CN115819486A - Arsenic-sulfydryl molecular beacon compound and application thereof - Google Patents

Arsenic-sulfydryl molecular beacon compound and application thereof Download PDF

Info

Publication number
CN115819486A
CN115819486A CN202210587979.1A CN202210587979A CN115819486A CN 115819486 A CN115819486 A CN 115819486A CN 202210587979 A CN202210587979 A CN 202210587979A CN 115819486 A CN115819486 A CN 115819486A
Authority
CN
China
Prior art keywords
arsenic
dna molecule
molecular beacon
atmb
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210587979.1A
Other languages
Chinese (zh)
Inventor
严晓文
谢鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiamen University
Original Assignee
Xiamen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiamen University filed Critical Xiamen University
Publication of CN115819486A publication Critical patent/CN115819486A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Saccharide Compounds (AREA)

Abstract

The invention discloses an arsenic-sulfydryl molecular beacon compound and application thereof, and the structural formula is
Figure DDA0003666627970000011
Or
Figure DDA0003666627970000012
The method successfully realizes the multiple reversible combination and dissociation of arsenic and micromolecule sulfhydryl compound lipoic acid regulated by the arsenic-sulfhydryl molecular beacon, and proves that the interaction strategy of regulating and controlling the arsenic and the sulfhydryl group by regulating and controlling the distance between the arsenic and the sulfhydryl group has high controllability, high stability and high reaction rate.

