, wherein E1) said nucleic acid molecule is any one of:

f1 A DNA molecule with a coding sequence of SEQ ID No.2 or SEQ ID No. 3;

f2 A DNA molecule whose nucleotide sequence is SEQ ID No.2 or SEQ ID No. 3.

5. A method for producing disease-resistant plants, which comprises reducing the content and/or activity of the protein of claim 1 or 2 in a target plant to obtain a disease-resistant plant having higher disease resistance than the target plant.

6. The method according to claim 5, wherein the reduction of the content and/or activity of the protein of claim 1 or 2 in the plant of interest is achieved by reducing the expression level of a gene encoding the protein in the plant of interest.

7. The method of claim 6, wherein the reducing the expression level of the gene encoding the protein in the plant of interest comprises reducing the expression level of the gene encoding the protein of claim 1 or 2 in the genome of the plant of interest using gene mutation, gene knock-out, gene editing, or gene knock-down techniques.

8. The method according to claim 7, wherein the reduction of the expression level of the gene encoding the protein of claim 1 or 2 in the genome of the target plant by gene knock-down is performed by using a virus-induced gene silencing vector constructed by positively integrating the nucleic acid molecule of SEQ ID No.3 into a plasmid vector based on Nicotiana tabacum virus.

9. Use according to any one of claims 1 to 4, and/or a method according to any one of claims 5 to 8, wherein the plant is any one of:

g1 A monocot or dicot;

g2 Malvaceae plants;

g3 Cotton plants;

g4 Cotton.

10. The protein of claim 1 or 2, and/or the biomaterial of claim 3 or 4.