CN115820657A - Dilated cardiomyopathy variant gene TTN and application thereof - Google Patents

Abstract

The invention relates to the technical field of gene detection, in particular to an dilated cardiomyopathy variant gene TTN, wherein compared with a reference sequence SEQ ID NO. 5 of a wild TTN gene, bases of 51654 to 51661 of the variant gene TTN are deleted, and the nucleotide sequence is SEQ ID NO. 1. The invention also relates to application of the dilated cardiomyopathy mutant gene TTN in preparation of a detection kit. The dilated cardiomyopathy variant gene TTN provided by the invention can be used as a biomarker for clinical auxiliary diagnosis; the carrier for detecting the variation provides a bearing guide and genetic counseling for the test person, reduces the birth of the sick children, and has important significance for early diagnosis of the dilated cardiomyopathy or auxiliary clinical judgment.

Description

Dilated cardiomyopathy variant gene TTN and application thereof

Technical Field

The invention relates to the technical field of gene detection, in particular to an dilated cardiomyopathy variant gene TTN and application thereof.

Background

Dilated Cardiomyopathy (DCM) is one of the important causes of heart failure and sudden cardiac death, is the most common indication for patients to carry out heart transplantation, has the morbidity rate of about 1. Symptoms, often already in the advanced stages of the disease, manifest as heart failure, arrhythmias and/or diseases of the conduction system, or as thromboembolic diseases. The diagnosis is based on left ventricular dilation with simultaneous systolic dysfunction (ejection fraction < 50%), often by means of thoracic echocardiography. Dilated cardiomyopathy has complicated etiology, including myocardial ischemia, heredity, infection, inflammation, long-term severe hypertension, radiation, toxin (such as anthrax), etc., and genetic factors thereof play an important role. Current studies have shown that up to 40% of dilated cardiomyopathies are caused by genetic factors. Most of them are autosomal dominant inheritance, but there are also autosomal recessive inheritance, X-chromosome recessive inheritance and maternal inheritance modes caused by mitochondrial gene mutation.

The dilated cardiomyopathy related pathogenic gene TTN is a coding gene of the titin, is mainly expressed in cardiac muscle and skeletal muscle, has a large molecular weight, spans 1/2 of sarcomere in length, and is an important structural protein.

The detection of the related genes of the suspected case according to the will of the patient is helpful for the early diagnosis and clinical intervention of the dilated cardiomyopathy so as to achieve the purpose of delaying the occurrence of the disease or preventing the disease. The pathogenesis of the dilated cardiomyopathy related to the TTN gene is revealed from the molecular level, a theoretical basis can be provided for clinical treatment of the dilated cardiomyopathy, but a large number of unknown TTN gene mutation sites still exist at present, and further discovery of new TTN gene mutation sites is helpful for further research of the dilated cardiomyopathy, and has important significance for early diagnosis of the dilated cardiomyopathy or auxiliary clinical judgment.

Disclosure of Invention

The invention aims to provide an dilated cardiomyopathy mutant gene TTN and application thereof aiming at the defects.

The present invention aims to provide: compared with the reference sequence SEQ ID NO of a wild type TTN gene, the base of the dilated cardiomyopathy variant gene TTN is deleted from 51654 to 51661, and the nucleotide sequence is SEQ ID NO 1; compared with the amino acid sequence SEQ ID NO. 6 of the wild TTN gene coding protein, the amino acid sequence of the variant gene TTN coding protein is SEQ ID NO. 2.

The invention successfully screens the variant gene TTN through a large number of tests, researches and analyses, and develops a detection kit which can be used for quickly, sensitively and effectively detecting the variant gene TTN by using the variant gene TTN. Specific information of variant gene TTN is shown in the following table:

TABLE 1 variant Gene TTN

Gene	Genomic position	Transcript number	Base change	Amino acid changes	Reference genome version
						TTN	chr2:179432003	NM_003319	c.51654_51661del	p.Leu17219ThrfsTer16	GRCh37/hg19

The invention also provides application of the dilated cardiomyopathy variant gene TTN in preparation of a detection kit, wherein the detection kit comprises a primer for amplifying the variant gene TTN, and the sequences of the primer are SEQ ID NO. 3 and SEQ ID NO. 4.

Preferably, the dilated cardiomyopathy kit further comprises a PCR premix, a negative control reagent and a positive control reagent.

The invention has the beneficial effects that: the variant gene TTN disclosed by the invention can be used as a biomarker for clinical auxiliary diagnosis of dilated cardiomyopathy, and has important significance for early diagnosis of dilated cardiomyopathy or auxiliary clinical judgment; the kit developed by the reagent based on the variant gene TTN can distinguish patients carrying TTN c.51654_51661del heterozygous missense mutation from normal people, provide better birth and sound care guidance and genetic counseling for the subjects and reduce the birth of the children patients.

Drawings

FIG. 1 is a Sanger sequencing chart of patients carrying TTN c.51654-51661 del of example 1;

FIG. 2 is a family diagram of the syndrome of the dilated cardiomyopathy predecessors in example 2.

Detailed Description

The present invention will be described in further detail with reference to the following embodiments, but the present invention is not limited thereto.

The experimental procedures in the following examples are all conventional ones unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

And (3) reagent sources: PCR premix solution: 2 × Taq MasterMix (Dye), available from Jiangsukang as a century Biotechnology Ltd, cat #: l01037/70335; comprises the following components: taq DNA Polymerase, PCR Buffer, mg ²⁺ Components required by conventional PCR, such as dNTPs, PCR stabilizers and enhancers. Agencourt AMPure XP magnetic bead: purchased from beckmann coulter commercial (china) ltd, cat #: 311303. the primers for amplification were synthesized by the firm Biotech engineering (Henan) Ltd. RNase-Free H ₂ O: purchased from beijing solibao technologies ltd. The whole blood genome DNA extraction kit by the paramagnetic particle method comprises the following steps: purchased from Jiangsu Baishinuo medical science and technology Co., ltd, batch number: 20031886-01C.

Example 1: verification experiment of variant gene TTN c.51654-51661 del

On the premise that a patient with dilated cardiomyopathy and family members sign informed consent voluntarily in clinical diagnosis, 5-10mL of human whole blood EDTA anticoagulation sample is sent, a medical record database is established, and data such as the patient's illness state and family conditions are recorded in detail. The study was approved by the ethical committee of this unit.

S1, extracting genome DNA: the method comprises the steps of extracting whole genome DNA from a human whole blood EDTA anticoagulation sample of a patient, adopting a magnetic bead method whole genome DNA extraction kit of Jiangsu Baishi medical science and technology GmbH, and carrying out operation steps according to a product specification. The concentration and purity of the DNA were determined and used as template DNA for PCR amplification.

S2, preparing a PCR reaction system for amplifying a section of DNA sequence including target gene sites, wherein the PCR reaction system comprises the following components: 25 μ L of PCR premix, 2 μ L of forward primer (10 μ M), 2 μ L of reverse primer (10 μ M), less than 1000ng of template DNA, and adding RNase-Free H2O to make up to 50 μ L. The information of the forward and reverse primers used is as follows:

forward primer (SEQ ID NO: 3): 5'AGCTGGTGCAATAAGTAAACCC 3'; reverse primer (SEQ ID NO: 4): 5'AACAACAGTCCAGGCAAGTCG 3'. Length: 508bp.

S3, amplifying a target fragment: mixing the reaction system, and carrying out amplification reaction of the target gene fragment on a PCR instrument, wherein the amplification procedure is as follows: pre-denaturation at 95 ℃ for 90s; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 30s for a total of 33 cycles. Final extension at 72 ℃ for 2min.

S4, detection of PCR products: taking 2 mu L of PCR product, detecting the PCR product by using 1.5% agarose gel electrophoresis, selecting 1000bp Marker as reference, and detecting and verifying that the amplification product is the expected size.

S5, PCR product purification: after detecting the PCR product, purifying the PCR product by using Agencour AMPure XP magnetic beads, wherein the purification step is carried out according to a product specification, and the specific steps are as follows: (1) The beads were vortexed for 30 seconds to thoroughly mix to a uniform solution. (2) The PCR product to be purified was added to a 1.5mL centrifuge tube, followed by a 2 sample volume of magnetic bead solution. After vortexing and mixing, the mixture was vortexed at 1400rpm for 5min at room temperature. (3) And (4) placing the centrifuge tube in the previous step on a magnetic frame for about 1min until the magnetic beads are completely adsorbed. (4) Keep the centrifuge tube fixed to the magnetic frame and discard the solution, avoiding contact with the beads during this period. (5) And adding 500 mu L of Buffer PW into the centrifugal tube in the previous step, taking the centrifugal tube off the magnetic frame, carrying out vortex oscillation for 10s, then putting the centrifugal tube back to the magnetic frame again, standing for 1min, and completely discarding the rinsing liquid after the magnetic beads are completely adsorbed on the side wall of the centrifugal tube. And (6) repeating the step (5). (7) Keeping the centrifugal tube fixed on the magnetic frame and standing for 10min to completely volatilize the ethanol. (8) The tube was removed from the magnetic frame, 20-100. Mu.L of Buffer EB was added, the beads were resuspended in the eluent by vortexing, and the tube was then eluted at 1400rpm for 5min at 65 ℃. (9) The centrifuge tube was placed on a magnetic rack for about 1min until the magnetic beads were completely adsorbed. (10) The eluate was transferred to a new 1.5mL centrifuge tube, at which point the beads were discarded.

S6, sanger sequencing is carried out on the amplification products by using an applied biosystems 3500Dx series gene analyzer.

S7, performing bioinformatics analysis on the sequencing result: the sequencing results and the wild-type TTN gene sequences (SEQ ID NO:5 and SEQ ID NO: 6) obtained at NCBI (https:// www.ncbi.nlm.nih.gov /) were subjected to sequence alignment in software Chromas to determine whether the detection site was mutated.

S8, demonstration of gene variation: the patient detects TTN c.51654-51661 del heterozygosis variation, namely, compared with the reference sequence SEQ ID NO. 5 of the wild-type TTN gene, the base of the variant gene TTN at the 51654 to 51661 bits is deleted, and the nucleotide sequence is SEQ ID NO. 1; compared with the amino acid sequence SEQ ID NO. 6 of the protein coded by the wild TTN gene, the amino acid sequence of the protein coded by the variant gene TTN is SEQ ID NO. 2, and a Sanger sequencing map is shown in figure 1.

Thousand human genomes were retrieved (https:// www.ncbi.nlm.nih.gov/variation/tools/1000 genes /): none. ClinVar (https:// www. Snpedia. Com/index. Php/ClinVar): none. ESP6500 (https:// ESP. Gs. Washington. Edu/drupal /): none. ExAC (http:// ExAC. Hms. Harvard. Edu /): none. HGMD (http:// www. HGMD. C. Ac. Uk/ac/index. Php): none. The variation was not carried by both the cardiomyocytes and the control population in the Baishano local cohort database.

The results of cross prediction by using a plurality of biological information prediction software (including SIFT, polyphen-2 and the like) are mostly harmful (SIFT is 'D', polyphen-2 is 'D', mutationTaster _ pred is 'D', VEST3 is graded as '0.666', and the others are '4D/1M/1N') amino acids changed from nonpolar alanine to nonpolar proline, which indicates that the amino acid change caused by the mutation may have an influence on the protein function.

According to the existing evidence: the variation is a rare variation, which is a highly suspected pathogenic mutation of dilated cardiomyopathy.

Example 2: sample validation experiment

2500 patients with dilated cardiomyopathy and 1000 healthy people without dilated cardiomyopathy were recruited. TTN c.51654-51661 del of each member of the family and healthy population was amplified using the method in example 1 and analyzed after Sanger sequencing after amplification was complete.

Based on sample information confidentiality, part of the sample information is now disclosed. The sample can disclose information: (1) dilated cardiomyopathy families; country/region: china/south china; the proportion of family members to male and female is as follows: 1: 1; age distribution of family members: 10-60 years old; (2) country/region of healthy population: china/south china; the proportion of healthy people to male and female is as follows: 1: 1; healthy population age distribution: 12-60 years old.

Only the affected members in the recruited dilated cardiomyopathy pedigree (pedigree shown in figure 2) carried TTN c.51654 — 51661del heterozygous missense mutations; the healthy people do not have any mutation at any site.

Example 3: detection kit

1. Consists of the following components:

TABLE 2 compositions

2. The using method comprises the following steps: (1) extracting genome DNA: peripheral blood sample genomic DNA was extracted using a DNA extraction kit. (2) PCR amplification: PCR amplification was carried out using the above-mentioned kit, and the reaction system and reaction conditions were as described in example 1. And (3) purifying the PCR amplification product. And (4) carrying out Sanger sequencing on the purified PCR amplification products. (5) Analyzing the sequencing result, and comparing whether there is TTN c.51654-51661 del heterozygosis variation.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Claims (4)

1. The dilated cardiomyopathy variant gene TTN is characterized in that compared with a reference sequence SEQ ID NO. 5 of a wild type TTN gene, the base of the variant gene TTN at the positions 51654 to 51661 is deleted, and the nucleotide sequence is SEQ ID NO. 1.

2. The dilated cardiomyopathy variant gene TTN of claim 1, wherein the amino acid sequence of the protein encoded by the variant gene TTN is SEQ ID NO. 2, as compared to the amino acid sequence of the protein encoded by the wild-type TTN gene SEQ ID NO. 6.

3. The application of the dilated cardiomyopathy variant gene TTN in the preparation of a detection kit according to claim 2, wherein the detection kit comprises primers for amplifying the variant gene TTN, and the sequences of the primers are SEQ ID NO. 3 and SEQ ID NO. 4.

4. The detection kit of claim 3, further comprising a PCR premix, a negative control reagent, and a positive control reagent.

Images