Description

Arsenic-sulfydryl molecular beacon compound and application thereof
Technical Field
The invention belongs to the technical field of research on arsenic-sulfydryl interaction, and particularly relates to an arsenic-sulfydryl molecular beacon compound and application thereof.
Background
Arsenic (As) is an environmental pollutant and exposure to arsenic from drinking water, air, food, etc. affects human health. Arsenic toxicity is derived primarily from trivalent arsenic (As) III ) The protein has higher affinity with protein sulfhydryl, and the binding of arsenic can inhibit the activity of the protein, cause the conformational change of the protein and influence the normal function of the protein. The full understanding of the interaction between arsenic and sulfhydryl groups is of great importance for understanding the mechanism of action of arsenic. However, the studies on the interaction between arsenic and thiol groups in the prior art are still insufficient, and no suitable tool is available for these studies.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides an arsenic-sulfydryl molecular beacon compound.
The invention also aims to provide application of the arsenic-sulfydryl molecular beacon compound.
The technical scheme of the invention is as follows:
an arsenic-sulfydryl molecular beacon compound with a structural formula
Figure BDA0003666627950000011
Figure BDA0003666627950000012
The derivative is prepared by reacting 4-cinnamic acid hydrocinnamate NHS ester, mercaptoethanol and DNA molecules, wherein the structural formula of the 4-cinnamic acid hydrocinnamate NHS ester is shown in the specification
Figure BDA0003666627950000013
In a preferred embodiment of the present invention, the compound has the formula
Figure BDA0003666627950000021
The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.01, the 5 'end of the DNA molecule is modified with Amino LinkerC6, and the 3' end of the DNA molecule is modified with Thiol Modifier C6S-S.
In a preferred embodiment of the present invention, the compound has the formula
Figure BDA0003666627950000022
The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.02, the 28 th C of the 5 'end of the DNA molecule is modified with iUniAmM/, and the 3' end of the DNA molecule is modified with thio Modifier C3S-S.
In a preferred embodiment of the present invention, the compound has the formula
Figure BDA0003666627950000023
The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.02, the 28 th site C of the 5 'end of the DNA molecule is modified with/iDTPA/, and the 3' end of the DNA molecule is modified with/3 AmMO/.
In a preferred embodiment of the invention, the synthesis route of the NHS 4-arsine hydrocinnamate is as follows:
Figure BDA0003666627950000024
the arsenic-sulfhydryl molecular beacon compound is applied to the preparation of an arsenic-sulfhydryl compound interaction detection kit, and the arsenic-sulfhydryl compound interaction detection kit also comprises an LC DNA molecule shown as SEQ ID NO.03 and an LCD DNA molecule shown as SEQ ID NO. 04.
An arsenic-sulfydryl compound interaction detection kit comprises the arsenic-sulfydryl molecular beacon compound, an LC DNA molecule shown as SEQ ID NO.03 and an LCD DNA molecule shown as SEQ ID NO. 04.
The application of the arsenic-sulfydryl molecular beacon compound in preparing a pharmaceutical composition with controllable arsenic toxicity.
In a preferred embodiment of the invention, the arsenic toxicity controllable pharmaceutical composition further comprises an LC DNA molecule shown as SEQ ID NO.03 and an LCD DNA molecule shown as SEQ ID NO. 04.
A pharmaceutical composition with controllable arsenic toxicity comprises the arsenic-sulfydryl molecular beacon compound, an LC DNA molecule shown as SEQ ID NO.03 and an LCD DNA molecule shown as SEQ ID NO. 04.
The invention has the beneficial effects that: the method successfully realizes the multiple reversible combination and dissociation of arsenic and micromolecular sulfhydryl compound lipoic acid regulated by the arsenic-sulfhydryl molecular beacon, proves the controllability of the strategy of regulating the interaction between the arsenic and the sulfhydryl by regulating the distance between the arsenic and the sulfhydryl, and has high sulfhydryl selectivity, high stability and high reaction rate.
Drawings
FIG. 1 is a (a) synthesis scheme of 4-arsenate hydrocinnamic acid in example 1 of this invention; (b) HPLC-ESI-MS selects ion flow pattern and (c) mass spectrum.
FIG. 2 shows the reaction of 4-arsenate hydrocinnamic acid in DMSO-D in example 1 of this invention 6 Nuclear magnetic resonance of 1 And H, spectrum.
FIG. 3 shows the reaction of 4-arsenate hydrocinnamic acid in DMSO-D in example 1 of this invention 6 Nuclear magnetic resonance of 13 And C, spectrum.
FIG. 4 shows (a) a synthetic route, (b) an HPLC-ESI-MS selective ion-flow diagram, and (c) a mass spectrum of NHS 4-arsenate hydrocinnamate in example 1 of the present invention.
FIG. 5 shows NHS 4-arsenate hydrocinnamate in DMSO-D in example 1 of the present invention 6 Nuclear magnetic resonance of 1 And H, spectrum.
FIG. 6 shows NHS 4-arsenate hydrocinnamate in DMSO-D in example 1 of the present invention 6 Nuclear magnetic resonance of 13 And C, spectrum.
FIG. 7 shows the arsenic-Thiol molecular beacon (ATMB-1 Thiol-As) in example 2 of the present invention (III) ) And synthesizing a route map.
FIG. 8 is a (a) synthesis scheme of lipoic acid-fluorescein (LA-FITC) in example 2 of the present invention; (b) HPLC-ESI-MS selects ion flow pattern and (c) mass spectrum.
FIG. 9 shows ATMB-1 thio-As of example 2 of the present invention (III) Reacting with LA-FITC, and desalting; (b) 12% native page gel electrophoresis pattern of product, wherein lane M: DNA marker; lane 1: ATMB-1Thiol-As (III) ；2：ATMB-1Thiol-As (III) Desalting; 3: ATMB-1Thiol-As (III) -LC；3：ATMB-1Thiol-As (III) -LC desalination.
FIG. 10 is a schematic representation of the reaction of ATMB-1Thiol-LC with LCD according to example 2 of the present invention; (b) 12% native page gel electrophoresis pattern of product, wherein lane M: DNA marker; lane 1: ATMB-1T;2: ATMB-1 thio-LC; 3-6: ATMB-1Thiol/LC-LCD.
FIG. 11 is a schematic representation of the reaction cycle for (a) ATMB-1Thiol with LC in example 2 of the present invention; (b) 12% of the product nativepage gel electrophoresis profile, lane 1: ATMB-1Thiol;2: ATMB-1 thio-LC;
3：ATMB-1Thiol/LC-LCD；4-7:ATMB-1Thiol-LC/LC-LCD。
FIG. 12 shows ATMB-1 thio-As of example 2 of the present invention (III) Reacting with LA-FITC; (b) 12% native page gel electrophoresis pattern of product, lanes 1-3: ATMB-1Thiol;4-6: ATMB-1Thiol-As (V) ；7-9：ATMB-1Thiol-As (III) 。
FIG. 13 shows ATMB-1 thio-As of example 2 of the present invention (III) Reaction process with LA-FITC (R = OHorSH); (b) 12% of the product, native page gel electrophoresis pattern, lane 1: ATMB-1Thiol;2: ATMB-1Thiol-As (V) ；3，4：ATMB-1Thiol-As (III) ；5，7，8：ATMB-1Thiol-As (III) -LC；6，9：LC-LCD/ATMB-1Thiol-As (III) 。
FIG. 14 shows ATMB-27T-1Thiol-As of example 3 of the present invention (III) Reacting with LA-FITC; (b) 12% of the product nativepage gel electrophoresis profile, lane 1: ATMB-27T-1Thiol;2: ATMB-27T-1Thiol-As (V) ；3-4：ATMB-27T-1Thiol-As (III) ；5：ATMB-27T-1Thiol-As (III) -LC；6：ATMB-27T-1Thiol-As (III) /LC-LCD。
FIG. 15 shows ATMB-27T-2Thiol-As of example 4 of the present invention (III) Reacting with LA-FITC; (b) 12% of the product, lane 1, 3, 5, 7: ATMB-27T-2Thiol-As (III) ；2、4、6：ATMB-27T-2Thiol-As (III) -LC。
Detailed Description
The technical solution of the present invention is further illustrated and described by the following detailed description in conjunction with the accompanying drawings.
EXAMPLE 1 Synthesis of NHS 4-arsenic hydrocinnamate
The synthetic route is as follows:
Figure BDA0003666627950000041
the method specifically comprises the following steps:
(1) Synthesis of 4-arsenate hydrocinnamic acid: a50 mL flask was charged with anhydrous sodium carbonate (500mg, 4.67mmol), arsenic trioxide (250mg, 1.26mmol) and copper sulfate pentahydrate (20mg, 0.075mol), and then with 8mL of water, followed by heating with stirring. When most of the solid is dissolved, the heating is stopped, and the solution is kept still and cooled to obtain the arsenite mixture. In a 50mL beaker, 4-aminohydrocinnamic acid (330mg, 2mmol) was added followed by the addition of 10mL of THF to facilitate dissolution, then concentrated hydrochloric acid (200. Mu.L) was slowly added, a quantity of ice was added to give a 15mL solution, and a saturated aqueous solution of sodium nitrite (139mg, 2mmol) was slowly added to give a pale yellow diazonium salt solution, which was then slowly added to the arsenite mixture, placed in an ice bath and stirred for 1h, and the resulting slurry was further stirred overnight to give a brown mixture. To the above solution was added 8mL of concentrated HCl and acidified until a brown oily precipitate was produced, and the mixture was centrifuged to remove the precipitate. The product was purified by reverse phase chromatography to give 237mg of a white solid after rotary evaporation in 43.2% yield. Using HPLC-ESI-MS (m/z = 274.9913) (FIG. 1) and nuclear magnetic resonance 1 H spectrum (FIG. 2) and 13 the structural identification of the product was carried out by C spectrum (FIG. 3). 1 H NMR(500MHz,DMSO-d 6 )δ7.70(d,2H),7.49(d,2H),2.91(t,2H),2.59(t,2H)， 13 C NMR(126MHz,DMSO)δ173.90,147.00,130.99,130.55,129.87,35.05,30.73.
(2) Synthesis of 4-arsenate hydrocinnamic acid NHS ester: 4-arsenate hydrocinnamic acid (30mg, 0.1mmol) and 5mL acetonitrile were added to a 25mL flask, and the flask was placed in an ice bath at 0 ℃ and activated with EDC (25mg0.12mmol) for 20min, followed by addition of N-hydroxysuccinimide (14mg, 0.12mmol), and the reaction was allowed to warm to room temperature for 3h. The product was purified by reverse phase chromatography and rotary evaporated to give 34mg of a white solid in 90% yield. Using HPLC-ESI-MS (m/z = 372.0006) (FIG. 4) and nuclear magnetic resonance 1 H spectrum (FIG. 5) and 13 the product was structurally characterized by C-profile (FIG. 6). 1 H NMR(500MHz,DMSO-d 6 )δ7.70(d,2H),7.49(d,2H),2.91(t,2H),2.64(t,4H),2.59(t,2H)， 13 C NMR(126MHz,DMSO)δ173.25,171.35,147.02,131.05,130.58,130.54,35.09,31.55,30.14,25.90.
Example 2
The structural formula of the arsenic-sulfydryl molecular beacon compound of the embodiment is
Figure BDA0003666627950000051
Prepared by the reaction of NHS ester of 4-arsenic acid hydrocinnamic acid prepared in the embodiment 1, mercaptoethanol and DNA molecule ATMB-1Thiol;
the nucleotide sequence of the DNA molecule ATMB-1Thiol is cgtacggaggtgatgtgtgtgagtgggtacg (SEQ ID NO. 01), the 5 'end of the DNA molecule is modified with Amino Linker C6, the 3' end of the DNA molecule is modified with Thiol Modifier C6S-S, and the structural formula of the Amino Linker C6 is shown in the specification
Figure BDA0003666627950000052
The structural formula of thio Modifier C6S-S is shown in the specification
Figure BDA0003666627950000061
The preparation method of the arsenic-sulfydryl molecular beacon compound comprises the following steps: adding sterile water into the designed DNA sequence to obtain ATMB-1Thiol mother liquor with the concentration of 20mM, taking 5 mu L, adding 4-arsenate hydrocinnamic acid NHS ester (5 mu L,200 mu M), adding 1 mu L of 1 XPBS and 9 mu L of water, and reacting at room temperature for 2h to obtain ATMB-1Thiol-As (V) Removing excessive NHS 4-arsenate hydrocinnamate in the mixture by using a Micro Bio-Spin 6 Columns desalting column, adding mercaptoethanol (20 mu L, 1M) to reduce arsenic into trivalent, desalting twice by using the Micro Bio-Spin 6 Columns desalting column to remove excessive mercaptoethanol to obtain the arsenic-mercapto molecular beacon compound ATMB-1Thiol-As with the concentration of 25 mu M (III) The synthetic route is shown in FIG. 7.
In order to facilitate characterization of the arsenic-thiol molecular beacon compounds of the invention using fluorescence gel electrophoresis, this example synthesizes a small molecule compound lipoic acid-fluorescein with thiol and a fluorescent group.
Synthesis and characterization of lipoic acid-fluorescein (LA-FITC): FITC (50mg, 0.13mmol) was added to a 50ml flask, 5ml of DMF was added and dissolved, then Boc-ethylenediamine (25mg, 0.16mmol) was added, and the reaction was stirred at room temperature for 8h. The crude product was deprotected by directly adding 80. Mu.L of LTFA and the mixture was stirred at room temperature for 12h. DEA-FITC was obtained, NHS-DLTA (50mg, 0.17mmol) was added to the crude product, and the reaction was stirred for 1h at 0 ℃ under ice bath conditions. And then stirred at room temperature for 2h. The product was purified by reverse phase chromatography to give 33mg of a yellow solid after rotary evaporation in 40% yield. The product was structurally characterized using HPLC-ESI-MS (m/z = 638.1487) (fig. 8).
TCEP reduction LA-FITC: 10mg of LA-FITC solid were weighed out and dissolved in 300. Mu.L DMF to give LA-FITC mother liquor in the oxidized state at a concentration of 50mM, which was mixed with 500mM NH 4 Cl and TCEP with the concentration of 100mM are reacted in the same volume, and the reaction solution is placed at room temperature and shaken for 2 hours to open disulfide bonds, so that LA-FITC with the concentration of 25mM in a reduced state is obtained.
Arsenic-mercapto molecular beacon compound ATMB-1Thiol-As (III) The characterization of (1): to analyze the DNA-terminally modified amino groups, 4-arsenate hydrocinnamate NHS ester has been coupled, while ATMB-1Thiol-As has been studied (III) The interaction with LA-FITC is schematically shown in FIG. 9 (a).
The DNAmarker concentration is 15 mu M; number 1 ATMB-1Thiol-As (III) (2. Mu.L, 25. Mu.M), adding LA-FITC (3. Mu.L, 50. Mu.M) and reacting for 30min; number 2 ATMB-1Thiol-As (III) (2. Mu.L, 25. Mu.M), LA-FITC (3. Mu.L, 50. Mu.M) was added for reaction for 30min, and desalted using a Micro Bio-Spin 6 Columns desalting column; no. 3 ATMB-1Thiol-As (III) (2. Mu.L, 25. Mu.M), adding LA-FITC (3. Mu.L, 50. Mu.M) for reaction for 30min, and adding LC (nucleotide sequence is shown as SEQ ID NO.03, 1. Mu.L, 50. Mu.M) for reaction for 10min; no. 4 ATMB-1Thiol-As (III) (2. Mu.L, 25. Mu.M), LA-FITC (3. Mu.L, 50. Mu.M) for 30min, LC (1. Mu.L, 50. Mu.M) for 10min, and desalting with a Micro Bio-Spin 6 Columns desalting column. Each lane sample was 10. Mu.L in volume, 5. Mu.M in 1 XPBS, and 2. Mu.L of DNA load was added.
Preparing glue: 4.5mL of polyacrylamide was taken, and 9.5mL of 1 XTBE and 9mL of H were added 2 O, adding 150 μ L10% APs and 15 μ L TEMED, mixing, injecting into prepared electrophoresis glass plate, inserting comb,gel was obtained after 10 min.
Loading: mu.L of DNA marker and samples No. 1, 2, 3 and 4 were added to the corresponding lanes, respectively.
Electrophoresis: all DNA was gel-electrophoresed for 1h at 80V in 1 XTBE electrophoresis buffer.
Dyeing: the gel was stained with ethidium bromide (20. Mu.M, 100. Mu.L) in 40mL of the electrophoresis solution for 20min, and then scanned with a gel imager, and the results of gel electrophoresis imaging are shown in FIG. 9 (b). The beacon without the arsenic-conjugated functional group did not bind to LA-FITC when it was turned on, and it was found from lanes 3 and 4 that ATMB-1 thio-As conjugated with the arsenic functional group (III) When the molecular beacon is opened, the molecular beacon is successfully combined with LA-FITC, and the synthesis of the arsenic-sulfydryl molecular beacon is proved to be successful.
Optimizing the use amount of the LCD:
to determine the optimal LCD (nucleotide sequence shown in SEQ ID No. 04) equivalent for the molecular beacon to return to the off state after the LC is turned on, this example was optimized by gel electrophoresis using the DNA sequence without functional modification, as shown schematically in fig. 10 (a).
The concentration of DNA marker is 15 mu M; ATMB-1Thiol (5. Mu.M, 10. Mu.L) blank sample No. 1; ATMB-1Thiol (2. Mu.L, 25. Mu.M) No. 2, LC (1. Mu.L, 50. Mu.M) was added for 10min, and the lane band determined that 1.0 equivalent of LC could completely turn on the molecular beacon; samples 3-6 were ATMB-1Thiol (2. Mu.L, 25. Mu.M), LC (1. Mu.L, 50. Mu.M) for 10min, 1. Mu.L, 1.2. Mu.L, 1.5. Mu.L, 2.0. Mu.L of 50. Mu.M LCD for 10min, 1 XPBS in 10. Mu.L of each lane, and 2. Mu.L of loading solution of LDNA. Gel electrophoresis results As shown in FIG. 10 (b), the optimum equivalent weight for adding the LCD back to the OFF state after ATMB-1Thiol binding to the LC was turned on was 1.
Optimizing the LC dosage by cyclic regulation:
after hybridization of ATMB-1Thiol with LC, the molecular beacons were returned to the OFF state by adding 1.2 fold equivalents of LCD, and optimized using the DNA sequence without functional modification to determine the optimal equivalents of LC required for molecular beacon reopening, as shown schematically in FIG. 11 (a).
The concentration of DNA marker is 15 mu M; ATMB-1Thiol (5. Mu.M, 10. Mu.L) blank sample No. 1, ATMB-1Thiol (2. Mu.L, 25. Mu.M) No. 2, LC (1. Mu.L, 50. Mu.M) was added for reaction for 10min; ATMB-1Thiol (2. Mu.L, 25. Mu.M) No. 3, adding LC (1. Mu.L, 50. Mu.M) for reaction for 10min, and adding LCD (1.2. Mu.L, 50. Mu.M) for reaction for 10min; lanes 4-7 are ATMB-1Thiol (2. Mu.L, 25. Mu.M), LC (1. Mu.L, 50. Mu.M) is added for 10min, LCD (1.2. Mu.L, 50. Mu.M) is added for 10min, and then 1.2. Mu.L, 1.4. Mu.L, 1.6. Mu.L, 2.0. Mu.L of LC at a concentration of 50. Mu.M are added for 10min, each lane sample volume of 10. Mu.L contains 1 XPBS, and 2. Mu.L of LDNA supernatant is added, the results of gel electrophoresis are shown in FIG. 11 (b), and the optimal equivalent for reopening molecular beacons by adding LC to ATMB-1Thiol is 1.2 as shown in lanes 4-7.
Optimization of LA-FITC dosage
Next, this example further optimizes the determination of ATMB-1Thiol, ATMB-1Thiol-As (V) And ATMB-1Thiol-As (III) The interaction with LA-FITC was determined to be optimal equivalent, and their interaction process was analyzed, as shown schematically in FIG. 12 (a).
The concentration of DNA marker is 15 mu M; no. 1-3 ATMB-1Thiol (2 muL, 25 muM), respectively adding 1 muL, 2 muL, 3 muL LA-FITC with concentration of 50 muM for reaction for 30min, and then adding LC (1 muL, 50 muM) for reaction for 10min; no. 4-6 ATMB-1Thiol-As (V) (2.5 μ L,20 μ M), adding 1 μ L,2 μ L, and 3 μ L LA-FITC with concentration of 50 μ M respectively, reacting for 30min, and adding LC (1 μ L,50 μ M) for reacting for 10min; no. 7-9 ATMB-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), 1. Mu.L, 2. Mu.L, and 3. Mu.L of LA-FITC at a concentration of 50. Mu.M were added thereto and reacted for 30min, and then LC (1. Mu.L, 50. Mu.M) was added thereto and reacted for 10min, and a sample volume of 10. Mu.L of each lane containing 1 XPBS and 2. Mu.L of LDNA supernatant was added thereto, and the results of gel electrophoresis were shown in FIG. 12 (b), and lane 8 shows ATMB-1 thio-As (III) The optimal equivalent ratio for reaction with LA-FITC is 1:2,ATMB-1Thiol and ATMB-1Thiol-As (V) And does not bind LA-FITC.
ATMB-1Thiol-As (III) Modulation of LA-FITC interaction
To explore ATMB-1Thiol-As (III) The binding of molecular beacons to LA-FITC in the ON and OFF states was studied from lanes 1 and 2, respectively, and the process is schematically shown in FIG. 13 (a).
The concentration of DNA marker is 15 mu M; no. 1-3 are ATMB-1Thiol and ATMB-1Thiol-As (V) 、ATMB-1Thiol-As (III) (5. Mu.M, 10. Mu.L) control sample; no. 4 ATMB-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), and LA-FITC (2. Mu.L, 50. Mu.M) was added to react for 30min; no. 5 ATMB-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), adding LA-FITC (2. Mu.L, 50. Mu.M) for reaction for 30min, and then adding LC (1. Mu.L, 50. Mu.M) for reaction for 10min; no. 6 ATMB-1Thiol-As (III) (2.5 μ L,20 μ M), adding LA-FITC (2 μ L,50 μ M) to react for 30min, adding LC (1 μ L,50 μ M) to react for 10min, and adding LCD (1.2 μ L,50 μ M) to react for 10min; no. 7 ATMB-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), LC (1. Mu.L, 50. Mu.M) was added for reaction for 10min; no. 8 ATMB-1Thiol-As (III) (2.5 μ L,20 μ M), adding LC (1 μ L,50 μ M) for reaction for 10min, and adding LA-FITC (2 μ L,50 μ M) for reaction for 30min; number 9 ATMB-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), LC (1. Mu.L, 50. Mu.M) was added for reaction for 10min, LA-FITC (2. Mu.L, 50. Mu.M) was added for reaction for 30min, LCD (1.2. Mu.L, 50. Mu.M) was added for reaction for 10min, 1 XPBS was added to 10. Mu.L of each lane sample, and 2. Mu.L of DNA loading solution was added, and the results of gel electrophoresis are shown in FIG. 13 (b).
Route 1 is to add LA-FITC and then add LC to turn on molecular beacon, and the result of gel electrophoresis shows that the molecular beacon after turn-on can be successfully coupled by adding LA-FITC, and in route 2, add LC to turn on molecular beacon and then add LA-FITC, and a coupled compound is obtained, but ATMB-1 thio-As (III) The migration position coincides with LA-FITC during closing, and whether the molecular beacon can be combined with LA-FITC in the closed state cannot be judged, so the embodiment optimizes the length of the molecular beacon.
Example 3
This example designed a longer DNA sequence, ATMB-27T-1Thiol, which was added 27 bases for separation from free LA-FITC, as shown schematically in FIG. 14 (a).
The arsenic-sulfydryl molecular beacon compound of the embodiment has the structural formula
Figure BDA0003666627950000091
Prepared by the reaction of NHS ester of 4-arsenate hydrocinnamic acid prepared in the example 1, mercaptoethanol and DNA molecule ATMB-27T-1Thiol;
the nucleotide sequence of the DNA molecule ATMB-27T-1Thiol is tttttttttttttttttttttttttttcgtacggaggtgatgtgtgtgagtgggtacg (SEQ ID NO. 02), the 28 th C of the 5 'end of the DNA molecule is modified with iUniAmM/, the 3' end of the DNA molecule is modified with ThiolModifierC3S-S, and the structural formula of the iUniAmM/, is shown in the specification
Figure BDA0003666627950000092
The structural formula of ThiolModifierC3S-S is shown as
Figure BDA0003666627950000093
The preparation method of the arsenic-mercapto molecular beacon compound is carried out with reference to example 2.
The DNAmarker concentration is 15 mu M; no. 1-3 are ATMB-27T-1Thiol, ATMB-27T-1Thiol-As (V) 、ATMB-27T-1Thiol-As (III) A control sample; no. 4 ATMB-27T-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), and LA-FITC (2. Mu.L, 50. Mu.M) was added to react for 30min; no. 5 ATMB-27T-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), adding LA-FITC (2. Mu.L, 50. Mu.M) for reaction for 30min, and adding LC (1. Mu.L, 50. Mu.M) for reaction for 10min; ATMB-27T-1Thiol-As No. 6 (III) (2.5. Mu.L, 20. Mu.M), LA-FITC (2. Mu.L, 50. Mu.M) was added for reaction for 30min, LC (1. Mu.L, 50. Mu.M) was added for reaction for 10min, LCD (1.2. Mu.L, 50. Mu.M) was added for reaction for 10min, the volume of each lane sample was 10. Mu.L containing 1 XPBS, and 2. Mu.L of LDNA loading solution was added, and the results of gel electrophoresis are shown in FIG. 14 (b). From lanes 4-6, ATMB-27T-1Thiol-As (III) The molecular beacon can be switched on and off, and can be successfully combined with LA-FITC in the on state, but can be combined with LA-FITC in the off state. The functional group modified by the designed DNA sequence only contains one sulfydryl, but arsenic (III) Contains two sulfhydryl combination sites, so that the molecular beacon arsenic functional group in the closed state still retains 1 combination site with sulfhydryl compound, thereby combining with LA-FITC.
Example 4
To make arsenic on molecular beaconsThe group and the sulfhydryl form a more stable intramolecular arsenic-sulfur bond, and the arsenic-sulfhydryl molecular beacon is ensured not to be combined with small molecule LA-FITC in a closed state, and the molecular beacon ATMB-27T-2 thio-As containing double sulfhydryl modification is designed in the embodiment (III) . When the molecular beacon is in an off state, the two sulfhydryl binding sites of arsenic are stably combined with double sulfydryl modified on the chain, so that an ideal state that other sulfhydryl compounds cannot be combined in the off state is achieved. This example investigated ATMB-27T-2Thiol-As by gel electrophoresis (III) The interaction with LA-FITC and the reversible regulation of the arsenic-sulfhydryl molecular beacon are shown in FIG. 15 (a).
The arsenic-mercapto molecular beacon compound of this example has the structural formula
Figure BDA0003666627950000101
Prepared by reacting NHS ester of 4-arsenate hydrocinnamate prepared in example 1, mercaptoethanol and DNA molecule ATMB-27T-2Thiol
The nucleotide sequence of the DNA molecule ATMB-27T-2thio is tttttttttttttttttttttttttttcgtacggaggtgatgtgtgtgagtgggtacg (SEQ ID NO. 02), the 28 th C of the 5 'end of the DNA molecule is modified with/iDTPA/, the 3' end of the DNA molecule is modified with/3 AmMO/, and/iDTPA/has the structural formula
Figure BDA0003666627950000102
The structural formula of/3 AmMO/is
Figure BDA0003666627950000103
The preparation method of the arsenic-mercapto molecular beacon compound is carried out with reference to example 2.
The DNAmarker concentration is 15 mu M; number 1 ATMB-27T-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), and LA-FITC (2. Mu.L, 50. Mu.M) was added to react for 30min; no. 2 ATMB-27T-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), adding LA-FITC (2. Mu.L, 50. Mu.M) for reaction for 30min, and then adding LC (1. Mu.L, 50. Mu.M) for reaction for 10min; no. 3 ATMB-27T-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), LA-FITC (2. Mu.L, 50. Mu.M) was added for reaction for 30min, LC (1. Mu.L, 50. Mu.M) was added for reaction for 10min, and LC was addedD (1.2. Mu.L, 50. Mu.M) for 10min; no. 4 ATMB-27T-1Thiol-As (III) (2.5. Mu.L, 20. Mu.M), LA-FITC (2. Mu.L, 50. Mu.M) was added for reaction for 30min, LC (1. Mu.L, 50. Mu.M) was added for reaction for 10min, LCD (1.2. Mu.L, 50. Mu.M) was added for reaction for 10min, and LC (1.2. Mu.L, 50. Mu.M) was added for reaction for 10min; 5. samples No. 6 and No. 7 were added in a regular stepwise manner, and the volume of each lane sample was 10. Mu.L containing 1 XPBS and 2. Mu.L of LDNA loading solution, and the results of gel electrophoresis are shown in FIG. 15 (b). The electrophoresis result shows that ATMB-27T-2Thiol-As (III) The molecular beacon is successfully combined with LA-FITC in an open state and is not combined in a closed state, and multiple reversible cycle regulation and control of the arsenic-sulfhydryl molecular beacon and the small molecular sulfhydryl compound LA-FITC are successfully realized.
The above description is only a preferred embodiment of the present invention, and therefore should not be taken as limiting the scope of the invention, and all equivalent variations and modifications made within the scope of the present invention and the content of the description should be included in the scope of the present invention.
Sequence listing
<110> university of mansion
<120> arsenic-sulfydryl molecular beacon compound and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgtacggagg tgatgtgtgt gagtgggtac g 31
<210> 2
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tttttttttt tttttttttt tttttttcgt acggaggtga tgtgtgtgag tgggtacg 58
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccactgccac tcacacacat cacctcc 27
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggaggtgatg tgtgtgagtg gcagtgg 27

Claims (10)

1. An arsenic-thiol molecular beacon compound, characterized by: the structural formula is
Figure FDA0003666627940000011
Figure FDA0003666627940000012
The derivative is prepared by reacting 4-cinnamic acid hydrocinnamate NHS ester, mercaptoethanol and DNA molecules, wherein the structural formula of the 4-cinnamic acid hydrocinnamate NHS ester is shown in the specification
Figure FDA0003666627940000013
2. An arsenic-thiol molecular beacon compound as claimed in claim 1, wherein: the structural formula is
Figure FDA0003666627940000014
The nucleotide sequence of the DNA molecule is shown as SEQ ID NO.01, wherein the 5 'end of the DNA molecule is modified with Amino Linker C6, and the 3' end of the DNA molecule is modified with thio Modifier C6S-S.
3. An arsenic-thiol molecular beacon compound as claimed in claim 1, wherein: the structural formula is
Figure FDA0003666627940000015
Nucleosides of said DNA moleculeThe sequence is shown as SEQ ID NO.02, the 28 th C at the 5 'end of the sequence is modified with iUniAm/, and the 3' end of the sequence is modified with thio Modifier C3S-S.
4. An arsenic-thiol molecular beacon compound as claimed in claim 1, wherein: the structural formula is
Figure FDA0003666627940000021
The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.02, the 28 th site C of the 5 'end of the DNA molecule is modified with/iDTPA/, and the 3' end of the DNA molecule is modified with/3 AmMO/.
5. The arsenic-thiol molecular beacon compound of any one of claims 1 to 4, wherein: the synthetic route of the 4-arsenic hydrocinnamic acid NHS ester is as follows:
Figure FDA0003666627940000022
6. use of the arsenic-thiol molecular beacon compound as claimed in any one of claims 1 to 5 in the preparation of an arsenic-thiol compound interaction detection kit, characterized in that: the arsenic-sulfhydryl compound interaction detection kit also comprises an LC DNA molecule shown in SEQ ID NO.03 and an LCD DNA molecule shown in SEQ ID NO. 04.
7. An arsenic-sulfhydryl compound interaction detection kit, which is characterized in that: has the arsenic-sulfydryl molecular beacon compound as claimed in any one of claims 1 to 5, an LC DNA molecule as shown in SEQ ID No.03 and an LCD DNA molecule as shown in SEQ ID No. 04.
8. Use of an arsenic-mercapto molecular beacon compound as defined in any one of claims 1 to 5 in the preparation of a pharmaceutical composition for the controlled toxicity of arsenic.
9. The use of claim 8, wherein: the arsenic toxicity controllable pharmaceutical composition also comprises an LC DNA molecule shown as SEQ ID NO.03 and an LCD DNA molecule shown as SEQ ID NO. 04.
10. A pharmaceutical composition with controllable arsenic toxicity, which is characterized in that: comprising the arsenic-thiol molecular beacon compound of any one of claims 1 to 5, an LC DNA molecule as shown in SEQ ID No.03 and an LCD DNA molecule as shown in SEQ ID No. 04.
CN202210587979.1A 2022-05-12 2022-05-27 Arsenic-sulfydryl molecular beacon compound and application thereof Pending CN115819486A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2022105172668 2022-05-12
CN202210517266 2022-05-12

Publications (1)

Publication Number Publication Date
CN115819486A true CN115819486A (en) 2023-03-21

Family

ID=85522599

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210587979.1A Pending CN115819486A (en) 2022-05-12 2022-05-27 Arsenic-sulfydryl molecular beacon compound and application thereof

Country Status (1)

Country Link
CN (1) CN115819486A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112457372A (en) * 2020-11-30 2021-03-09 华南理工大学 Synthesis method and application of polypeptide hydrazide containing cysteine residues
CN114144422A (en) * 2019-03-01 2022-03-04 中尺度技术有限责任公司 Electrochemiluminescence labeled probes for use in immunization methods, methods of using such probes, and kits comprising such probes
CN114835753A (en) * 2022-05-07 2022-08-02 厦门大学 Photo-cleavage arsenic-sulfydryl label compound and application thereof
CN115322226A (en) * 2022-08-17 2022-11-11 厦门大学 Covalent targeting arsenic inhibitor and preparation method and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114144422A (en) * 2019-03-01 2022-03-04 中尺度技术有限责任公司 Electrochemiluminescence labeled probes for use in immunization methods, methods of using such probes, and kits comprising such probes
CN112457372A (en) * 2020-11-30 2021-03-09 华南理工大学 Synthesis method and application of polypeptide hydrazide containing cysteine residues
CN114835753A (en) * 2022-05-07 2022-08-02 厦门大学 Photo-cleavage arsenic-sulfydryl label compound and application thereof
CN115322226A (en) * 2022-08-17 2022-11-11 厦门大学 Covalent targeting arsenic inhibitor and preparation method and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BEIBEI CHEN ET AL: "Therapeutic and analytical applications of arsenic binding to proteins", METALLOMICS, vol. 7, pages 39 - 55 *
XIAOWENYAN ET AL: "p-Azidophenylarsenoxide: An Arsenical "Bait" for the In Situ Capture and Identification of Cellular Arsenic-Binding Proteins", ANGEW.CHEM.INT.ED., vol. 55, pages 14051 - 14056 *

Similar Documents

Publication Publication Date Title
US5198537A (en) Digoxigenin derivatives and use thereof
CA2345376A1 (en) Water-soluble luminescent quantum dots and bioconjugates thereof
JP4745331B2 (en) Reagent for labeling, synthesis method of the reagent, and detection method of biomolecule
CA1293258C (en) Biotinylating agents
DE4302241A1 (en) New biotinylation reagent
Adhikari et al. Tuning of donor-acceptor linker in rhodamine-coumarin conjugates leads remarkable solvent dependent FRET efficiency for Al3+ imaging in HeLa cells
CN115819486A (en) Arsenic-sulfydryl molecular beacon compound and application thereof
NO314308B1 (en) Biotin-containing chemiluminescent marker, use of the marker for preparation of a diagnostic assay, diagnostic assay and pre-diagnostic assay
US20030219780A1 (en) Methods for the preparation of chemically misaminoacylated tRNA via protective groups
WO2003000683A1 (en) Method of the solid phase synhesis of pyrrole-imidazole polyamide
US4798795A (en) Biotinylating agents
JP5465724B2 (en) Labeling reagent having pyridine nucleus having diazomethyl functional group, method for synthesizing the reagent, and method for detecting biomolecule
Brglez et al. Photocleavable ligands for protein decoration of DNA nanostructures
JPH07505632A (en) Benzodiazepine derivatives and conjugates of the derivatives with proteins or polypeptides
CN105503879B (en) A kind of method of immobilization albumen
EP1308728A2 (en) Method and compounds for the fluorescent labelling of biomolecules and polymer particles
JP2005536748A (en) Hydrophilic chemiluminescent acridinium labeling agent
US6933384B2 (en) Synthetic molecules for labeling histidine-rich proteins
EP0578066A1 (en) Photochemical labelling of nucleic acids with digoxigenin-reagents and their use in gene probe systems
CN109438414B (en) Method for preparing benzo 1, 3-oxathiane-4-ketone
WO1996031496A1 (en) Methadone derivatives and protein and polypeptide methadone derivative conjugates and labels
US20200361863A1 (en) Method of synthesizing alpha-amino acid derivatives
US6979575B1 (en) Fluorochromes for labelling biomolecules and polymer particles and bioanalytical and screening methods based thereon
WO2004092174A1 (en) Pyrrolopyrroles used as fluorescent labels for biomolecules and spherical particles
Cosimelli et al. A new synthetic route to 2, 2′: 5′, 2 ″-terthiophene-5-derivatives to conjugate with proteins and monoclonal antibodies

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination