CN115820717B - Culture method of radix sileris transgenic hairy root - Google Patents
Culture method of radix sileris transgenic hairy root Download PDFInfo
- Publication number
- CN115820717B CN115820717B CN202211300524.3A CN202211300524A CN115820717B CN 115820717 B CN115820717 B CN 115820717B CN 202211300524 A CN202211300524 A CN 202211300524A CN 115820717 B CN115820717 B CN 115820717B
- Authority
- CN
- China
- Prior art keywords
- transgenic
- culturing
- root
- culture medium
- hairy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for culturing a wind-proof transgenic hairy root, belonging to the technical field of biology. The culture method of the invention comprises the following steps: s1, sterilizing and culturing the divaricate saposhnikovia seeds to grow aseptic divaricate saposhnikovia seedlings; s2, transferring a plant expression vector pCAMBIA2301 plasmid into a competent cell of agrobacterium rhizogenes K599, and screening and identifying to obtain transgenic agrobacterium rhizogenes K599; s3, activating transgenic agrobacterium rhizogenes K599, performing amplification culture, wherein the OD value is 0.6-1.0, and preparing a transgenic dyeing solution; s4, cutting wounds on the leaves of the explants, placing the leaves in transgenic dyeing liquid for infection, taking out, wiping, inoculating on an MS solid culture medium for co-culture for 1-5 days, taking out, washing, transferring into a solid MS culture medium containing Cef, and transferring into a 1/2 liquid culture medium for culture until hairy roots grow to 2-3 cm. The invention firstly induces the hairy root of the divaricate saposhnikovia root through the K599 agrobacterium containing pCAMBIA2301 plasmid, and establishes a transgenic hairy root system of the divaricate saposhnikovia root.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a culture method of a wind-proof transgenic hairy root.
Background
Radix Saposhnikoviae [ Saposhnikovia divaricata (Trucz. ] is an important medicinal plant in China, and is used as a medicament with the dry roots not bolting, and has the effects of dispelling wind, relieving exterior syndrome, eliminating dampness, relieving pain and relieving spasm. Can be used for treating common cold, headache, rheumatalgia, rubella, pruritus, tetanus, etc. The traditional Chinese medicine records that the regions such as Shandong, henan and Hubei are mainly places for preventing wind, but the current places for preventing wind are mainly regions such as inner Mongolia and northeast three provinces. The main active ingredients of radix Saposhnikoviae include cimicifugae rhizoma glycoside, cimicifugae rhizoma, 5-O-methyl vitamin A-Mirabilide, chromones such as Helicoverpa, polysaccharide, volatile oil, etc. The chromone component contained in the radix sileris is a main material foundation for playing a role of medicine effect and is also a main secondary metabolite of the radix sileris. In recent years, it has been found that limited natural resources are difficult to meet the increasing demands of medicine and research and development, and the long-term excavation of wild resources inevitably breaks ecological balance, resulting in exhaustion of natural resources. The plant tissue culture technology has fast and stable propagation speed and is applied to the protection of medicinal plant resources with unique advantages. Wherein hairy root and adventitious root culture technique is an important way for obtaining secondary metabolite of medicinal plant.
Therefore, the method for culturing the hairy roots of the divaricate saposhnikovia root transgenes is provided, and the method becomes a problem to be solved urgently by the person skilled in the art.
Disclosure of Invention
The invention aims to provide a method for culturing a windproof transgenic hairy root, which uses K599 agrobacterium containing an expression vector pCAMBIA2301 to infect a windproof aseptic seedling and induce the windproof aseptic seedling to obtain the windproof hairy root, wherein the obtained windproof hairy root has higher biomass and chromone content.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
the invention provides a method for culturing a wind-proof transgenic hairy root, which comprises the following steps:
s1, preparing an explant: sterilizing the divaricate saposhnikovia seeds, inoculating the divaricate saposhnikovia seeds into a culture medium, and culturing the divaricate saposhnikovia seeds into divaricate saposhnikovia aseptic seedlings to obtain explants;
s2, preparing agrobacterium rhizogenes: transferring the plant expression vector pCAMBIA2301 into a competent cell of agrobacterium rhizogenes K599, and then screening and identifying to obtain transgenic agrobacterium rhizogenes K599;
s3, preparing a transgenic dye-dip solution: the transgenic agrobacterium rhizogenes K599 of the S2 is activated and then subjected to expansion culture, and when the OD value is 0.6-1.0, the preparation of the transgenic dyeing solution is completed;
s4, induction of hairy roots of radix sileris
Cutting wounds on leaves of an explant, placing the cut wounds in prepared transgenic dye invasion solution, taking out the cut wounds after infection, wiping the cut wounds, inoculating the cut wounds on an MS solid culture medium for co-culture for 1-5 days, then transferring the explant into the solid MS culture medium containing Cef after washing the explant with sterile water to remove mixed bacteria, sequentially growing white hairy roots at the wound positions of the explant, cutting the hairy roots to 2-3 cm from the wound positions of the leaves, placing the cut roots into a liquid culture medium, and culturing in a shaking table and shading subculture.
In some embodiments of the invention, the medium in S1 is MS solid medium;
preferably, the sterilized seeds of divaricate saposhnikovia root are cultured in a culture medium for 20 to 40 days to grow aseptic seedlings of divaricate saposhnikovia root.
In some embodiments of the invention, in S2, the plant expression vector pCAMBIA2301 plasmid is transferred into Agrobacterium rhizogenes K599 competent cells by freeze thawing;
preferably, after transferring the plant expression vector pCAMBIA2301 plasmid into Agrobacterium rhizogenes K599 competent cells, positive selection is performed on YEB solid medium containing kanamycin and streptomycin resistance, monoclonal is selected and plasmid DNA is extracted, and primers are: f-2301AGAACCGACGACTCGTCCGT, R-2301TCACACGTGGTGGTGGTGGT, and obtaining transgenic agrobacterium rhizogenes K599 through PCR identification;
preferably, the PCR reaction procedure is: pre-denaturation at 95℃for 5min, 30 cycles of denaturation at 95℃for 30s, annealing at 60℃for 30s, and extension at 72℃for 2min were performed, and extension at 72℃for 10min after the cycle was completed.
In some embodiments of the invention, in S3, transgenic Agrobacterium rhizogenes K599 is inoculated into a YEB liquid culture medium containing kanamycin and streptomycin resistance, and cultured for 2-3d under the conditions of a shaking table of 28+/-2 ℃ to obtain activated transgenic Agrobacterium rhizogenes K599;
preferably, the activated transgenic Agrobacterium rhizogenes K599 is scraped off and resuspended in 1/2MS medium to an OD of 0.6-1.0, and the preparation of the transgenic invasive solution is completed.
In some embodiments of the present invention, the YEB solid medium has a kanamycin content of 40-60 mg/L and a streptomycin content of 40-60 mg/L; preferably, the kanamycin content is 50mg/L, and the streptomycin content is 50mg/L;
in the YEB liquid culture medium, the kanamycin content is 40-60 mg/L, and the streptomycin content is 40-60 mg/L; preferably, the kanamycin content is 50mg/L and the streptomycin content is 50mg/L.
In some embodiments of the invention, in S4, the time of infection of the explant in the transgenic invasive solution is 5-20 min, preferably 10min;
or/and the solid MS culture medium containing the Cef, wherein the content of the Cef is 40-60 mg/L, preferably 50mg/L.
In some embodiments of the invention, in S4, the liquid medium comprises 1/2MS liquid medium, and B5 liquid medium; preferably 1/2MS liquid medium.
In some embodiments of the invention, in S4, the medium is replaced every 7 days during the secondary culture, and the culture is carried out for 14-35 days; the culture conditions were 24.+ -. 2 ℃ and 130r/min.
In some embodiments of the invention, the PCR identification of transgenic hairy roots is also included, and the specific steps are as follows: picking the induced hairy roots, extracting DNA, and carrying out PCR detection to identify genes including rolB and GUS genes.
In some embodiments of the invention, the primers used for PCR detection are:
rolB-F：GCCAGCATTTTTGGTGAACT
rolB-R：CTGGCCCATCGTTCTAAAAA
GUS-F：ACCGGTGTCGCAATATCTTC
GUS-R：TCCAGGATGAGCGATTTACC
compared with the prior art, the invention has the following beneficial effects:
the invention has scientific design and ingenious conception, and the windproof hairy root system is established by inducing the windproof hairy root by the K599 agrobacterium containing the pCAMBIA2301 plasmid for the first time. The empty vector gene was shown to have been transferred into hairy roots by PCR detection.
The wind-proof transgenic hairy root cultivated by the method has good growth, the biomass of the wind-proof transgenic hairy root is increased by about 21 times when being cultivated for 35 days, and the wind-proof transgenic hairy root has higher chromone content. The establishment of the genetic transformation system of the radix sileris transgenic hairy roots provides support for the subsequent exploration of functional genes of the radix sileris hairy roots.
Drawings
FIG. 1 is a diagram showing the process of producing the wind-proof transgenic hairy root of the present invention; wherein a is the culture of aseptic seedlings of radix sileris, b and c are the conditions of inducing radix sileris leaves to generate hairy roots by infection of agrobacterium K599, d is the growth condition of hairy roots in a solid culture medium, e and f are the growth condition of hairy roots in a 1/2MS liquid culture medium, g is the hairy roots (fresh) cultured in the liquid culture medium, and h is the hairy roots after drying.
FIG. 2 is a diagram showing growth of hairy roots of three strains according to the present invention, wherein a is ZA strain, b is ZB strain, and c is ZC strain.
FIG. 3 is a graph showing the results of the roller gene detection of three strains according to the present invention, wherein 1 is ck Falstonia saposhnikovia aseptic seedlings, 2 is ZA strain, 3 is ZB strain, and 4 is ZC strain.
FIG. 4 is a graph showing the results of GUS gene detection of three strains according to the present invention, wherein 1 is ck Falstonia saposhnikovia aseptic seedlings, 2 is ZA strain, 3 is ZB strain, and 4 is ZC strain.
FIG. 5 is a graph of the growth of wind-resistant transgenic hairy roots in various media.
FIG. 6 is a graph showing the results of the growth of the wind-resistant transgenic hairy roots in different culture media.
FIG. 7 is a graph showing the total amount of the wind-resistant transgenic hairy root chromones in different culture mediums.
FIG. 8 is a graph showing the results of the growth of the wind-resistant transgenic hairy roots of different strains.
FIG. 9 is a graph showing the total amount of the wind-resistant transgenic hairy root chromones of different strains.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The windproof aseptic seedlings in the embodiment of the invention are cultivated in a Jilin agricultural university Chinese herbal medicine college laboratory; the plant expression vector pCAMBIA2301 and agrobacterium K599 are purchased from vast plasmid platform and Beijing Hua Vietnam biotechnology Co., ltd respectively; plant DNA extraction kits were purchased from bioengineering, inc.
A culture method of a wind-proof transgenic hairy root comprises the following steps:
s1, preparing an explant: sterilizing the divaricate saposhnikovia seeds, inoculating the divaricate saposhnikovia seeds into an MS solid culture medium, and culturing for 20-40 days to obtain divaricate saposhnikovia aseptic seedlings, thereby obtaining explants; preferably, the divaricate saposhnikovia seeds are soaked for 5-12 hours in advance, then disinfected and inoculated into MS solid culture medium.
S2, preparing agrobacterium rhizogenes: transferring the plant expression vector pCAMBIA2301 into a competent cell of agrobacterium rhizogenes K599, and then screening and identifying to obtain transgenic agrobacterium rhizogenes K599;
s3, preparing a transgenic dye-dip solution: the transgenic agrobacterium rhizogenes K599 of the S2 is activated and then subjected to expansion culture, and when the OD value is 0.6-1.0, the preparation of the transgenic dyeing solution is completed;
s4, induction of hairy roots of radix sileris
Cutting wounds on leaves of the explant, placing the cut wounds in prepared transgenic dyeing liquid, infecting for 5-20 min, preferably 10min, taking out, wiping, inoculating on an MS solid culture medium, co-culturing for 1-5 days, then washing the explant with sterile water, transferring the explant into the solid MS culture medium containing Cef to remove mixed bacteria, sequentially growing white hairy roots at the wounds of the explant, cutting the hairy roots from the leaves until the hairy roots grow to 2-3 cm, placing the cut roots into a liquid culture medium, and culturing by shaking table and shading.
In S2, transferring the plant expression vector pCAMBIA2301 plasmid into agrobacterium rhizogenes K599 competent cells by a freeze thawing method, performing positive screening on a YEB solid culture medium containing kanamycin and streptomycin resistance, picking up monoclonal and extracting plasmid DNA, and obtaining transgenic agrobacterium rhizogenes K599 by PCR identification. In the YEB solid culture medium, the kanamycin content is 40-60 mg/L, and the streptomycin content is 40-60 mg/L; preferably, the kanamycin content is 50mg/L and the streptomycin content is 50mg/L.
S3, inoculating transgenic agrobacterium rhizogenes K599 into a YEB liquid culture medium containing kanamycin and streptomycin resistance, and culturing for 2-3d at the temperature of 28+/-2 ℃ on a shaking table to obtain activated transgenic agrobacterium rhizogenes K599;
preferably, the activated transgenic Agrobacterium rhizogenes K599 is scraped off and resuspended in 1/2MS medium to an OD of 0.6-1.0, and the preparation of the transgenic invasive solution is completed.
In the YEB liquid culture medium, the kanamycin content is 40-60 mg/L, and the streptomycin content is 40-60 mg/L; preferably, the kanamycin content is 50mg/L and the streptomycin content is 50mg/L.
The content of Cef in the solid MS culture medium containing Cef is 40-60 mg/L, preferably 50mg/L.
In S4, the liquid culture medium comprises 1/2MS liquid culture medium, MS liquid culture medium and B5 liquid culture medium; preferably 1/2MS liquid medium.
S4, replacing a culture medium every 7 days during secondary culture, and co-culturing for 14-35 days; the culture conditions were 24.+ -. 2 ℃ and 130r/min.
The culture method also comprises PCR identification of the transgenic hairy root, and comprises the following specific steps: picking the induced hairy roots, extracting DNA, and carrying out PCR detection to identify genes including rolB and GUS genes.
In some embodiments of the invention, the primers used for PCR detection are:
rolB-F：GCCAGCATTTTTGGTGAACT
rolB-R：CTGGCCCATCGTTCTAAAAA
GUS-F：ACCGGTGTCGCAATATCTTC
GUS-R：TCCAGGATGAGCGATTTACC。
in the S2 of the embodiment of the invention, monoclonal is selected and plasmid DNA is extracted, positive clone is obtained through PCR identification, and the primers are as follows: f-2301AGAACCGACGACTCGTCCGT, R-2301TCACACGTGGTGGTGGTGGT.
The PCR reaction procedure was: pre-denaturation at 95℃for 5min, 30 cycles of denaturation at 95℃for 30s, annealing at 60℃for 30s, and extension at 72℃for 2min were performed, and extension at 72℃for 10min after the cycle was completed.
Example 1
The embodiment discloses a method for culturing a wind-proof transgenic hairy root, which specifically comprises the following steps:
s1, preparing an explant: soaking radix Saposhnikoviae seeds for 12 hr in advance, placing proper amount of seeds in a beaker on an ultra-clean workbench, adding 75% ethanol for sterilization for 30s, pouring ethanol into a waste liquid tank, adding sterile water, shaking and cleaning for 2min, and pouring sterile water into the waste liquid tank. Pouring 10% NaClO solution into beaker, sterilizing for 30min, continuously shaking, discarding NaClO waste liquid, adding sterile water, cleaning for 3-4min, and repeating for 3 times. The seeds were placed on filter paper to absorb water and inoculated in MS solid medium, after 1 month they were grown into aseptic seedlings of Falstonia saposhnikoviae (as shown in FIG. 1 a), and explants were obtained.
S2, preparing agrobacterium rhizogenes:
the plant expression vector pCAMBIA2301 plasmid is transferred into agrobacterium rhizogenes K599 competent cells by a freeze thawing method, positive screening is carried out on a YEB solid culture medium containing 50mg/L kanamycin and 50mg/L streptomycin resistance, monoclonal is selected, plasmid DNA is extracted, and positive clone is obtained through PCR identification.
S3, preparing a transgenic dye-dip solution: positive clones were inoculated into YEB liquid medium containing 50mg/L kanamycin and 50mg/L streptomycin resistance and cultured for 3d at 160r/min on a shaker at 28 ℃; the activated agrobacterium is scraped off and resuspended in 1/2MS medium to an OD of 0.7, and the preparation of the transgenic invasive solution is completed.
S4, induction of hairy roots of radix sileris
Cutting out wounds on leaves of the divaricate saposhnikovia root aseptic seedlings, placing the cut wounds in prepared K599 bacterial liquid, carrying out infection for 10min, taking out the infected explants, drying the explants on filter paper, inoculating the explants on an MS solid culture medium, carrying out co-culture for 3 days, washing the explants out excessive agrobacterium in sterile water after 3 days, transferring the explants into the solid MS culture medium containing 50mg/L Cef to remove mixed bacteria, continuously growing white hairy roots at the divaricate saposhnikovia root wound for about two weeks, cutting the hairy roots from the leaf wound until the hairy roots grow to about 2-3 cm, placing the cut hairy roots into a 150ml conical flask containing liquid 1/2MS culture medium (shown in fig. 1 b-f), placing the cut explants on a shaking table at 25 ℃ and carrying out dark culture for 28 days, and replacing the culture medium every 7 days.
Three vigorous-growing hairy root lines, designated ZA, ZB and ZC lines, were selected after 35 d.
From morphological observation, ZA strain has long hairy root, less branches, thick and soft (as shown in FIG. 2 a), ZB strain has long, less branches, thick and hard (as shown in FIG. 2 b), ZC strain has short hairy root, thin and many branches, and hard (as shown in FIG. 2 c).
S5, identifying transgenic hairy roots
The Ri plasmid in the agrobacterium K599 contains the rolB gene, and the plant expression vector pCAMBIA2301 contains the GUS reporter gene. To verify whether the related genes of plant expression vector pCAMBIA2301 and agrobacterium K599 are integrated into the hairy roots of Fangfeng, the hairy roots of Fangfeng of three strains ZA, ZB and ZC with better growth vigor are selected, DNA is extracted and PCR detection is carried out by using specific primers (shown in Table 1), and the root DNA of Fangfeng is taken as negative control, and the rolB and GUS genes are detected by using specific primers respectively.
20. Mu. LPCR reaction system: dd H 2 O7. Mu.L, 10. Mu.L of Premix Taq enzyme, 1. Mu.L of each of 10. Mu. Mol/L upstream and downstream primers, and 1. Mu.L of template DNA. The PCR reaction procedure was 94℃for 5min, followed by 30 cycles of 94℃for 45s, 55℃for 45s, and 72℃for 90s, and 10min after the cycle was completed. The PCR products were detected by 1% agarose electrophoresis, with the target band being the positive root.
TABLE 1 primer sequences
As shown in FIG. 3 and FIG. 4, the transgenic hairy roots of the three strains can amplify the rolB and GUS genes, but the negative control is not detected, which indicates that the rolB and GUS genes are integrated into the radix sileris hairy roots, and the radix sileris transgenic hairy roots are successfully induced.
Example 2
The embodiment discloses a screening test of different liquid culture mediums in step S4, specifically:
clamping 1g of radix sileris hairy roots, respectively placing the roots in MS, 1/2MS and B5 liquid culture mediums, placing the liquid culture mediums in a shaking table at 25 ℃ and 130r for dark culture, replacing the culture mediums every 7 days, sampling and weighing, and culturing for 35 days in total, wherein 3 culture mediums are arranged in parallel. After the cultivation is finished, the hairy roots in the culture medium are dried by filter paper, and are put into an oven for drying at 60 ℃, and the dry weight of the hairy roots and the total content of four chromones of cimicifuga rhizome glycoside, 5-O-methyl vitamin-amiloride glycoside and helmholoside are respectively measured.
The content of the four chromones was determined by the method described in the reference "Ledebouriella sessilifolia chromone microwave-assisted extraction and content dynamic Change study" (Han Zhongming et al. Chinese herbal medicine, 2011,34 (3): 4.):
1. preparation of test solution: grinding the dried hairy roots into fine powder by using a mortar, sieving the fine powder by a 30-mesh sieve, taking 0.5g of sample, precisely weighing the sample, and mixing the sample with the powder according to a feed liquid ratio of 1:30, 15ml of 70% ethanol is added for extraction, and the temperature is 90 ℃ for 3min of microwave extraction. The extract was filtered through a 0.45um filter membrane for further use.
Hplc assay chromatographic conditions: column Diamond C 18 (4.6 mm. Times.200 mm,5 μm); column temperature is 30 ℃; wavelength 254nm; methanol-water gradient elution: methanol: 0-15min:21% -45%;15-25min:45% -70%; and calculating the total chromone content according to a standard curve, wherein the flow rate is 1mL/min and the flow rate is 70-100% in 25-30 min.
The results are shown in FIGS. 4-7:
hairy roots cultured in 1/2MS medium are optimal in biomass and total content of four chromones. Wherein, on biomass, the hairy roots cultured by 1/2MS are 1.25 times of the hairy roots in the MS culture medium and 2.24 times of the hairy roots in the B5 culture medium; from the quality point of view, the hairy root chromone content of 1/2MS culture is 2.05 times of that of MS and 1.66 times of that of B5, so that 1/2MS is most suitable for the growth of the hairy root of divaricate saposhnikovia root. From the growth curve screened by the culture medium, the growth of hairy roots is slower when divided into three stages 0-14d, faster when 14-28d, and the growth speed starts to decrease after 28 d.
Example 3
The difference of the growth amount and the quality of the hairy roots of different strains is examined in the embodiment, and the results are shown in figures 8-9.
The results show that:
1. in terms of biomass, ZC has a biomass of 6.7g, 2.06 times ZA, and 1.99 times ZB.
2. The total content of the four chromones of ZB is the highest, namely 5.49mg/g; 1.03 times ZA and 1.99 times ZC.
ZB strain was selected as the subsequent culture strain because of the highest chromone content of ZB.
Example 4
The embodiment discloses a method for culturing a wind-proof transgenic hairy root, which specifically comprises the following steps:
s1, preparing an explant: soaking radix Saposhnikoviae seeds for 5 hours in advance, placing proper amount of seeds in a beaker in an ultra-clean workbench, adding 75% ethanol for sterilization for 30s, pouring the ethanol into a waste liquid tank, adding sterile water for shaking and cleaning for 2min, and pouring the sterile water into the waste liquid tank. Pouring 10% NaClO solution into beaker, sterilizing for 30min, continuously shaking, discarding NaClO waste liquid, adding sterile water, cleaning for 3-4min, and repeating for 3 times. The seeds are placed in filter paper to absorb water, inoculated in MS solid culture medium, and grown into aseptic seedlings of divaricate saposhnikovia root after 40 days, thus obtaining the explant.
S2, preparing agrobacterium rhizogenes:
the plant expression vector pCAMBIA2301 plasmid is transferred into agrobacterium rhizogenes K599 competent cells by a freeze thawing method, positive screening is carried out on a YEB solid culture medium containing 40mg/L kanamycin and 40mg/L streptomycin resistance, monoclonal is selected, plasmid DNA is extracted, and positive clone is obtained through PCR identification.
S3, preparing a transgenic dye-dip solution: positive clones were inoculated into YEB liquid medium containing 40mg/L kanamycin and 40mg/L streptomycin resistance and cultured at 160r/min for 2d at shaker 28 ℃; the activated agrobacterium is scraped off and resuspended in 1/2MS medium to an OD of 1.0, and the preparation of the transgenic invasive solution is completed.
S4, induction of hairy roots of radix sileris
Cutting wounds on leaves of the divaricate saposhnikovia root aseptic seedlings, placing the cut wounds in prepared K599 bacterial liquid, infecting for 5min, taking out the infected explants, wiping the infected explants on filter paper, inoculating the infected explants on an MS solid culture medium, co-culturing for 5 days, washing the explants with excess agrobacterium in sterile water after 5 days, transferring the explants into the solid MS culture medium containing 40mg/L Cef to remove mixed bacteria, continuously growing white hairy roots at the divaricate saposhnikovia root wound for about two weeks, cutting off the hairy roots from the leaf wound until the hairy roots grow to about 2-3 cm, placing the cut explants into a 150ml conical flask containing liquid 1/2MS culture medium, placing the cut explants on a shaking table at 25 ℃ for 28 days, and replacing the culture medium once every 7 days.
S5, identifying transgenic hairy roots
The identification of transgenic hairy roots was performed as in example 1, and the results showed that the rolB and GUS genes had been integrated into the hairy roots of Ledebouriella, successfully inducing the transgenic hairy roots of Ledebouriella.
Example 5
The embodiment discloses a method for culturing a wind-proof transgenic hairy root, which specifically comprises the following steps:
s1, preparing an explant: soaking radix Saposhnikoviae seeds for 10 hr in advance, placing proper amount of seeds in a beaker on an ultra-clean workbench, adding 75% ethanol for sterilization for 30s, pouring ethanol into a waste liquid tank, adding sterile water, shaking and cleaning for 2min, and pouring sterile water into the waste liquid tank. Pouring 10wt.% NaClO solution into beaker, sterilizing for 30min, continuously shaking, discarding NaClO waste liquid, adding sterile water, cleaning for 3-4min, and repeating for 3 times. The seeds are placed in filter paper to absorb water, inoculated in MS solid culture medium, and grown into aseptic seedlings of divaricate saposhnikovia root after 30 days, thus obtaining the explant.
S2, preparing agrobacterium rhizogenes:
the plant expression vector pCAMBIA2301 plasmid is transferred into agrobacterium rhizogenes K599 competent cells by a freeze thawing method, positive screening is carried out on a YEB solid culture medium containing 60mg/L kanamycin and 60mg/L streptomycin resistance, monoclonal is selected, plasmid DNA is extracted, and positive clone is obtained through PCR identification.
S3, preparing a transgenic dye-dip solution: positive clones were inoculated into YEB liquid medium containing 60mg/L kanamycin and 60mg/L streptomycin resistance and cultured at 160r/min for 2d at shaker 28 ℃; the activated agrobacterium is scraped off and resuspended in 1/2MS medium to an OD of 0.6, and the preparation of the transgenic invasive solution is completed.
S4, induction of hairy roots of radix sileris
Cutting wounds on leaves of the divaricate saposhnikovia root aseptic seedlings, placing the cut wounds in prepared K599 bacterial liquid, infecting for 20min, taking out the infected explants, wiping the infected explants on filter paper, inoculating the infected explants on an MS solid culture medium, co-culturing for 1 day, washing the explants with excess agrobacterium in sterile water after 1 day, transferring the explants into the solid MS culture medium containing 60mg/L Cef to remove mixed bacteria, continuously growing white hairy roots at the divaricate saposhnikovia root wound for about two weeks, cutting off the hairy roots from the leaf wound until the hairy roots grow to about 2-3 cm, placing the cut explants into a 150ml conical flask containing the liquid 1/2MS culture medium, placing the cut explants into a shaking table at 25 ℃ for 28 days, and replacing the culture medium once every 7 days.
S5, identifying transgenic hairy roots
The identification of transgenic hairy roots was performed as in example 1, and the results showed that the rolB and GUS genes had been integrated into the hairy roots of Ledebouriella, successfully inducing the transgenic hairy roots of Ledebouriella.
The embodiments described above are some, but not all embodiments of the invention. The detailed description of the embodiments of the invention is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Claims (18)
1. A method for culturing a wind-proof transgenic hairy root, which is characterized by comprising the following steps:
s1, preparing an explant: sterilizing the divaricate saposhnikovia seeds, inoculating the divaricate saposhnikovia seeds into a culture medium, and culturing the divaricate saposhnikovia seeds into divaricate saposhnikovia aseptic seedlings to obtain explants;
s2, preparing agrobacterium rhizogenes: transferring the plant expression vector pCAMBIA2301 into a competent cell of agrobacterium rhizogenes K599, and then screening and identifying to obtain transgenic agrobacterium rhizogenes K599;
s3, preparing a transgenic dye-dip solution: the transgenic agrobacterium rhizogenes K599 of the S2 is activated and then subjected to expansion culture, and when the OD value is 0.6-1.0, the preparation of the transgenic dyeing solution is completed;
s4, induction of the hairy roots of the divaricate saposhnikovia root:
cutting wounds on leaves of an explant, placing the cut wounds in prepared transgenic dye invasion liquid, taking out the cut wounds after infection, wiping the cut wounds, inoculating the cut wounds on an MS solid culture medium for co-culture for 1-5 days, then transferring the explant into the solid MS culture medium containing Cef after washing the explant with sterile water to remove mixed bacteria, sequentially growing white hairy roots at the wound positions of the explant until the hairy roots grow to 2-3 cm, cutting the hairy roots from the wound positions of the leaves, placing the cut roots into a liquid culture medium, and culturing in a shaking table and shading subculture mode.
2. The method for culturing a transgenic hairy root of Ledebouriella root according to claim 1, wherein the culture medium in S1 is MS solid culture medium.
3. The method for culturing the transgenic hairy roots of radix sileris according to claim 1, wherein the sterilized seeds of radix sileris in S1 are cultured in a culture medium for 20-40 days to grow aseptic seedlings of radix sileris.
4. The method for culturing transgenic hairy roots of Ledebouriella sessilifolia according to claim 1, wherein in S2, the plant expression vector pCAMBIA2301 plasmid is transferred into competent cells of Agrobacterium rhizogenes K599 by freeze thawing.
5. The method for culturing the transgenic hairy roots of divaricate saposhnikovia root as claimed in claim 4, wherein after transferring the plasmid pCAMBIA2301 as a plant expression vector into competent cells of agrobacterium rhizogenes K599, positive screening is carried out on a YEB solid culture medium containing kanamycin and streptomycin resistance, monoclonal is selected and plasmid DNA is extracted, and the primers are: f-2301AGAACCGACGACTCGTCCGT and R-2301TCACACGTGGTGGTGGTGGT, and obtaining transgenic agrobacterium rhizogenes K599 through PCR identification.
6. The method for culturing a transgenic hairy root of Ledebouriella seseloides according to claim 5, wherein the PCR reaction procedure is as follows: pre-denaturation at 95℃for 5min, 30 cycles of denaturation at 95℃for 30s, annealing at 60℃for 30s, and extension at 72℃for 2min were performed, and extension at 72℃for 10min after the cycle was completed.
7. The method for culturing a transgenic hairy root of Ledebouriella root according to claim 5, wherein in S3, the transgenic Agrobacterium rhizogenes K599 is inoculated into a YEB liquid medium containing kanamycin and streptomycin resistance, and cultured for 2-3d under the conditions of a shaker 28+ -2 ℃ to obtain the activated transgenic Agrobacterium rhizogenes K599.
8. The method for culturing a transgenic hairy root against wind according to claim 7, wherein in S3, the activated transgenic Agrobacterium rhizogenes K599 is scraped off and resuspended in 1/2MS medium to have an OD of 0.6-1.0, and the preparation of the transgenic invasive solution is completed.
9. The method for culturing the transgenic hairy roots of divaricate saposhnikovia root of claim 7, wherein the YEB solid culture medium has a kanamycin content of 40-60 mg/L and a streptomycin content of 40-60 mg/L; in the YEB liquid culture medium, the kanamycin content is 40-60 mg/L, and the streptomycin content is 40-60 mg/L.
10. The method for culturing a transgenic hairy root of Ledebouriella root according to claim 7, wherein the YEB solid medium has a kanamycin content of 50mg/L and a streptomycin content of 50mg/L.
11. The method for culturing transgenic hairy roots of Ledebouriella root according to claim 7, wherein the YEB liquid medium has a kanamycin content of 50mg/L and a streptomycin content of 50mg/L.
12. The method for culturing the transgenic hairy roots of divaricate saposhnikovia root according to claim 1, wherein in S4, the infection time of the explant in the transgenic dyeing solution is 5-20 min;
or/and the content of Cef in the solid MS culture medium containing Cef is 40-60 mg/L.
13. The method for culturing a transgenic hairy root against wind according to claim 12, wherein in S4, the infection time of the explant in the transgenic invasion solution is 10min;
or/and the solid MS culture medium containing the Cef, wherein the content of the Cef is 50mg/L.
14. The method for culturing a transgenic hairy root against wind according to claim 1, wherein in S4, the liquid medium comprises 1/2MS liquid medium, MS liquid medium and B5 liquid medium.
15. The method for culturing a transgenic hairy root against wind according to claim 14, wherein in S4, the liquid medium is 1/2MS liquid medium.
16. The method for culturing the transgenic hairy roots of radix sileris according to claim 1, wherein in S4, the culture medium is replaced every 7 days for subculture, and the culture medium is co-cultured for 14-35 days; the culture conditions were 24.+ -. 2 ℃ and 130r/min.
17. The method for culturing a transgenic hairy root of Ledebouriella root according to any one of claims 1 to 15, further comprising the step of PCR identification of the transgenic hairy root, comprising the steps of: picking the induced hairy roots, extracting DNA, and carrying out PCR detection to identify genes including rolB and GUS genes.
18. The method for culturing a transgenic hairy root of divaricate saposhnikovia root of claim 17, wherein the primers used for PCR detection are:
rolB-F：GCCAGCATTTTTGGTGAACT
rolB-R：CTGGCCCATCGTTCTAAAAA
GUS-F：ACCGGTGTCGCAATATCTTC
GUS-R：TCCAGGATGAGCGATTTACC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211300524.3A CN115820717B (en) | 2022-10-24 | 2022-10-24 | Culture method of radix sileris transgenic hairy root |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211300524.3A CN115820717B (en) | 2022-10-24 | 2022-10-24 | Culture method of radix sileris transgenic hairy root |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115820717A CN115820717A (en) | 2023-03-21 |
| CN115820717B true CN115820717B (en) | 2023-09-26 |
Family
ID=85525304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211300524.3A Active CN115820717B (en) | 2022-10-24 | 2022-10-24 | Culture method of radix sileris transgenic hairy root |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820717B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1656881A (en) * | 2005-03-21 | 2005-08-24 | 中国科学院成都生物研究所 | Gentic transforming method of perennial rye grass |
| CN101565460A (en) * | 2008-04-21 | 2009-10-28 | 中国农业科学院生物技术研究所 | Populus euphratica DREB2 transcription factor cDNA sequence, expression carrier containing same and application thereof |
| WO2017127524A1 (en) * | 2016-01-19 | 2017-07-27 | Ohio State Innovation Foundation | Low inoculum, long co-culture agrobacterium-mediated transformation of plants |
| CN110669786A (en) * | 2019-11-13 | 2020-01-10 | 内蒙古农业大学 | Method for establishing and optimizing agrobacterium rhizogenes-mediated genetic transformation system of middle caragana hairy roots |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10967031B2 (en) * | 2010-12-28 | 2021-04-06 | Kamedis Ltd. | Synergistic herbal compositions with prebiotic properties for treatment of skin infections, allergies and inflammation |
| US9758788B2 (en) * | 2014-08-08 | 2017-09-12 | Naprogenix, Inc. | Mutagenesis of plants for overproduction of selective estrogen receptor modulators |
-
2022
- 2022-10-24 CN CN202211300524.3A patent/CN115820717B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1656881A (en) * | 2005-03-21 | 2005-08-24 | 中国科学院成都生物研究所 | Gentic transforming method of perennial rye grass |
| CN101565460A (en) * | 2008-04-21 | 2009-10-28 | 中国农业科学院生物技术研究所 | Populus euphratica DREB2 transcription factor cDNA sequence, expression carrier containing same and application thereof |
| WO2017127524A1 (en) * | 2016-01-19 | 2017-07-27 | Ohio State Innovation Foundation | Low inoculum, long co-culture agrobacterium-mediated transformation of plants |
| CN110669786A (en) * | 2019-11-13 | 2020-01-10 | 内蒙古农业大学 | Method for establishing and optimizing agrobacterium rhizogenes-mediated genetic transformation system of middle caragana hairy roots |
Non-Patent Citations (1)
| Title |
|---|
| 防风根腐病拮抗真菌的筛选鉴定及生防作用研究;韩忠明;中国生物防治学报;第38卷(第5期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115820717A (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101768604B (en) | Efficient and rapid sugarcane genetically modified method | |
| Du et al. | Transgenic hairy roots of Tetrastigma hemsleyanum: induction, propagation, genetic characteristics and medicinal components | |
| CN104745672A (en) | Method for rapidly identifying black shank resistance of tobaccos | |
| Yao et al. | Hairy root induction and polysaccharide production of medicinal plant Callerya speciosa Champ. | |
| CN115537425A (en) | Tissue culture method for induction and proliferation of rhizoma atractylodis lanceae hairy roots | |
| CN103444524B (en) | Method for quickly building genetic transformation regeneration system of grapes | |
| CN102321664B (en) | Method for inducing production of tripterygium wilfordii hairy root by agrobacterium rhizogenes | |
| CN115820717B (en) | Culture method of radix sileris transgenic hairy root | |
| CN105907733B (en) | A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application | |
| CN102754594B (en) | Preparation and cultivation method of hairy roots of tongkat ali | |
| CN104845929B (en) | Tuniclike psammosilene root plant cell suspension cultures and its method for building up | |
| CN103740751B (en) | A kind of agriculture bacillus mediated sugarcane genetically modified method | |
| CN106613970B (en) | The quick breeding by group culture method of sealwort leaf elegant jessamine | |
| CN103026966B (en) | Method for identifying tomato yellow leaf curl virus resistance by utilizing detached leaf | |
| CN107760708B (en) | The method for improving Jatropha curcus fruit yield by being overexpressed JcARF19 gene | |
| CN112322653B (en) | Agrobacterium-mediated genetic transformation method for Maohua chrysanthemum | |
| CN105695504B (en) | A kind of method that mediated by agriculture bacillus infects the Mongolian willow of conversion | |
| Novikova et al. | Agrobacterium rhizogenes-transformed roots of Astragalus membranaceus (Fisch. Ex Link) Bunge as a source of valuable secondary metabolites | |
| CN103233039A (en) | Agrobacterium tumefaciens-mediated rice seedling gene transformation method | |
| CN109055422A (en) | Application of the miRNA PtomiR6443 in regulation lignin S/G value | |
| CN106171981A (en) | The preparation method of a kind of cross-pollinatd plant callus high frequency regeneration system and the application in genetic transformation thereof | |
| CN102640642B (en) | Method for pierce-inoculating geminivirus infectious clone-containing solid colony to plant, and application thereof | |
| CN109762838A (en) | A kind of hairy genetic conversion system of spinach that agrobacterium rhizogenes mediates | |
| CN111937749B (en) | High-efficiency induction and culture method of uncaria hairy roots | |
| CN112143734A (en) | SmbHLH92 gene cloning primer, expression vector, function of regulating and controlling salvianolic acid biosynthesis and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |