CN115820434B - Efficient phosphorus-dissolving fungus Taba Lei Sitan echinococcus PtWFY-1 and application thereof - Google Patents
Efficient phosphorus-dissolving fungus Taba Lei Sitan echinococcus PtWFY-1 and application thereof Download PDFInfo
- Publication number
- CN115820434B CN115820434B CN202211493325.9A CN202211493325A CN115820434B CN 115820434 B CN115820434 B CN 115820434B CN 202211493325 A CN202211493325 A CN 202211493325A CN 115820434 B CN115820434 B CN 115820434B
- Authority
- CN
- China
- Prior art keywords
- ptwfy
- phosphorus
- sitan
- lei
- taba
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention provides a high-efficiency phosphorus-dissolving fungus Taba Lei Sitan Acremonium acutum PtWFY-1 and application thereof. Taba Lei Sitan, ptWFY-1, deposited at the microbiological bacterial collection center, GDMCC, address: guangzhou city first middle road 100 # college 59 # building 5, post code: 510070 under the accession number GDMCC No:61861. the invention provides a Taba Lei Sitan Acidocella spinosa PtWFY-1, which is applied to various inorganic phosphorus sources (calcium phosphate Ca) 3 (PO 4 ) 2 Magnesium phosphate Mg 3 (PO 4 ) 2 Phosphate rock powder) and organic phosphorus source (calcium phytate) have dissolving power.
Description
Technical Field
The invention belongs to the technical field of microbial fertilizers, and particularly relates to a high-efficiency phosphate-dissolving PtWFY-1, namely Taba Lei Sitan, and application thereof.
Background
Rice (Oryza sativa l.) is one of the most important food crops for humans, and as the global population increases, the tillable area decreases gradually, and the production of rice increases in rigidity demand (gap et al, 2019). Phosphorus is a necessary nutrient element for rice growth, but has been faced with the problem of low phosphorus utilization efficiency in the rice production process. Most of the phosphate fertilizer and Ca applied to the soil 2+ 、Fe 2+ 、Fe 3+ 、Al 3+ The plasma combined conversion becomes unavailable insoluble phosphorus, so that the on-season utilization rate of the phosphate fertilizer is not more than 30%, which not only causes the yield reduction of rice, but also seriously affects the quality and commodity value of rice, and the lack of available phosphorus in soil has become an important factor for limiting the growth and yield increase of rice (Bunnemann, 2015;Dash and Dangar,2017). At present, the main mode for promoting the growth of rice and improving the yield is to use industrial chemical fertilizers and pesticides, but the problems of high cost, serious environmental pollution, non-lasting effect and the like exist. Therefore, the development and utilization of microbial fertilizers to improve the utilization rate of phosphate fertilizers of rice has become a problem to be solved in rice production, and has great significance in guaranteeing the grain safety of China.
The use of phosphorus-dissolving microorganisms to increase the content of available phosphorus in soil is the safest and effective method for dealing with low phosphate fertilizer utilization (Mahanty et al, 2017). To date, researchers have isolated some phosphorus-dissolving fungi from plant bodies and plant rhizosphere soil, and have reported mainly Aspergillus (Aspergillus), penicillium (Penicillium), trichoderma (Trichoderma), rhizopus (Rhizopus), sclerotinia (Sclerotinia), bluestone (Talaromyces) and Fusarium (Fusarium) et al (Alori et al, 2017; kalayu, 2019). Among them, penicillium and Aspergillus are internationally recognized species of phosphorus-solubilizing microorganisms, and are highest in phosphorus-solubilizing activity with Aspergillus fungi (Saxena et al, 2013; xie et al, 2019). The above phosphorus-dissolving fungi, such as deep et al, (2010) 12 strains with high phosphorus-dissolving capacity are isolated from rice field soil, belonging to Alternaria (Alternaria), cladosporium (Cladosporium), aspergillus, penicillium, fusarium and Rhizopus respectively; the Mwajita et al, (2013) reported that 21 total fungal strains of rice leaf circumference, root surface and rhizosphere soil have phosphorus dissolving function, including penicillium, aspergillus, fusarium, trichoderma, and the like. However, in general, the types of phosphorus-dissolving fungi separated from the rice field ecological system are few, and a large amount of phosphorus-dissolving fungi resources are still not explored.
The action mechanism of the phosphate-dissolving fungi for promoting the absorption and utilization of plant phosphorus is mainly divided into direct action and indirect action, wherein the direct action refers to the action of the phosphate-dissolving fungi for increasing the phosphorus content in soil through substances such as acid, enzyme and the like, improving the phosphorus nutrition condition of plants, and the indirect action refers to the action of the phosphate-dissolving fungi for promoting the growth and development of plants so as to promote the absorption and utilization of the plant to the phosphorus (Zhang Yican and the like, 2020). According to the existing research reports, the direct action mechanism of the phosphorus-dissolving fungi for dissolving phosphorus mainly comprises three aspects: (i) rhizosphere acidification: the phosphorus-dissolving fungus can produce organic acid (such as citric acid, oxalic acid, tartaric acid, malic acid, lactic acid, etc.), reduce soil pH, and also produce inorganic acid (such as H) 2 S、HCl、H 2 CO 3 Etc.) to dissolve the phosphorus minerals to increase the phosphorus content of the soil (Yadav et al, 2015); (ii) chelation: the phosphate-dissolving fungi can produce chelates of extracellular polysaccharide and siderophores, etc., chelating metal ions to release more phosphate ions for plant use (Paul and Sinha,2013;Sarker et al, 2014); (iii) mineralization: the phosphate-dissolving fungi can produce enzymes (such as phosphatase, phosphohydrolase, phytase, etc.), accelerate mineralization of organic phosphorus compounds, release phosphorus, and finally convert insoluble phosphorus into phosphorus which can be absorbed and utilized by plants (Raliya et al, 2016). In addition, the phosphorus-dissolving fungi can promote the growth and development of plants, thereby improving the absorption and utilization of phosphorus by the plants. However, the action mechanism of the phosphate-dissolving fungi for promoting the absorption and growth of rice phosphorus is not well known so far.
Acremonium (Pyrenochaetopsis Gruyter, aveskamp)&Verkley, gen. Nov) is a new genus established by de Gruyter et al in 2010, belonging to Ascomycota, dothideomycetes, ales of the order acervulina, pyrenochaliotidaceae (de Gruyter et al, 2010; valenzuela-Lopez et al, 2018). Although Phanerochaete 20It was established in 10 years, but it is widely distributed in paddy field ecosystems, the most common type of microorganism in paddy field ecosystems, accounting for about 4.0% to 6.6% of the microbial species in paddy fields (Papizadeh et al, 2017; chen et al, 2020). The prior studies found that they have a variety of biological functions, e.g., de Gruyter et al, (2010) studies indicate that echinococcus fungi are directly involved in regulating soil respiration and soil enzymatic activity in the soil carbon cycle, and have a strong capacity to solubilize poorly soluble carbon (organic matter, etc.); a study of Bai et al, (2019) reported that aschersonia was responsible for soil CO 2 A very important class of fungi that are discharged; meanwhile, studies by Xun et al, (2020) indicate that the relative abundance of aschersonia fungi and N in paddy soil 2 O release is positively correlated and affects N 2 The main microbial type of O release. In addition, soil organic carbon levels, zn concentration, biochar addition, etc. can also affect the distribution and ecological function of Pachydospora fungi (Zheng et al, 2016; chen et al, 2020). However, the research on the echinococcus fungi in the rice field ecological system is less at present, and the kind of the echinococcus fungi with the phosphorus dissolving function has not been reported yet.
Disclosure of Invention
The invention aims to provide a PtWFY-1 strain of Taba Lei Sitan echinococcus (Pyrenochaetopsis tabarestanensis) with an efficient phosphate-dissolving function, which is a novel phosphate-dissolving fungus, and can be used for preparing a soil phosphorus activator, improving the phosphorus utilization rate of rice, reducing the use of phosphorus-containing chemical fertilizers and promoting the growth of rice.
The first object of the invention is to provide a PtWFY-1 strain of PtWFY-1, ptWFY-Pyrenochaetopsis tabarestanensis, of Pachydrographis tarda Lei Sitan for decomposing inorganic and organic phosphorus, it was deposited at the collection of microbiological strains, abbreviated as GDMCC, address: guangzhou city first middle road 100 # college 59 # building 5, post code: 510070 under the accession number GDMCC No:61861.
a second object of the present invention is to provide the use of PtWFY-1, ptWFY-Lei Sitan, in the decomposition of inorganic and/or organic phosphorus.
Preferably, the inorganic phosphorusIs Ca 3 (PO 4 ) 2 、Mg 3 (PO 4 ) 2 And the organic phosphorus is calcium phytate.
Preferably, the PtWFY-1, taba Lei Sitan, is a cake and/or strain broth of PtWFY-1, taba Lei Sitan.
A third object of the present invention is to provide the use of PtWFY-1, ptWFY-Lei Sitan, ammopsis sinensis in the secretion of organic acids.
The fourth object of the invention is to provide the application of PtWFY-1, which is prepared from Pachylomyces taenii Lei Sitan, in promoting the dissolution of phosphorus in soil and the absorption of phosphorus in rice.
A fifth object of the invention is to provide the use of PtWFY-1, ptWFY-Lei Sitan, ammopsis takii in the preparation of soil phosphorus activators.
It is a sixth object of the present invention to provide a biological agent containing PtWFY-1, ptWFY-62, toba, as an active ingredient.
The biological agent is a microbial agent or microbial fertilizer for decomposing inorganic phosphorus and organic phosphorus, secreting organic acid, promoting soil phosphorus dissolution and rice phosphorus absorption, and can promote plant growth.
Preferably, the biological agent is obtained by culturing PtWFY-1, pachytrium tarum Lei Sitan in PDB culture solution.
Compared with the prior art, the invention has the following advantages and effects
1. The Pachyrhizus taenii Lei Sitan PtWFY-1 is obtained by first separating from the rhizosphere soil of a paddy variety Wufengyou 615 in a great farm of China institute of agricultural science, guangdong province, and can well colonise paddy root systems; the phosphorus activator is used as a soil phosphorus activator, so that the production and the processing of rice are safer and more reliable;
2. the invention provides a Taba Lei Sitan Acidocella spinosa PtWFY-1, which is applied to various inorganic phosphorus sources (calcium phosphate Ca) 3 (PO 4 ) 2 Magnesium phosphate Mg 3 (PO 4 ) 2 Phosphate rock powder) and organic phosphorus source (calcium phytate) have dissolving capacity;
3. the invention provides the Tabanteine17 organic acids can be secreted by the PtWFY-1 in the phosphorus dissolving process, so that the pH value of the fermentation liquor is reduced, and the organic acids with higher content are: alpha-ketoglutarate, pyruvic acid, lactic acid, succinic acid, citraconic acid, 5-hydroxymethyl-2-furancarboxylic acid, total amount of secreted organic acid 3439.94 ng.ml -1 ；
4. The obtained Taba Lei Sitan echinococcus PtWFY-1 has low requirements on culture conditions, and the biological source is environment-friendly and nontoxic and has little influence on ecological environment; has good development and application prospect.
Pyrenochaetopsis tabarestanensis PtWFY-1 was deposited at 2021, 8.11 with the collection of microbiological strains, abbreviated as GDMCC, address: guangzhou city first middle road 100 # college 59 # building 5, post code: 510070 under the accession number GDMCC No:61861.
drawings
FIG. 1 is a single colony of PtWFY-1, acidocella takii, on oat medium, wherein A is the front morphology of PtWFY-1, A is the back morphology of PtWFY-1, B is the chlamydospore, C is the chlamydospore produced by PtWFY-1, D is a PtWFY-1 strain phylogenetic tree constructed based on ITS rDNA sequence homology.
FIG. 2 is the result of phosphorus dissolution characteristics of PtWFY-1, acremonium tambach Lei Sitan, on PVK solid medium. Wherein A is PtWFY-1 strain, respectively, added with Ca 3 (PO 4 ) 2 And phosphate solubilizing ring (72 h of culture) produced on PVK solid medium of calcium phytate, B is PtWFY-1 strain under PVK solid culture condition for Ca 3 (PO 4 ) 2 And the phosphorus-dissolving capacity of calcium phytate;
FIG. 3 shows the results of phosphorus dissolution characteristics of PtWFY-1, acremonium tamariscinum under PVK liquid culture conditions. Wherein A is PtWFY-1 strain under PVK liquid culture condition for Ca 3 (PO 4 ) 2 B is the P-dissolving effect of PtWFY-1 strain on Mg under PVK liquid culture condition 3 (PO 4 ) 2 C is the phosphorus dissolving effect of PtWFY-1 strain on phosphate rock powder under PVK liquid culture condition, and D is the phosphorus dissolving effect of PtWFY-1 strain on calcium phytate under PVK liquid culture conditionFruit;
FIG. 4 shows the pH change of PtWFY-1 fermentation broth of Taba Lei Sitan Acidocella echinocandi, wherein A is PtWFY-1 strain in Ca 3 (PO 4 ) 2 pH change in fermentation liquor, B is PtWFY-1 strain in Mg 3 (PO 4 ) 2 The pH change in fermentation liquor, C is the pH change of PtWFY-1 strain in phosphate rock powder fermentation liquor, D is the pH change of PtWFY-1 strain in calcium phytate fermentation liquor;
FIG. 5 is a graph showing the results of promoting phosphorus absorption and phosphorus dissolution in rice by PtWFY-1, pachyrhizus, taba Lei Sitan, wherein A is the effect of non-inoculation and inoculation on phosphorus content in rice plants, and B is the effect of non-inoculation and inoculation on phosphorus content in soil. Control and PtWFY-1 represent the non-inoculation and inoculation processes, respectively.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.
Example 1: isolation, purification, identification and preservation of PtWFY-1 (Pyrenochaetopsis tabarestanensis) from Taba Lei Sitan Achillea
(1) Sampling: the rice rhizosphere soil is collected in a great-scale foundation of the national institute of agriculture, guangdong province, put into a clean sampling bag (bottle), marked and stored in a refrigerator at 4 ℃ for standby.
(2) Separation and purification: weighing 100g of rice rhizosphere soil, dissolving in 100mL of sterile water, standing for 2h, and preparing the supernatant into 10 by adopting a 10-fold dilution method -1 ～10 -7 Diluting the bacterial suspension. 100. Mu.L of each of the culture plates was plated on PDA (potato dextrose agar) fungus medium and cultured in a constant temperature incubator at 28℃for 48 to 72 hours. And (3) picking out the fungus strain, purifying, separating and subculturing for multiple times to obtain the pure culture strain PtWFY-1.
(3) And (3) identification: and (3) performing fungus morphological identification on the pure culture strain PtWFY-1 obtained by separation and purification, extracting DNA (deoxyribonucleic acid) of the pure culture strain PtWFY-1 as a template, amplifying ITS rDNA universal primers as primers, directly performing sequence determination on the amplified fragments, obtaining the name of the phosphorus-dissolving and growth-promoting fungus strain according to the determination result, and preserving the name in a strain preservation center.
The amplified length of ITS rDNA sequence of the strain PtWFY-1 is 442bp, the homology with the PtWFY-1 strain is up to 99.77% through homology comparison, and the strain is identified as a strain of Pyrnochaetopsis genus by combining morphological characteristics of the PtWFY-1 strain, and is named PtWFY-1 of PtWFY Lei Sitan.
ITS rDNA sequence fragments were as follows:
GTCTTTTGCGTACCGTATGTTTCCTCGGCGGGCTTGCCTGCCGGTTGGACATTATCAAACCTTTTTGTAGTTGCAATCAGCGTCAGAAAATAATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTTGTACCCTCAAGCACTGCTTGGTGTTGGGCGCTTGTCCTGCAAAGGACTCGCCTGAAAGCGATTGGCGGCCAACGTACTGGTGGTAGAGCGCAGCACAATTTGCGTCTTTCCCCTCTGCGTTAGCGTCCATGAAGCCTATTTCAACGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAAC (SEQ ID NO. 1)
Taba Lei Sitan Acremonium acutum PtWFY-1 was grown on oat medium for 14d with a diameter of 50-60mm. The mycelium is grey brown, velvet is slightly flocculent, and the center is grey white. With chlamydospores (see figure 1).
(4) Preserving: ptWFY-1, from 2021, was prepared by mixing Toba Lei Sitan with Acremonium acutum (Pyrenochaetopsis tabarestanensis) the 11 th month is preserved in the microorganism strain collection center of Guangdong province, abbreviated as GDMCC, address: guangzhou city first middle road 100 # college 59 # building 5, post code: 510070 under the accession number GDMCC No:61861.
EXAMPLE 2 analysis of phosphorus dissolution Properties of Taba Lei Sitan Acidocella echinosporium PtWFY-1
(1) Preparation of PVK solid medium: glucose 10.0g,NaCl 0.3g,KCl 0.3g, (NH) 4 ) 2 SO 4 0.5g，MgSO 4 ·7H 2 O 0.3g，MnSO 4 ·4H 2 O 0.03g，FeSO 4 ·7H 2 O 0.03g，Ca 3 (PO 4 ) 2 5.0g of calcium phytate, 18g of agar powder, constant volume to 1000mL, pH value adjustment to 7.0-7.2, sterilization at 121 ℃ for 20min, cooling and storage for standby.
(2) Preparation of PVK liquid culture medium: glucose 10.0g，NaCl 0.3g，KCl 0.3g，(NH 4 ) 2 SO 4 0.5g，MgSO 4 ·7H 2 O 0.3g，MnSO 4 ·4H 2 O 0.03g，FeSO 4 ·7H 2 O 0.03g，Ca 3 (PO 4 ) 2 /FePO 4 /Al PO 4 /Mg 3 (PO 4 ) 2 5.0g of phosphorite powder/calcium phytate, constant volume to 1000mL, regulating pH value to 7.0-7.2, sterilizing at 121 ℃ for 20min, cooling and storing for standby.
(3) Preparation of fungal spore suspension: activating PtWFY-1 strain of Pachytrium tarum Lei Sitan, scraping fungus spore into sterile water to obtain 1.0X10 6 CFU/mL fungal spore suspension.
(4) Determination of phosphorus dissolution characteristics of PtWFY-1, acidocella spinosa, taba Lei Sitan, on PVK solid medium: inoculating PtWFY-1 bacterial block (bacterial block size phi 0.5 cm) of Acidocella takii Lei Sitan into PVK solid culture medium (Ca 3 (PO 4 ) 2 Calcium phytate as phosphorus source), the colony diameter (D) and diameter (D) were measured after culturing at 28℃for 72 hours, and PtWFY-1 strain-dissolved Ca was analyzed based on the diameter ratio (D/D) of the phosphate solubilizing ring to the colony 3 (PO 4 ) 2 And the ability of calcium phytate, the results are shown in FIG. 2.
(5) Determination of phosphorus dissolution characteristics of PtWFY-1, toba Lei Sitan, acremonium acutum under PVK liquid culture conditions: inoculating PtWFY-1 spore suspension of Taba Lei Sitan Acidocella at a volume fraction of 2% to Ca 3 (PO 4 ) 2 (5g/L)、FePO 4 (5g/L)、AlPO 4 (5g/L)、Mg 3 (PO 4 ) 2 In PVK liquid medium with (5 g/L), powdered rock phosphate (5 g/L) and calcium phytate (5 g/L) as the sole phosphorus source, 3 replicates were performed for each treatment with suspension made without inoculating the medium as a control. After culturing for 24h, 48h, 72h, 96h, 120h, 144h and 168h respectively by a constant temperature shaking table at 28 ℃, centrifuging for 10min at 10000r/min, and quantitatively measuring the concentration of available phosphorus in the supernatant by an ammonium molybdate colorimetric method, wherein the result is shown in FIG. 3. At the same time, the pH of the supernatant was measured using a pH meter, and the results are shown in FIG. 4.
Analysis of results: taba Lei Sitan PtWFY-1 vs. Ca 3 (PO 4 ) 2 、Mg 3 (PO 4 ) 2 And insoluble inorganic phosphorus salt such as phosphate rock powder, but has dissolving capability to FePO 4 And AlPO 4 There is no solvency. Meanwhile, taba Lei Sitan Acidocella spinosa PtWFY-1 also has a dissolving capacity for insoluble organic phosphorus salt calcium phytate. The method can degrade the soil insoluble phosphate by secreting organic acid substances, thereby increasing the absorption and utilization of phosphorus by rice.
Example 3 analysis of the capability of Taba Lei Sitan to secrete organic acids by PtWFY-1
(1) Preparing a bacterial strain fermentation liquid: activating PtWFY-1 strain of Pachylomyces takii Lei Sitan, scraping fungus spore into PVK liquid culture medium containing calcium phosphate to obtain 1.0X10 6 CFU/mL fungus spore suspension, shaking table 28 ℃,180rpm culture 5d,12000r/min centrifugation 5min, taking supernatant and placing in-80 ℃ refrigerator for preservation.
(2) Sample pretreatment: thawing the strain supernatant, and uniformly mixing by vortex 10 s; taking 50 mu L of supernatant (the sampled sample is put back into a refrigerator at the temperature of minus 80 ℃ as soon as possible) and added into a corresponding numbered 1.5mL centrifuge tube, and 250 mu L of 20% acetonitrile methanol extract is added; centrifuging after swirling for 3min, centrifuging for 12000r/min, and centrifuging for 10min at 4 ℃; sucking 250 mu L of supernatant into another 1.5mL centrifuge tube with the same number after centrifugation, and standing in a refrigerator at-20 ℃ for 30min;12000r/min, and centrifuging at 4deg.C for 10min; 180 μl of the supernatant was removed from the sample vials and stored at-20deg.C.
(3) Chromatographic mass spectrometry acquisition conditions: the data acquisition instrument system mainly comprises ultra-high performance liquid chromatography (Ultra Performance Liquid Chromatography, UPLC) (ExionLC) TM AD, https:// sciex.com.cn /) and tandem mass spectrometry (Tandem Mass Spectrometry, MS/MS)/(MS)
6500+，https://sciex.com.cn/)。
(4) The liquid phase conditions mainly comprise: chromatographic column: ACQUITY HSS T3 column (1.8 μm,100 mm. Times.2.1 mm i.d.); mobile phase: phase a, ultrapure water (0.05% formic acid), phase B, acetonitrile (0.05% formic acid); gradient elution procedure: 0-8.0min A/B is 95:5 (V/V), 8.0-9.5min A/B is 5:95 (V/V), 9.6-12.0min A/B is 95:5 (V/V); the flow rate is 0.35mL/min; column temperature 40 ℃; the sample injection amount was 2. Mu.L.
(5) The mass spectrum conditions mainly comprise: electrospray ion source (Electrospray Ionization, ESI) temperature 550 ℃, mass spectral voltage 5500V in positive ion mode, mass spectral voltage-4500V in negative ion mode, and Gas Curtain (curtaingas, CUR) 35psi. In Q-Trap 6500+, each ion pair is scan detected based on an optimized declustering voltage (declustering potential, DP) and Collision Energy (CE).
(6) Qualitative and quantitative analysis: and constructing a MWDB (Metware Database) database based on the standard substance, and carrying out qualitative analysis on the data of the mass spectrum detection. Quantification was done using a multiple reaction monitoring mode (Multiple Reaction Monitoring, MRM) analysis of triple quadrupole mass spectrometry. After obtaining mass spectrometry data of different samples, the chromatographic peaks of all the targets are integrated, and quantitative analysis is carried out through a standard curve. The results are shown in Table 1.
TABLE 1
Analysis of results: taba Lei Sitan, ptWFY-1 can secrete 17 organic acids in the phosphorus dissolving process, and the organic acids with higher content are: alpha-ketoglutarate, pyruvic acid, lactic acid, succinic acid, citraconic acid, 5-hydroxymethyl-2-furancarboxylic acid, total amount of secreted organic acid 3439.94 ng.ml -1 。
Example 4 Effect of Taba Lei Sitan Acidocella spinosa PtWFY-1 on phosphorus uptake and phosphorus solubilization in Rice
(1) Sterilization and germination of rice seeds: taking a proper amount of Yangguan No. six rice seeds for sterilization and disinfection, firstly soaking the seeds in 70% ethanol solution for 1min, rinsing the seeds with sterilized water for 1 time, soaking the seeds in 2.5% sodium hypochlorite solution, oscillating the seeds at 37 ℃ for sterilization for 30min, and cleaning the seeds with sterilized water for 5 to 6 times. Placing the cleaned rice seeds into a sterile culture dish paved with sterile double-layer filter paper, and culturing for 3d at 30 ℃ in a dark place to enable the seeds to germinate and become exposed.
(2) Preparation of potting matrix: mixing rice soil and sand with a volume ratio of 3:1 (v/v) to obtain a potting matrix, sterilizing at 121 ℃ for 20min, cooling, and proportionally filling into rice pots, wherein about 300g of the potting matrix is needed for each pot.
(3) Preparation of PtWFY-1 bacterial liquid of Taba Lei Sitan Cryptosporidium: activating phosphorus-dissolving growth-promoting fungus Taba Lei Sitan Achrombotia echinosporium PtWFY-1 strain with single colony, scraping fungus spore into sterile water to obtain 1.0X10 6 CFU/mL fungal spore suspension.
(4) Rice planting and index determination: taking 6 rice seeds of the step (1), clamping the seeds into a rice basin by using sterilizing forceps, and carrying out the sterilization on the seeds by 1.0X10 6 The CFU/mL fungus spore suspension is applied to soil in a root filling mode according to the mass of 2% of the filled soil, and the suspension prepared by a non-inoculation culture medium is used as a control. Then placing the rice pot into a climatic chamber with the temperature and illumination kept at 30 ℃, 16h illumination and about 24 ℃ and 8h darkness for cultivation, thinning the rice pot after one week, and reserving 3 seedlings per pot. And (3) finishing the experiment after the rice is cultured for about 60 days, and measuring indexes such as phosphorus content of the rice, total phosphorus content of soil and the like.
Analysis of results: the results of potting control experiments show that PtWFY-1, toba Lei Sitan, has a remarkable promoting effect on rice phosphorus absorption and total phosphorus content in soil (see FIG. 5).
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.
Claims (10)
1. Taba Lei Sitan, ptWFY-1, achausena lansium (Pyrenochaetopsis tabarestanensis), accession number GDMCC No:61861.
2. use of tagatose Lei Sitan, ptWFY-1, according to claim 1, for the decomposition of inorganic and/or organic phosphors.
3. The use according to claim 2, wherein the inorganic phosphorus is Ca 3 (PO 4 ) 2 、Mg 3 (PO 4 ) 2 And the organic phosphorus is calcium phytate.
4. Use according to claim 2 or 3, characterized in that said column Lei Sitan, ptWFY-1 is a cake and/or a strain broth of column Lei Sitan, ptWFY-1.
5. Use of talbot Lei Sitan acanthocephalosporium PtWFY-1 according to claim 1 for the secretion of organic acids.
6. Use of tagatose Lei Sitan, ptWFY-1, according to claim 1, for promoting soil phosphorus solubilization and rice phosphorus absorption.
7. Use of toba Lei Sitan, ptWFY-1, as claimed in claim 1, for the preparation of a soil phosphorus activator.
8. A biological agent comprising PtWFY-1, ptWFY-34, ptBAR Lei Sitan, as an active ingredient.
9. The biological agent according to claim 8, wherein the biological agent is a microbial agent or microbial fertilizer for decomposing inorganic phosphorus and organic phosphorus, secreting organic acid, promoting soil phosphorus dissolution, and absorbing rice phosphorus.
10. The biological agent according to claim 8 or 9, wherein the biological agent is obtained by culturing PtWFY-1, pachytrium tarum Lei Sitan in PDB medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211493325.9A CN115820434B (en) | 2022-11-25 | 2022-11-25 | Efficient phosphorus-dissolving fungus Taba Lei Sitan echinococcus PtWFY-1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211493325.9A CN115820434B (en) | 2022-11-25 | 2022-11-25 | Efficient phosphorus-dissolving fungus Taba Lei Sitan echinococcus PtWFY-1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115820434A CN115820434A (en) | 2023-03-21 |
| CN115820434B true CN115820434B (en) | 2023-06-23 |
Family
ID=85531690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211493325.9A Active CN115820434B (en) | 2022-11-25 | 2022-11-25 | Efficient phosphorus-dissolving fungus Taba Lei Sitan echinococcus PtWFY-1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820434B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110616179A (en) * | 2019-11-13 | 2019-12-27 | 东莞市农业科学研究中心 | Pseudomonas aeruginosa DGNK-JL2 and application thereof |
| CN111057666A (en) * | 2019-12-20 | 2020-04-24 | 辽宁省微生物科学研究院 | Pseudomonas and screening method and application thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107779407B (en) * | 2017-10-31 | 2019-07-23 | 中国农业科学院农业资源与农业区划研究所 | Microorganism Aspergillus aculeatus P93 and bio-feritlizer preparation prepared therefrom and application |
| CN110699303A (en) * | 2019-11-19 | 2020-01-17 | 河南工业大学 | High-efficiency phosphate-solubilizing pseudomonas as well as microbial agent and application thereof |
| US20230167384A1 (en) * | 2020-04-21 | 2023-06-01 | Novozymes A/S | Cleaning compositions comprising polypeptides having fructan degrading activity |
| CN112322535B (en) * | 2020-11-09 | 2021-07-27 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Pseudomonas phosphate solubilizing bacteria and application thereof |
| CN114426937A (en) * | 2021-12-31 | 2022-05-03 | 华南农业大学 | Root nodule endophyte S43 with phosphate solubilizing function and application thereof |
| CN115927007B (en) * | 2022-11-25 | 2023-08-04 | 广东省农业科学院水稻研究所 | Multiple-effect plant growth-promoting fungus Taba Lei Sitan echinococcus PtWFY-2 and application thereof |
-
2022
- 2022-11-25 CN CN202211493325.9A patent/CN115820434B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110616179A (en) * | 2019-11-13 | 2019-12-27 | 东莞市农业科学研究中心 | Pseudomonas aeruginosa DGNK-JL2 and application thereof |
| CN111057666A (en) * | 2019-12-20 | 2020-04-24 | 辽宁省微生物科学研究院 | Pseudomonas and screening method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115820434A (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Isolation and characterization of phosphofungi, and screening of their plant growth-promoting activities | |
| Liu et al. | Influences of arbuscular mycorrhizae, phosphorus fertiliser and biochar on alfalfa growth, nutrient status and cadmium uptake | |
| Blanco-Vargas et al. | Phosphate-solubilizing Pseudomonas sp., and Serratia sp., co-culture for Allium cepa L. growth promotion | |
| CN108949584B (en) | Salt-resistant and alkali-resistant aspergillus strain, ITS sequence and application thereof | |
| CN106434374A (en) | Trichoderma asperellum and application thereof in remediation for heavy metal pollution | |
| CN109182136B (en) | Separation and application of aspergillus niger JXZ01 with decomposing capability of various insoluble phosphorus sources | |
| CN108676755B (en) | Microbial liquid fertilizer containing bacillus and preparation method and application thereof | |
| CN110117560B (en) | Rhizosphere growth-promoting bacterium for enhancing salt tolerance of crops, microbial fertilizer and application thereof | |
| CN106424126B (en) | Method for restoring copper-cadmium composite polluted soil | |
| Hua et al. | Interactions between arbuscular mycorrhizal fungi and fungivorous nematodes on the growth and arsenic uptake of tobacco in arsenic-contaminated soils | |
| Brazhnikova et al. | Phosphate mobilization by culturable fungi and their capacity to increase soil P availability and promote barley growth | |
| CN115927007B (en) | Multiple-effect plant growth-promoting fungus Taba Lei Sitan echinococcus PtWFY-2 and application thereof | |
| CN109868242B (en) | Salt-tolerant acetoin-producing bacillus subtilis and application thereof | |
| Kariman et al. | Feremycorrhizal symbiosis confers growth and nutritional benefits to mycorrhizal and non-mycorrhizal crops | |
| CN109735475B (en) | Acid-resistant acetoin-producing bacillus amyloliquefaciens and application thereof | |
| CN113528398B (en) | Bacillus subtilis with phosphate and potassium solubilizing effects, microbial agent and application thereof | |
| CN117050913B (en) | Paenibacillus CBP-2 and application thereof | |
| Ou-Zine et al. | Effects and relationships of compost dose and organic additives on compost tea properties, efficacy against Fusarium oxysporum and potential effect on endomycorrhization and growth of Zea mays L. | |
| CN113755347A (en) | Endophytic fungus AM1 for promoting nitrogen absorption of oil tea | |
| CN111394255B (en) | Aspergillus buried and application thereof | |
| CN107557313B (en) | Compound conditioner for passivating farmland cadmium pollution and promoting rice yield increase | |
| CN110951625B (en) | Penicillium phosphate solubilizing PSF and application thereof | |
| CN115820434B (en) | Efficient phosphorus-dissolving fungus Taba Lei Sitan echinococcus PtWFY-1 and application thereof | |
| CN109694835B (en) | Bacillus subtilis and application thereof in phosphorus dissolving and bacteriostasis | |
| CN111909852A (en) | Cellulose degradation bacterium and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |