CN115820433A - Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof - Google Patents
Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof Download PDFInfo
- Publication number
- CN115820433A CN115820433A CN202211426974.7A CN202211426974A CN115820433A CN 115820433 A CN115820433 A CN 115820433A CN 202211426974 A CN202211426974 A CN 202211426974A CN 115820433 A CN115820433 A CN 115820433A
- Authority
- CN
- China
- Prior art keywords
- trichoderma atroviride
- parts
- organic fertilizer
- fermentation
- days
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Landscapes
- Fertilizers (AREA)
Abstract
The invention relates to the technical field of microbial application, in particular to Trichoderma atroviride Ta102, a multifunctional organic fertilizer and application thereof, wherein the Trichoderma atroviride Ta102 is stored in the common microbial center of China Committee for culture Collection of microorganisms, the storage address is No. 1 Hospital, west Luo, north Cheng, in the sunward area of Beijing city, the storage date is 7-13 days in 2022 years, the storage number is CGMCC No.40242, and the multifunctional organic fertilizer is prepared by using the Trichoderma atroviride Ta102, the rotten time is shortened to 9-12 days, the requirement on fermentation conditions is low, the preparation process is facilitated, the cost is reduced, and the prepared multifunctional organic fertilizer simultaneously has the functions of inhibiting soil-borne diseases such as damping-off disease, blight, root rot disease and the like and promoting growth.
Description
Technical Field
The invention relates to the technical field of microorganism application, and particularly relates to trichoderma atroviride Ta102, a multifunctional organic fertilizer and application thereof.
Background
The organic fertilizer usually takes plant and/or animal residues as main raw materials, and the organic fertilizer has safe use conditions after being processed, and is used for improving and fertilizing soil and providing nutrients for plant growth. The organic fertilizer contains a high amount of organic matters, can increase and update soil organic matters, promote microbial propagation, improve the physical and chemical properties and biological activity of soil, and maintain and improve the soil fertility.
At present, the main raw materials adopted for producing the organic fertilizer are straws (mainly crop straws according to statistical research) and livestock and poultry manure (mainly cow manure and sheep manure according to statistical research), and the raw materials contain a large amount of lignocellulose. In the constitution of lignocellulose, lignin is an aromatic amorphous polymer composed of three alcohol monomers and is used as a cementing material between cellulose and hemicellulose cross-links, and the degradation of the lignin is a rate-limiting factor in the degradation process of the lignocellulose. The natural degradation of lignin comprises two stages of depolymerization and mineralization, wherein the depolymerization stage mainly catalyzes and breaks carbon-carbon bonds, carbon-hydrogen bonds and ether bonds among lignin structural units, and the mineralization stage mainly decomposes aromatic compounds generated in the depolymerization stage into a linear form (Zhao Yi Quanet al, 2020). Some microorganisms have laccase, peroxidase and other enzymes capable of degrading lignin, wherein laccase is the only enzyme currently known to participate in lignin depolymerization process and can further participate in mineralization process by using aromatic compounds (Li Chunfeng, 2010). The high laccase activity plays an important role in the rapid degradation of lignocellulose.
The common organic fertilizer starter is prepared by compounding live bacteria with degradation capacity and adding a carrier, and can play a role in improving material decomposition and temperature accumulation to a certain extent and accelerating softening and decomposition of the organic fertilizer. However, due to the limitations of strain combination and environmental differences, especially the low decomposition efficiency of lignin, the fermentation and decomposition efficiency of the organic fertilizer is not ideal and the use effect is not stable. Therefore, the search for the strain producing high-activity laccase is of great significance for improving the decomposition efficiency of the organic fertilizer.
Disclosure of Invention
Aiming at the technical problems that the degradation capability of the currently selected lignin degrading bacteria is poor and the organic fertilizer decomposition efficiency is low, the invention provides the trichoderma atroviride Ta102, the multifunctional organic fertilizer and the application thereof, the trichoderma atroviride Ta102 is separated and screened from the fermentation product of the corn straw-cow dung compost laccase in the activity peak period, the high-activity laccase can be efficiently and stably produced, and the decomposition efficiency of the organic fertilizer is greatly improved.
In a first aspect, the invention provides Trichoderma atroviride Ta102, wherein the Trichoderma atroviride Ta102 has been deposited in China general microbiological culture Collection center, the deposition address is No. 1 Xilu Beijing Hospital, chaoyang, the date of deposition is 2022 years, 7 months and 13 days, and the number of deposition is CGMCC No.40242.
In a second aspect, the invention provides an application of producing high-activity laccase, manganese peroxidase, hemicellulase and cellulase by using the trichoderma atroviride Ta 102.
Experiments show that in Trichoderma atroviride Ta102, the enzyme activity of the high-activity laccase is 396.50IU/mL, the activity of the manganese peroxidase is 2.96IU/mL, the activity of the hemicellulase is 60.41IU/mL, and the activity of the cellulase is 3.25IU/mL. Manganese peroxidase participates in lignin depolymerization, hemicellulase participates in decomposing hemicellulose, cellulase participates in decomposing cellulose, and high-activity laccase participates in both lignin depolymerization and mineralization processes. The trichoderma atroviride Ta102 with the compound degrading enzyme system can be used for efficiently preparing organic fertilizers, and the decomposing time is only 9-12 days.
In a third aspect, the invention provides an application of the trichoderma atroviride Ta102 in production of indoleacetic acid. Experiments have shown that T.atroviridae Ta102 produces indoleacetic acid at a level of 153.42 μ g/L.
In a fourth aspect, the invention provides an application of the trichoderma atroviride Ta102 in inhibiting rhizoctonia solani, fusarium oxysporum or fusarium moniliforme.
The bacteriostasis rate of the trichoderma atroviride Ta102 to rhizoctonia solani is 100.00% + -0.00%, the bacteriostasis rate to fusarium oxysporum is 100.00% + -0.00%, and the bacteriostasis rate to fusarium moniliforme is 75.85% + -4.62%.
In a fifth aspect, the invention provides an application of the trichoderma atroviride Ta102 in fermentation preparation of an organic fertilizer.
In a sixth aspect, the invention provides a multifunctional organic fertilizer, which comprises, by weight, 0.1-0.5 parts of Trichoderma atroviride Ta102 wettable powder, 100-150 parts of cow dung, and 30-E E.straw ground40 parts, wherein the effective viable count of the Trichoderma atroviride Ta102 wettable powder is more than or equal to 8 multiplied by 10 9 cfu/g；
The preparation method comprises controlling the water-material ratio to be 1 (0.7 + -0.05), controlling the initial pH value to be 6 + -0.5, stacking and fermenting at normal temperature for 9-12 days, turning the stack once every 3 days, drying and pulverizing after fermentation.
Further, the Trichoderma atroviride Ta102 wettable powder is prepared according to the following preparation method:
(1) Preparing a seed solution: inoculating Trichoderma atroviride Ta102 preserved at-80 ℃ to a PDA (personal digital assistant) plate, activating for 3 days at 26-30 ℃, taking hyphae from the edge of a colony to inoculate the hyphae to the PDA plate, culturing for 3 days at 26-30 ℃, and repeatedly taking the hyphae to culture once to obtain an activated strain; culturing the activated strain on PDA plate at 26-30 deg.C for 7-12 days under 12h light-12 h dark condition to prepare 10 7 The seed solution was obtained by inoculating a conidium suspension of 1/mL to a PDB culture solution at a volume ratio of 1 5 ～9×10 5 cfu/mL；；
(2) Preparation of trichoderma atroviride Ta102 bacterial powder: 15-25% of seed liquid by volume percentage is inoculated into a fermentation tank filled with a liquid fermentation culture medium for fermentation, the fermentation temperature is 27-33 ℃ before 12 hours, the fermentation temperature is 25-30 ℃ after 12 hours, the initial pH is 4.0-5.0, the stirring speed is 200-300 rpm, the ventilation volume is 10-15L/min, and the fermentation time is 72-96 hours; the number of viable bacteria in the fermentation product is 1 × 10 9 ～8×10 9 cfu/mL; vacuum freeze drying the fermented liquid to obtain Trichoderma atroviride Ta102 powder with viable count not less than 2 × 10 10 cfu/g；
(3) Preparation of Trichoderma atroviride Ta102 wettable powder: mixing the Trichoderma atroviride Ta102 strain powder with an auxiliary agent according to the following parts by weight: 50-70 parts of trichoderma atroviride Ta102 bacterial powder, 40-60 parts of diatomite, 3-5 parts of wetting agent, 4-6 parts of dispersing agent, 0.3-0.6 part of adhesive and 1.5-2.5 parts of zinc sulfate, and uniformly mixing to prepare the trichoderma atroviride Ta102 wettable powder.
Further, in the step (2), the liquid fermentation medium comprises the following components in parts by weight: 70 to 200 portions of blasting corn straw powder,40-80 parts of blasting vegetable straw powder, 45-65 parts of wheat bran powder, 15-40 parts of glucose, (NH) 4 ) 2 SO 4 1 to 1.5 portions of KH 2 PO 4 0.03 to 0.05 portion of MgSO 4 ·7H 2 0.04 to 0.06 portion of O and 6000 to 8000 portions of water.
In a seventh aspect, the invention provides an application of the multifunctional organic fertilizer in inhibiting strawberry rhizoctonia root rot, strawberry fusarium root rot, tomato damping off and/or tomato fusarium wilt.
In an eighth aspect, the invention provides an application of the multifunctional organic fertilizer in promoting the growth of strawberries or tomatoes.
The invention has the beneficial effects that:
1. the trichoderma atroviride Ta102 provided by the invention has high-activity laccase and a composite degrading enzyme system, and can shorten the preparation and decomposition time of an organic fertilizer to 9-12 days.
2. The trichoderma atroviride Ta102 provided by the invention can inhibit rhizoctonia solani, fusarium oxysporum or fusarium moniliforme, can also produce 153.42 mu g/L indoleacetic acid, and an organic fertilizer prepared by fermenting the trichoderma atroviride Ta102 has the functions of inhibiting soil-borne diseases such as rhizoctonia solani and root rot and promoting growth.
3. Compared with a composite bacterial system constructed by multiple strains, the process for preparing the multifunctional organic fertilizer by using the Trichoderma atroviride Ta102 has lower requirement on fermentation conditions, is beneficial to simplifying the preparation process of the organic fertilizer and reducing the cost.
Drawings
In order to more clearly illustrate the embodiments or technical solutions in the prior art of the present invention, the drawings used in the description of the embodiments or prior art will be briefly described below, and it is obvious for those skilled in the art that other drawings can be obtained based on these drawings without creative efforts.
FIG. 1 is a diagram showing the colony status of Ta102 in example 1 of the present invention.
FIG. 2 is a graph showing the results of plate screening in example 2 of the present invention.
In the figure, A is a colony front view, B is a colony back view, C is a guaiacol plate screening result view, D is an aniline blue plate screening result view, E is a CMC plate screening result view, and F is a xylan plate screening result view.
Detailed Description
In order to make those skilled in the art better understand the technical solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 isolation and characterization of the strains
(1) The strain source is as follows: the fermentation product of the corn straw-cow dung compost laccase in the activity peak period is collected in a Shandong Jinnan compost field in 5 months in 2020.
(2) Strain separation: the collected fermentation sample was diluted to 10 with a gradient of sterile water containing 0.3% tween-80 -1 ～10 -7 mu.L of each of the gradient dilutions was plated on sodium rose agar and incubated at 28 ℃ for 3 days. From each plate diluted in a gradient, a single colony was picked for identification.
(3) Species were identified by morphological microscopic observation and alignment with endogenous transcribed spacers (ITS). Among them, the strain numbered Ta102 was the dominant strain isolated.
The colony status of Ta102 is shown in FIG. 1, and the ITS gene sequence of Ta102 is:
GCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTTCAGAAGTTGGGTGTTTTACGGACGTGGACGCGCCGCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGGGCCGGGATCCCGTCTTAGGGGCTCCCGAGGTCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAAATAACGTCCGCGAGGGGACTACAGAAAAGAGTTTGGTTGGTCCCTCCGGCGGGCGCCTGGTTCCGGGGCTGCGACGCACCCGGGGCGTGACCCCGCCGAGGCAACAGTTTGGTATGGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGT。
the strain with the number of Ta102 is identified as Trichoderma atroviride (Trichoderma atroviride), and is preserved in the China general microbiological culture Collection center with the preservation address: the collection date of No. 1 Xilu Beijing, chaoyang, beijing, in Beicheng, is 2022, 7 months and 13 days, and the collection number is CGMCC No.40242.
Example 2 enzymatic Activity assay identification of Trichoderma atroviride Ta102
(1) Taking the dominant strain trichoderma atroviride Ta102 separated in the embodiment 1, and culturing the dominant strain on a PDA flat plate at the constant temperature of 26 ℃ for 3 days;
(2) The qualitative detection of the lignocellulose degrading enzyme is carried out by adopting a flat plate, and the process is as follows:
(1) screening of strain for producing laccase by guaiacol flat plate
a. Preparing guaiacol flat plates: filtering guaiacol separately to sterilize to obtain 1% mother liquor (25 times), adding 0.01% volume concentration of 0.1g/L CuSO under aseptic condition 4 The PDA culture medium of (1) is prepared by pouring the plate and cooling.
b. The colony cultured on PDA plate is taken by aseptic puncher and inoculated on guaiacol plate, 3 plates are prepared for repeating, inverted culture is carried out at 27 +/-1 ℃, brick red pigment generation is recorded on the guaiacol plate, and brick red pigment generation is recorded as + and vice versa. And selecting strains with strong laccase producing capacity according to the diameter of the pigment producing area, and recording the time.
After cultivation, trichoderma atroviride Ta102 produced a distinct brick-red pigment in guaiacol plate medium, with a pigment diameter of 9cm (full of plate) on day 4, as shown in panel C of FIG. 2.
(2) Screening strain for producing manganese peroxidase by aniline blue plate
a. Preparing aniline blue plates: separately filtering RB brilliant blue to sterilize into 2% mother liquor (200 times), adding into 0.01% volume concentration of 0.1g/L CuSO under aseptic condition 4 PDA cultureAnd (5) pouring the mixture into a flat plate and cooling the mixture to obtain the nutrient medium.
b. Taking the colony cultured on the PDA plate by using a sterile puncher, inoculating the colony on an aniline blue plate, preparing 3 plates for repeated culture, performing inverted culture at the temperature of 27 +/-1 ℃, recording whether the phenomenon of decoloration and transparence exists on the aniline blue plate, and recording the decoloration as plus or minus on the aniline blue plate. According to the diameter of the transparent area, the strain with strong capacity of producing manganese peroxidase is selected, and the time is recorded.
After cultivation, trichoderma atroviride Ta102 was decolorized and cleared in aniline blue plate medium, and the clear zone on day 4 was 4.04cm in diameter, as shown in FIG. 2D.
(3) Screening strains for producing cellulase on a CMC flat plate:
CMC plate medium: CMC 10g, (NH) 4 ) 2 SO 4 4g，KH 2 PO 4 2g，MgSO 4 ·7H 2 0.5g of O, 1.0g of peptone, 16g of agar, 0.5g of deoxysodium cholate and 1000ml of distilled water, and autoclaving at 121 ℃ for 20min.
b. Taking the colony cultured on the PDA plate by using a sterile puncher, inoculating the colony on a CMC plate, preparing 3 plates for repeating, carrying out inverted culture for 4 days at the temperature of 27 +/-1 ℃, then covering the plate with 0.1% Congo red dye solution, standing for 30min, decoloring for 1h by using 1mol/LNaCl, and observing whether each strain generates a hydrolysis transparent ring. Selecting the bacterial strain with strong cellulase producing capability according to the diameter of the hydrolysis transparent ring.
After cultivation, trichoderma atroviride Ta102 produced a hydrolytically transparent loop in CMC medium, with a diameter of 3.09cm on day 4, see FIG. 2, panel E.
(4) Screening of strain for producing hemicellulase by xylan plate
a. Xylan plate medium: (NH) 4 ) 2 SO 4 2g，MgSO 4 ·7H 2 O 0.5g，KH 2 PO 4 1g, naCl 0.5g, xylan 2g, agar 20g, distilled water 1000mL, natural pH value, 121 ℃ high pressure sterilization for 20min.
b. Taking the colony cultured on the PDA plate by using a sterile puncher, inoculating the colony on a xylan plate, preparing 3 plates, repeating, and performing inverted culture at 25 +/-1 ℃ for 4 days; then covering the flat plate with 0.1% Congo red dye solution, standing for 10min, decoloring for 2-3 times by using 2mol/L NaCl, and observing whether each strain generates a hydrolysis transparent circle. Selecting the strain with strong capability of producing the hemicellulase according to the diameter of the hydrolysis transparent ring.
After cultivation, trichoderma atroviride Ta102 produced a hydrolytic clearing circle in xylan medium, with a clearing circle diameter of 6.24cm on day 4, see panel F in FIG. 2.
The screening of a flat plate shows that the Trichoderma atroviride Ta102 has laccase, manganese peroxidase, cellulase and hemicellulase.
Example 3 quantitative determination of the Activity of the degrading enzyme of Trichoderma atroviride Ta102
(1) And (3) laccase activity detection: activation of Ta102 Strain on PDA plates 1X 10 preparation 7 Culturing the conidium suspension per mL at the temperature of 27 +/-1 ℃ and the rpm of 160 for 5 days to obtain fermentation liquor; the fermentation broth was centrifuged at 12000rpm for 20min at 4 ℃ to give a crude enzyme supernatant.
The reaction was initiated by adding 0.7mL of ABTS buffer (3 mmol/L ABTS,0.1mol/L acetic acid-sodium acetate buffer pH = 4.5) to 0.7mL of the crude enzyme solution, and the change in absorbance within L0min was measured at a wavelength of 420 nm. The amount of enzyme required to convert l. Mu. Mol of ABTS per minute is defined as one activity unit. Three replicates were set up. Through detection, the laccase activity of the Trichoderma atroviride Ta102 is 396.50IU/mL,
(2) detecting the activity of manganese peroxidase: activation of Ta102 Strain on PDA plates 1X 10 preparation 7 Inoculating the conidium suspension per mL into veratryl alcohol culture solution according to the volume ratio of 1%, and culturing at 26 + -1 deg.C and 160rpm for 5 days to obtain fermentation broth; the fermentation broth was centrifuged at 12000rpm for 20min at 4 ℃ to give a crude enzyme supernatant.
Mixing 400 mu L of crude enzyme solution to be detected, 3.4mL of 50mmol/L sodium lactate buffer solution and 0.1mL of 1.6mmol/L manganese sulfate solution to obtain reaction solution, preheating in 37 ℃ water bath, and adding 1.6mmol/L H 2 O 2 The reaction was started with 0.1mL of the solution, and the absorbance at 240nm was measured quickly and again 1 time after 4 min.
1 mu mol/L of Mn in 1min 2+ Conversion to Mn 3+ Is 1 enzyme activity unit. Takes sterilized fermentation liquor as pairThree replicates were set up. Through detection, the activity of the manganese peroxidase of the Trichoderma atroviride Ta102 is 2.96IU/mL.
(3) And (3) detecting the activity of the cellulase: activation of Ta102 Strain on PDA plates 1X 10 preparation 7 Inoculating the conidium suspension per mL into CMC culture solution (obtained by removing agar from CMC solid culture medium) according to the volume ratio of 1%, and culturing at 26 + -1 deg.C and 160rpm for 7 days to obtain fermentation liquid. The fermentation broth was centrifuged at 12000rpm for 10min at 4 ℃ and the supernatant was the crude enzyme. 400. Mu.L of citric acid-Na 2HPO4 buffer (pH = 4.5) containing 1% (w/v) CMC was added to a 2mL Eppendorf tube, and after preheating in a 50 ℃ water bath for 3min, 100. Mu.L of the crude enzyme solution was added, and after 30min of incubation, 1mL of DNS reagent was added to terminate the reaction, after shaking sufficiently, the mixture was subjected to boiling water bath for 5min, and after cooling in cold water, the absorbance at a wavelength of 540nm was measured. Sterilized fermentation broth was used as control. Three replicates were set up. Through detection, the cellulase activity of Trichoderma atroviride Ta102 is 3.25IU/mL.
(4) And (3) detecting the activity of the hemicellulase: activation of Trichoderma atroviride Ta102 on PDA plates, preparation of 1X 10 7 Inoculating the conidium suspension per mL into xylan culture solution (obtained by reducing agar from xylan solid culture medium) according to the volume ratio of 1%, and culturing at 26 + -1 deg.C and 160rpm for 7 days to obtain fermentation liquor. 0.5mL of 20-fold diluted fermentation broth was aspirated, added to a 1% xylan solution prepared with disodium hydrogen phosphate-lemon buffer (pH = 4.8), and subjected to enzymatic hydrolysis at 50 ℃ for 30min. Adding 3mL of DNS reagent after enzymolysis, heating in a boiling water bath for 5min, then rapidly cooling with ice water, adding distilled water to 25mL, measuring absorbance at 540nm, setting three biological repetitions, and calculating according to the following formula by taking sterilized fermentation broth as a reference:
in the formula: w is the content of xylose produced by enzymolysis, mg;
n is the dilution multiple of the fermentation liquor;
enzymolysis time 30, min;
v is the volume of the reaction solution, mL.
Through detection, the hemicellulase activity of Trichoderma atroviride Ta102 is 60.41IU/mL.
(5) And (3) measuring the content of the indoleacetic acid: activation of Ta102 Strain on PDA plates 1X 10 preparation 7 Culturing the conidium suspension per mL at the temperature of 27 +/-1 ℃ and the rpm of 160 for 5 days to obtain fermentation liquor; the fermentation broth was centrifuged at 12000rpm for 20min at 4 ℃ to obtain the supernatant. And detecting the content of the indoleacetic acid in the fermentation supernatant by using GC-MS. The detection proves that the indoleacetic acid yield of the Trichoderma atroviride Ta102 is 153.42 mu g/L.
Example 4 antagonistic action of Trichoderma atroviride Ta102 against Rhizoctonia solani, fusarium oxysporum or Fusarium moniliforme
The trichoderma atroviride Ta102 and rhizoctonia solani, fusarium oxysporum or fusarium moniliforme are respectively inoculated into a PDA (personal digital assistant) plate together, activated twice at 25 ℃, and after the second activation and growth for 3 days, a 5mm puncher is used for punching a bacterial cake from the edge of a bacterial colony. Placing Trichoderma atroviride Ta102 and Rhizoctonia solani at two ends of the central line of the same 9cm PDA flat plate, and recording the number A of the flat plate; placing Trichoderma atroviride Ta102 and Fusarium oxysporum at two ends of the center line of the same 9cm PDA plate, and recording the plate number B; placing Trichoderma atroviride Ta102 and Fusarium moniliforme at two ends of the center line of the same 9cm PDA plate, and recording the plate number C; the plates numbered A, B and C were all cultured at 25 ℃ for 6 to 8 days, and the distance T (unit: cm) from the growth front of Ta102 to the pathogenic fungus cake was measured. The distance C (unit: cm) from the front end of the growth of the pathogenic bacteria to the pathogenic bacteria cake was measured in comparison with a plate on which three kinds of pathogenic bacteria were cultured alone. Each plate is provided with 5 biological replicates, and the bacteriostatic rate calculation formula is as follows:
the measurement result shows that the bacteriostasis rate of the trichoderma atroviride Ta102 to rhizoctonia solani is 100.00% + -0.00%, the bacteriostasis rate to fusarium oxysporum is 100.00% + -0.00%, and the bacteriostasis rate to fusarium moniliforme is 75.85% + -4.62%. The result shows that the trichoderma atroviride Ta102 has obvious antagonistic action on the three pathogenic bacteria.
Example 6 preparation of Trichoderma atroviride Ta102 inoculant and multifunctional organic fertilizer
(1) Preparing a seed solution: inoculating Trichoderma atroviride Ta102 preserved at-80 ℃ to a PDA (personal digital assistant) plate, activating for 3 days at 26 ℃, taking hyphae from the edge of a colony and inoculating the hyphae to the PDA plate, culturing for 3 days at 26 ℃, and repeatedly taking the hyphae and culturing once to obtain an activated strain; culturing the activated strain on PDA plate at 26 deg.C under 12h light-12 h dark condition for 7 days to obtain 10 7 The seed solution was obtained by inoculating a conidium suspension per mL in a PDB culture solution at a volume ratio of 1 5 cfu/mL；；
(2) Preparation of trichoderma atroviride Ta102 bacterial powder:
a. preparing a liquid fermentation culture medium, which comprises the following components in parts by weight: 70 parts of blasting corn straw powder, 40 parts of blasting vegetable straw powder, 45 parts of wheat bran powder, 15 parts of glucose, (NH) 4 ) 2 SO 4 1 part of KH 2 PO 4 0.03 part of MgSO (MgSO) 4 ·7H 2 0.04 part of O and 6000 parts of water.
b. Inoculating 15% of seed liquid by volume into a fermentation tank filled with a liquid fermentation culture medium for fermentation, wherein the fermentation temperature is 27 ℃ before 12 hours, the fermentation temperature is 25 ℃ after 12 hours, the initial pH is 4.0, the stirring speed is 200rpm, the ventilation quantity is 10L/min, and the fermentation time is 72 hours; the number of viable bacteria in the fermentation product is 1 × 10 9 cfu/mL; vacuum freeze drying the fermented liquid to obtain Trichoderma atroviride Ta102 powder with viable count not less than 2 × 10 10 cfu/g；
(3) Preparation of Trichoderma atroviride Ta102 wettable powder: mixing the Trichoderma atroviride Ta102 strain powder with an auxiliary agent according to the following parts by weight: 50 parts of trichoderma atroviride Ta102 bacterial powder, 40 parts of diatomite, 3 parts of tween-80, 4 parts of sodium methylene dinaphthalene sulfonate, 0.5 part of starch paste and 1.5 parts of zinc sulfate are uniformly mixed to prepare the trichoderma atroviride Ta102 wettable powder, wherein the effective viable count is more than or equal to 8 multiplied by 10 9 cfu/g。
(4) Preparing a multifunctional organic fertilizer: the raw materials are fully mixed according to the following parts by weight: 0.1 part of trichoderma atroviride Ta102 wettable powder, 100 parts of cow dung and 30 parts of crushed corn straw, wherein the water-material ratio is 1.7, the initial pH value is 6, the mixture is piled up and fermented for 12 days at normal temperature, the pile is turned over once every 3 days, and the mixture is dried and crushed after the fermentation is finished.
Example 7 preparation of Trichoderma atroviride Ta102 microbial inoculum and multifunctional organic fertilizer
(1) Preparing a seed solution: inoculating Trichoderma atroviride Ta102 preserved at-80 ℃ to a PDA (personal digital assistant) plate, activating at 30 ℃ for 3 days, taking hyphae from the edge of a colony to inoculate the PDA plate, culturing at 230 ℃ for 3 days, and repeatedly taking the hyphae for culturing once to obtain an activated strain; culturing the activated strain on PDA plate at 30 deg.C for 12 days under 12h light-12 h dark condition to obtain 1 × 10 7 The seed solution was obtained by inoculating a conidium suspension/mL in a PDB culture solution at a volume ratio of 1:100, and shake-culturing at 26 ℃ and 180rpm for 72 hours, the viable cell count of the seed solution being 9X 10 5 cfu/mL；；
(2) Preparation of trichoderma atroviride Ta102 bacterial powder:
a. preparing a liquid fermentation culture medium, which comprises the following components in parts by weight: 200 parts of blasting corn straw powder, 80 parts of blasting vegetable straw powder, 65 parts of wheat bran powder, 40 parts of glucose, (NH) 4 ) 2 SO 4 1.5 parts of KH 2 PO 4 0.05 part of MgSO 2 4 ·7H 2 0.06 part of O and 8000 parts of water.
b. Inoculating 25% of seed liquid by volume into a fermentation tank filled with a liquid fermentation culture medium for fermentation, wherein the fermentation temperature is 33 ℃ before 12 hours, 30 ℃ after 12 hours, the initial pH is 5.0, the stirring speed is 300rpm, the ventilation volume is 15L/min, and the fermentation time is 96 hours; the number of viable bacteria in the fermentation product is 8 × 10 9 cfu/mL; vacuum freeze drying the fermented liquid to obtain Trichoderma atroviride Ta102 powder with viable count not less than 2 × 10 10 cfu/g；
(3) Preparation of Trichoderma atroviride Ta102 wettable powder: mixing the Trichoderma atroviride Ta102 strain powder with an auxiliary agent according to the following parts by weight: 70 parts of trichoderma atroviride Ta102 bacterial powder, 60 parts of diatomite, 5 parts of tween-80, 6 parts of sodium methylene dinaphthalene sulfonate, 0.6 part of starch paste and 2.5 parts of zinc sulfate are uniformly mixed to prepare the trichoderma atroviride Ta102 wettable powder, wherein the effective viable count is more than or equal to 8 multiplied by 10 9 cfu/g。
(4) Preparing a multifunctional organic fertilizer: the raw materials are fully mixed according to the following parts by weight: 0.5 part of Trichoderma atroviride Ta102 wettable powder, 150 parts of cow dung and 40 parts of crushed corn straw, wherein the water-material ratio is controlled to be 0.75, the initial pH value is 6 +/-0.5, the materials are piled and fermented for 9 days at normal temperature, the piles are turned over once every 3 days, and the materials are dried and crushed after the fermentation is finished.
Example 8 preparation of Trichoderma atroviride Ta102 microbial inoculum and multifunctional organic fertilizer
(1) Preparing a seed solution: inoculating Trichoderma atroviride Ta102 preserved at-80 ℃ to a PDA (personal digital assistant) plate, activating at 28 ℃ for 3 days, taking hyphae from the edge of a colony, inoculating the hyphae to the PDA plate, culturing at 28 ℃ for 3 days, and repeatedly taking the hyphae for culturing once to obtain an activated strain; culturing the activated strain on PDA plate at 28 deg.C for 9 days under 12h light-12 h dark condition, and preparing 10 7 The seed solution was obtained by inoculating a conidium suspension of one seed/mL into a PDB culture solution at a volume ratio of 1 5 cfu/mL；；
(2) Preparation of trichoderma atroviride Ta102 bacterial powder:
a. preparing a liquid fermentation culture medium, which comprises the following components in parts by weight: 100 parts of blasting corn straw powder, 60 parts of blasting vegetable straw powder, 50 parts of wheat bran powder, 25 parts of glucose, (NH) 4 ) 2 SO 4 1.2 parts of KH 2 PO 4 0.04 part of MgSO 2 4 ·7H 2 0.05 part of O and 7000 parts of water.
b. Inoculating the seed liquid with 20% volume percentage into a fermentation tank filled with a liquid fermentation culture medium for fermentation, wherein the fermentation temperature is 30 ℃ before 12 hours, the fermentation temperature is 27 ℃ after 12 hours, the initial pH is 5.0, the stirring speed is 250rpm, the ventilation volume is 12L/min, and the fermentation time is 85 hours; the number of viable bacteria in the fermentation product is 5 × 10 9 cfu/mL; vacuum freeze drying the fermented liquid to obtain Trichoderma atroviride Ta102 powder with viable count not less than 2 × 10 10 cfu/g；
(3) Preparation of Trichoderma atroviride Ta102 wettable powder: mixing the Trichoderma atroviride Ta102 strain powder with an auxiliary agent according to the following parts by weight: 60 parts of trichoderma atroviride Ta102 bacterial powder, 50 parts of kieselguhr, 4 parts of tween-80, 5 parts of methylene dinaphthalene sodium sulfonate, 0.5 part of starch paste and sulfur2 portions of zinc and evenly mixed to prepare the Trichoderma atroviride Ta102 wettable powder, the effective viable count of which is more than or equal to 8 multiplied by 10 9 cfu/g。
(4) Preparing a multifunctional organic fertilizer: the raw materials are fully mixed according to the following parts by weight: 0.3 part of Trichoderma atroviride Ta102 wettable powder, 120 parts of cow dung and 35 parts of crushed corn straws, wherein the water-material ratio is controlled to be 0.7, the initial pH value is 6 +/-0.5, the materials are piled and fermented for 10 days at normal temperature, the piles are turned over once every 3 days, and the materials are dried and crushed after the fermentation is finished.
Example 9 field test of applying multifunctional organic fertilizer to strawberry planting
(1) Test site: in the strawberry greenhouse in the historic city region of Jinan city, shandong province, the tested strawberry is of the red color.
(2) The test contents are as follows:
(1) a plurality of cells are arranged, and each cell has an area of 10m 2 Guard rows are spaced between cells.
(2) The cells are randomly divided into four groups, namely a treatment group, a comparison group 1, a comparison group 2 and a blank comparison group, wherein each group comprises five cells, and the treatment is as follows:
treatment group: the applied organic fertilizer is the multifunctional organic fertilizer prepared in example 6;
control group 1: the applied organic fertilizer is prepared by the same method as the embodiment 6, but the preparation process does not add Trichoderma atroviride Ta102 microbial inoculum;
control group 2: the applied organic fertilizer is the organic fertilizer prepared by the same method as the embodiment 6, but in the preparation process, the Trichoderma atroviride Ta102 microbial inoculum is replaced by a commercial decomposed leavening agent (the active ingredients are bacillus subtilis, saccharomyces cerevisiae and Trichoderma longibrachiatum, and the total number of the live bacteria is>2×10 9 cfu/g)。
Blank control group: no organic fertilizer is applied.
The fertilizer application modes of the treatment group, the control group 1 and the control group 2 in strawberry planting are all unified operation and are conventional application modes, namely 400 kg/mu before field planting, 20 kg/mu before flowering and 40 kg/mu in fruit stage.
(3) And (3) result statistics and analysis:
a. in the seedling stage of the strawberry, 10 plants are respectively taken at random in each treatment to determine the strong seedling index and the acre yield.
Wherein the content of the first and second substances,
b. in the harvest period of the strawberries, the disease condition of the strawberries is investigated, and the prevention and treatment effects are respectively calculated in a statistical manner through each treatment, wherein the formula is as follows:
wherein, the disease index I is the disease index of the blank control group, and the disease index II is the disease index of the treatment group or the control group 1 or the control group 2.
The disease condition of the rhizoctonia solani root rot (caused by rhizoctonia solani) is classified and referred to as prediction, prediction and prevention of main crop diseases and pests, and the disease condition of the rhizoctonia solani (caused by fusarium oxysporum) is classified and referred to as NY/T1464.16-2007 pesticide field efficacy test criteria.
The results are shown in table 1:
TABLE 1 application of multifunctional organic fertilizer to strawberry cultivation effect
Note: letter disagreement indicates a significant difference (P < 0.05).
The multifunctional organic fertilizer (treatment group) prepared by the trichoderma atroviride Ta102 is obviously higher than each control group in seedling strengthening index, yield and control effect on rhizoctonia solani root rot and fusarium root rot of strawberries, and the multifunctional organic fertilizer (treatment group) is proved to have excellent functions of inhibiting the rhizoctonia solani root rot and fusarium root rot of strawberries and promoting the growth of strawberries.
Example 10 application of multifunctional organic fertilizer to field test for tomato planting
(1) Test site: in the tomato greenhouse in the historic city region of Jinan city, shandong, the tested tomato variety is the pink tomato.
(2) The test contents are as follows:
(1) setting a plurality of cells, each cell having an area of 10m 2 Guard rows are arranged among the cells, and all the processing cells are randomly arranged.
(2) Dividing the cells into four groups, namely a treatment group, a comparison group 1, a comparison group 2 and a blank comparison group, wherein each group comprises five cells, and the specific treatment comprises the following steps:
treatment group: the applied organic fertilizer is the multifunctional organic fertilizer prepared in example 7;
control group 1: the applied organic fertilizer is the organic fertilizer prepared by the same method as the embodiment 7, but the preparation process does not add Trichoderma atroviride Ta102 microbial inoculum;
control group 2: the applied organic fertilizer is the organic fertilizer prepared by the same method of the embodiment 7, but in the preparation process, the Trichoderma atroviride Ta102 microbial agent is replaced by a commercial decomposed leavening agent (the active ingredients are Bacillus subtilis, saccharomyces cerevisiae and Trichoderma longibrachiatum, and the total number of the live bacteria is>2×10 9 cfu/g)
Blank control group: no organic fertilizer is applied.
The fertilizer application modes of the treatment group, the control group 1 and the control group 2 in tomato planting are all unified operation and are conventional application modes, namely 500 kg/mu is applied before planting.
(3) And (3) result statistics and analysis:
a. in the tomato seedling stage, 10 plants are respectively and randomly taken in each treatment to determine the strong seedling index and the acre yield.
Wherein the content of the first and second substances,
b. in the tomato harvesting period, the tomato disease condition is investigated, the control effect is statistically calculated respectively in each treatment, and the formula is as follows:
wherein, the disease index I is the disease index of the blank control group, and the disease index II is the disease index of the treatment group or the control group 1 or the control group 2.
Wherein, the disease condition of tomato damping off (caused by rhizoctonia solani) is referred to 'prediction and prevention of main crop diseases and insect pests', and the disease condition of tomato damping off (caused by fusarium oxysporum and fusarium moniliforme) is referred to 'NY/T1464.16-2007 pesticide field efficacy test criteria'.
The results are shown in table 2:
TABLE 2 planting effect of tomato with multifunctional organic fertilizer
Note: letter disagreement indicates a significant difference (P < 0.05).
The multifunctional organic fertilizer (treatment group) prepared by using the trichoderma atroviride Ta102 is obviously higher than each control group in seedling strengthening index and control effects on tomato damping-off and tomato blight, is obviously higher than a blank control group and a control group 1 in yield, and is improved but not obvious compared with a control group 2 which applies a commodity decomposed fermentation group.
Although the present invention has been described in detail by referring to the drawings in connection with the preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made on the embodiments of the present invention by those skilled in the art without departing from the spirit and scope of the present invention, and these modifications or substitutions should be within the scope of the present invention/any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present disclosure and the scope of the present invention.
Claims (10)
1. Trichoderma atroviride Ta102 is characterized in that Trichoderma atroviride Ta102 has been preserved in China general microbiological culture Collection center, the preservation address is No. 1 Hospital of North West Lu of the sunward district, beijing, the preservation date is 2022 years, 7 months and 13 days, and the preservation number is CGMCC No.40242.
2. The use of Trichoderma atroviride Ta102 as claimed in claim 1 in the production of highly active laccases, manganese peroxidases, hemicellulases, cellulases using Trichoderma atroviride Ta 102.
3. Use of trichoderma atroviride Ta102 according to claim 1 for the production of indoleacetic acid using trichoderma atroviride Ta 102.
4. Use of trichoderma atroviride Ta102 according to claim 1 for the inhibition of rhizoctonia solani, fusarium oxysporum or fusarium moniliforme by trichoderma atroviride Ta 102.
5. The application of Trichoderma atroviride Ta102 as claimed in claim 1, wherein Trichoderma atroviride Ta102 is used for fermentation to prepare organic fertilizer.
6. A multifunctional organic fertilizer is characterized in that the raw materials comprise, by weight, 0.1-0.5 part of Trichoderma atroviride Ta102 wettable powder, 100-150 parts of cow dung and 30-40 parts of crushed corn straw, wherein the effective viable count of the Trichoderma atroviride Ta102 wettable powder is more than or equal to 8 multiplied by 10 9 cfu/g；
The preparation method comprises controlling the water-material ratio to be 1 (0.7 + -0.05), controlling the initial pH value to be 6 + -0.5, stacking and fermenting at normal temperature for 9-12 days, turning the stack once every 3 days, drying and pulverizing after fermentation.
7. The multifunctional organic fertilizer as claimed in claim 6, wherein the wettable powder of trichoderma atroviride Ta102 is prepared by the following preparation method:
(1) Preparing a seed solution: inoculating Trichoderma atroviride Ta102 preserved at the temperature of minus 80 ℃ to a PDA flat plate, activating for 3 days at the temperature of 26-30 ℃, taking hyphae from the edge of a colony, inoculating the hyphae to the PDA flat plate, culturing for 3 days at the temperature of 26-30 ℃, and repeatedly taking the hyphae for one-time culture to obtain an activated strain; culturing the activated strain on PDA plate at 26-30 deg.C for 7-12 days under 12h light-12 h dark condition to prepare 10 7 The seed solution was obtained by inoculating a conidium suspension of 1/mL to a PDB culture solution at a volume ratio of 1 5 ～9×10 5 cfu/mL；
(2) Preparation of trichoderma atroviride Ta102 bacterial powder: 15-25% of seed liquid by volume percentage is inoculated into a fermentation tank filled with a liquid fermentation culture medium for fermentation, the fermentation temperature is 27-33 ℃ before 12 hours, the fermentation temperature is 25-30 ℃ after 12 hours, the initial pH is 4.0-5.0, the stirring speed is 200-300 rpm, the ventilation volume is 10-15L/min, and the fermentation time is 72-96 hours; the number of viable bacteria in the fermentation product is 1 × 10 9 ～8×10 9 cfu/mL; vacuum freeze drying the fermented liquid to obtain Trichoderma atroviride Ta102 powder with viable count not less than 2 × 10 10 cfu/g；
(3) Preparation of Trichoderma atroviride Ta102 wettable powder: mixing the Trichoderma atroviride Ta102 strain powder with an auxiliary agent according to the following parts by weight: 50-70 parts of trichoderma atroviride Ta102 bacterial powder, 40-60 parts of diatomite, 3-5 parts of wetting agent, 4-6 parts of dispersing agent, 0.3-0.6 part of adhesive and 1.5-2.5 parts of zinc sulfate, and uniformly mixing to prepare the trichoderma atroviride Ta102 wettable powder.
8. The multifunctional organic fertilizer as claimed in claim 7, wherein in the step (2), the liquid fermentation medium comprises the following components in parts by weight: 70-200 parts of blasting corn straw powder, 40-80 parts of blasting vegetable straw powder, 45-65 parts of wheat bran powder, 15-40 parts of glucose, (NH) 4 ) 2 SO 4 1 to 1.5 portions of KH 2 PO 4 0.03 to 0.05 portion of MgSO 4 ·7H 2 0.04 to 0.06 portion of O and 6000 to 8000 portions of water.
9. The use of the multifunctional organic fertilizer as claimed in claim 6, characterized in that the multifunctional organic fertilizer is applied to inhibit rhizoctonia solani root rot of strawberry, fusarium root rot of strawberry, tomato damping off and/or tomato fusarium wilt.
10. The application of the multifunctional organic fertilizer as claimed in claim 6, wherein the multifunctional organic fertilizer is applied to promote the growth of strawberries or tomatoes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211426974.7A CN115820433A (en) | 2022-11-15 | 2022-11-15 | Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211426974.7A CN115820433A (en) | 2022-11-15 | 2022-11-15 | Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115820433A true CN115820433A (en) | 2023-03-21 |
Family
ID=85528158
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211426974.7A Pending CN115820433A (en) | 2022-11-15 | 2022-11-15 | Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820433A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117004495A (en) * | 2023-08-04 | 2023-11-07 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma atroviride T280, screening method and application thereof |
-
2022
- 2022-11-15 CN CN202211426974.7A patent/CN115820433A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117004495A (en) * | 2023-08-04 | 2023-11-07 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma atroviride T280, screening method and application thereof |
| CN117004495B (en) * | 2023-08-04 | 2024-06-11 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma atroviride T280, screening method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112322501B (en) | Trichoderma africanum Ta97 and application thereof in straw returning | |
| CN108315275B (en) | High-yield 'three-enzyme' straw decomposition agent and preparation method thereof | |
| CN101775359A (en) | Special microorganism composite bacterial agent for directly decomposing and fermenting crops straws to generate marsh gas and application method thereof | |
| CN1325635C (en) | Endogenetic polymexa bacillus of plant for prophyiaxis and promoting growth and application thereof | |
| CN106631248A (en) | Production process for bioorganic fertilizer with high bacteria content | |
| CN105754881B (en) | A kind of Irpex lacteus of degradable lignin and its application | |
| CN111073839B (en) | Siam bacillus, microbial inoculum and application thereof | |
| CN111620745B (en) | Method for producing bio-organic fertilizer by degrading agricultural wastes with biological agent | |
| US20230242868A1 (en) | Pseudomonas graminis strain capable of degrading cellulose at low temperature and use thereof | |
| CN111363684B (en) | Composite microbial inoculum for efficiently degrading wood fibers and application thereof in composting | |
| CN103255091B (en) | Composite bacteria inoculant capable of rapidly decomposing cotton stalk and preparation method thereof | |
| CN111334452B (en) | Compound bacterium agent for degrading livestock and poultry manure and application thereof | |
| CN114381378B (en) | Penicillium chrysogenum for degrading lignin and application thereof | |
| De los Santos-Villalobos et al. | Production of Trichoderma asperellum T8a spores by a" home-made" solid-state fermentation of mango industrial wastes. | |
| CN114231463A (en) | Preparation method of microbial agent and aerobic high-temperature composting of quail excrement | |
| CN109456918B (en) | Bacillus for quickly decomposing organic materials, application thereof and organic material decomposing agent | |
| CN115820433A (en) | Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof | |
| CN108865927B (en) | Bacterial strain for low-temperature glycolysis of corn straw and fermentation culture method and application thereof | |
| CN102050645A (en) | Method for producing trichoderma microbial fertilizer by utilizing sweet potato starch wastewater | |
| CN111154661B (en) | Complex microbial inoculant and application thereof | |
| CN104560817A (en) | Thermophilic bacillus licheniformis UTM102 for producing phytase and application of thermophilic bacillus licheniformis UTM102 | |
| CN107893042B (en) | Organic matter decomposing inoculant, preparation method and application thereof | |
| CN102040403A (en) | Production of trichoderma spp. microbial fertilizer by waste water of kitchen garbage | |
| CN111607404A (en) | Preparation method of probiotic soil conditioner and product thereof | |
| CN102352320B (en) | Novel myceliophthora thermophila strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |