CN115807040A

CN115807040A - PD-1 protein expression vector and application thereof

Info

Publication number: CN115807040A
Application number: CN202210856914.2A
Authority: CN
Inventors: 冯炜; 陈云; 郭慧毅; 阚子义; 罗顺
Original assignee: Aosikang Biology Nantong Co ltd; Jianshun Biosciences Co ltd; Jianshun Biotechnology Nantong Co ltd; Shanghai Jianshibai Biotechnology Co ltd; Shanghai Aosikang Biopharmaceutical Co ltd
Current assignee: Aosikang Biology Nantong Co ltd; Jianshun Biosciences Co ltd; Jianshun Biotechnology Nantong Co ltd; Shanghai Jianshibai Biotechnology Co ltd; Shanghai Aosikang Biopharmaceutical Co ltd
Priority date: 2022-07-20
Filing date: 2022-07-20
Publication date: 2023-03-17

Abstract

The invention discloses a PD-1 protein expression vector and application thereof, wherein the PD-1 protein expression vector comprises an AAV vector, and PD-1 gene segments are inserted between enzyme cutting sites of multiple cloning sites of the AAV vector. The PD-1 protein expression vector can express PD-1 protein in a human body for a long time, and the PD-1 protein is specifically combined with PD-L1 of tumor cells, so that the negative regulation effect of the tumor cells on the T cells is reduced, and the inhibition effect of T lymphocytes on the growth of the tumor cells is improved.

Description

PD-1 protein expression vector and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a PD-1 protein expression vector and application thereof.

Background

Programmed cell death protein (PD-1) is a type I membrane protein with 268 amino acids, belongs to a CD28 family member, and has a gene located on chromosome 2 and is mainly expressed on T cells and pro-B cells.

The structure of PD-1 mainly includes an extracellular immunoglobulin variable region (IgV) structure, a hydrophobic transmembrane region, and an intracellular region, in which 2 independent tyrosine residues are present at the tail of the intracellular region, the tyrosine residue at the nitrogen terminal participates in forming an Immunoreceptor Tyrosine Inhibition Motif (ITIM), and the tyrosine residue at the carbon terminal participates in forming an Immunoreceptor Tyrosine Switch Motif (ITSM).

PD-L1 and PD-L2 are two glycoprotein ligands of PD-1, wherein PD-L1 is a ligand protein produced by tumor cells and can be combined with PD-1 of T lymphocytes. After the PD-L1 of the tumor cell is combined with the PD-1 on the T cell, tyrosine in an ITSM structural domain of the PD-1 is promoted to be phosphorylated, so that dephosphorylation of downstream protein kinases Syk and PI3K is further caused, activation of downstream pathways such as AKT, ERK and the like is inhibited, transcription and translation of genes and cytokines required by activation of the T cell are finally inhibited, and the function of negatively regulating the activity of the T cell is exerted.

At present, research on common antitumor drugs focuses on targeting PD-1 monoclonal antibodies, but monoclonal antibody drugs have the limitations of immunogenicity, individual difference, limited indications and the like.

In addition, protein drugs have a half-life in vivo, and thus require multiple administrations during treatment, which also reduces patient compliance and affects treatment efficacy.

Therefore, how to improve the therapeutic effect of the drugs and expand the scope of indications of the drugs is a difficult point in developing tumor drugs.

Disclosure of Invention

In order to solve the above problems, a first objective of the present invention is to provide a PD-1 protein expression vector, which includes an AAV vector, wherein a PD-1 gene segment is inserted between enzyme cutting sites of multiple cloning sites of the AAV vector, so as to achieve long-term expression of PD-1 protein in a human body by the expression vector, and the PD-1 protein is specifically bound to PD-L1 of a tumor cell, thereby reducing the negative regulation effect of the tumor cell on T cells, and improving the inhibition effect of T lymphocytes on the growth of the tumor cell.

In one implementation mode of the invention, the sequence of the PD-1 gene segment is shown as SEQ ID NO. 1.

In one implementation mode of the invention, the enzyme cutting sites of the multiple cloning sites are the enzyme cutting sites of restriction enzymes Not I and EcoR I.

The second object of the present invention is to provide a transformant comprising the above-mentioned PD-1 protein expression vector.

In one embodiment of the present invention, the transformant includes a host cell and an expression vector transformed into the host cell.

In one embodiment of the invention, the host cell is an Escherichia coli cell, an HEK293 cell, a Hela cell or a Vero cell.

A third object of the present invention is to provide a pharmaceutical composition comprising:

the PD-1 protein expression vector and a pharmaceutically or physiologically acceptable drug carrier.

In one implementation of the invention, the pharmaceutical carrier comprises at least one of a filler, a diluent and an excipient.

The fourth object of the present invention is to provide the use of the above PD-1 protein expression vector, the above transformant, or the above pharmaceutical composition for the preparation of a medicament for the treatment of cancer.

In one implementation of the invention, the cancer is non-small cell lung cancer.

The PD-1 protein expression vector disclosed by the invention can express PD-1 protein in a human body for a long time, and the PD-1 protein is specifically combined with PD-L1 of tumor cells, so that the negative regulation effect of the tumor cells on the T cells is reduced, and the inhibition effect of T lymphocytes on the growth of the tumor cells is improved; the PD-1 protein expression vector uses AAV as a vector, receptors are Heparan Sulfate Proteoglycan (HSPG), coreceptors alpha beta 5 integrin and Fibroblast Growth Factor Receptor (FGFR), and exist on the surfaces of various cells, so that the AAV can infect various different tissues and cells and can infect cells in a division stage and a non-division stage; the PD-1 protein expression vector adopts AAV as a vector, the AAV can not generate strong T cell reaction like adenovirus, lentivirus and other vectors, is the only biosafety class I virus identified by NIH, and is the safest virus; the PD-1 protein expression vector of the invention leads the virus to lose the integration site through the genetic engineering technology, is not integrated with the chromosome of a host cell, has high safety and hardly causes human diseases related to adeno-associated virus; the PD-1 protein expression vector of the invention exists in a form of forming end-to-end connected annular high molecular weight polymers, and the structure enables exogenous genes to be expressed for a long time, so that patients can use the vector more conveniently, the frequency is lower, the compliance is increased, and the medication cost of the patients is reduced.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic structural diagram of a PD-1 protein expression vector constructed in example 1 of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

It is therefore intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are apparent from the following detailed description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention.

As described above, currently known anti-tumor drugs aiming at PD-1/PD-L1 interaction are monoclonal antibody drugs, but monoclonal antibody drugs have limitations such as immunogenicity, individual variability and limited indications.

Non-small cell lung cancers include squamous cell carcinoma (squamous cell carcinoma), adenocarcinoma, large cell carcinoma, and low growth and division of cancer cells and relatively late metastasis compared to small cell carcinoma. Non-small cell lung cancer accounts for approximately 80% of all lung cancers, with a low 5-year survival rate as approximately 75% of patients develop in the middle and advanced stages. The PD-1 medicines for the non-small cell lung cancer have high administration frequency, but for patients with the non-small cell lung cancer, the medicines have poor application convenience, low patient compliance and high economic cost.

In order to at least partially solve at least one of the above technical problems, a first aspect of the present invention provides a PD-1 protein expression vector, as shown in fig. 1, comprising an AAV vector, wherein a PD-1 gene fragment is inserted between cleavage sites of a multiple cloning site of the AAV vector. The PD-1 protein expression vector is a recombinant AVV vector, wherein Adeno-associated viruses (AAV) are small, non-enveloped and icosahedral tiny single-stranded DNA viruses, and the recombinant AAV vector is a gene vector modified on the basis of non-pathogenic wild type AAV.

As used herein, the terms "recombinant AAV vector", "recombinant AAV virus", "recombinant AAV virion", "recombinant AAV viral particle" or "AAV gene expression vector" are used interchangeably herein and mean that the AAV virus capsid-enveloped genomic DNA contains a heterologous polynucleotide. The vector may be deleted for the Rep and Cap genes in the genome and replaced with a heterologous polynucleotide expressing the gene of interest, which is then infected, transformed, transduced or transfected into a host cell to express the carried genetic material elements in the host cell. The vector may contain a number of elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, introns, kozak sequences, therapeutic genes, polyA sequences, selection elements, and reporter genes. In addition, the vector may further comprise an origin of replication.

The assembly of recombinant AAV viruses must rely on three components, namely: a transfer vector which consists of a transgene expression reading frame and ITR regions (complete ITRs and incomplete ITRs) of wild type AAV at both sides; cap and rep coding sequences of AAV; helper virus function. AAV vectors have relatively mature assembly systems, which facilitates large-scale production. At present, the AAV vector assembly system commonly used at home and abroad mainly comprises a three-plasmid cotransfection system, a system using adenovirus as helper virus, a packaging system using herpes simplex virus as helper virus and a packaging system based on baculovirus. Among them, the three-plasmid transfection assembly system is the most widely used AAV vector assembly system due to high safety, and is also the mainstream production system in the world at present. Specifically, a three-plasmid transfection assembly system generally comprises three plasmids: recombinant AAV transfer plasmid, wherein only ITR sequences (complete ITR or incomplete ITR) at two ends of genome are retained, rep and Cap genes of wild AAV are deleted, and a heterologous polynucleotide for expressing target gene is substituted; recombinant AAV helper plasmids, which are the genomes of cloned ITR-deleted wild-type AAV, providing the functions of Rep and Cap gene-encoded proteins in trans; and AdV helper virus plasmids containing genes E2a, E4orf6 and VA RNA for helper function. E1a and E1b55k may be provided by the cell to be transfected, for example a HEK293 cell.

The PD-1 protein expression vector can express PD-1 protein in a human body for a long time, and the PD-1 protein is specifically combined with PD-L1 of tumor cells, so that the negative regulation effect of the tumor cells on the T cells is reduced, and the inhibition effect of the T lymphocytes on the growth of the tumor cells is improved; the PD-1 protein expression vector uses AAV as a vector, receptors are Heparan Sulfate Proteoglycan (HSPG), coreceptors alpha beta 5 integrin and Fibroblast Growth Factor Receptor (FGFR), and exist on the surfaces of various cells, so that the AAV can infect various different tissues and cells and can infect cells in a division stage and a non-division stage; the PD-1 protein expression vector adopts AAV as a vector, the AAV does not generate strong T cell reaction like adenovirus, lentivirus and other vectors, is the only biologically safe I virus identified by NIH, and is the safest virus; the PD-1 protein expression vector of the invention leads the virus to lose the integration site through the genetic engineering technology, is not integrated with the chromosome of a host cell, has high safety and hardly causes human diseases related to adeno-associated virus; the PD-1 protein expression vector of the invention exists in a form of forming end-to-end connected annular high molecular weight polymers, and the structure enables exogenous genes to be expressed for a long time, so that patients can use the vector more conveniently, the frequency is lower, the compliance is increased, and the medication cost of the patients is reduced.

In some embodiments, the AAV vector used in the present invention is pAAV-MCS2 vector for insertion of the PD-1 gene fragment, wherein pAAV-MCS2 is prepared by a method commonly used in the art or is commercially available.

Generation of PD-1 protein expression vectors may be accomplished using any suitable genetic engineering technique known in the art, including, but not limited to, standard techniques of DNA homologous recombination, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, such as those of Sambrook et al (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. (1989)).

In some embodiments, the cleavage sites of the AAV vector multiple cloning site are those commonly found in the art, so long as the nucleic acid encoding the PD-1 protein can be cloned into the pAAV-MCS2 vector.

In some embodiments, the cleavage sites of the AAV vector multiple cloning site are the cleavage sites of the restriction enzymes NotI and EcoR I.

In some embodiments, the PD-1 gene fragment is a cDNA encoding a PD-1 protein, and the sequence is shown in SEQ ID No. 1:

SEQ ID NO.1：

ATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAGGTCAGCCGGCCAGTTCCAAACCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTGCTAGTCTGGGTCCTGGCCGTCATCTGCTCCCGGGCCGCACGAGGGACAATAGGAGCCAGGCGCACCGGCCAGCCCCTGAAGGAGGACCCCTCAGCCGTGCCTGTGTTCTCTGTGGACTATGGGGAGCTGGATTTCCAGTGGCGAGAGAAGACCCCGGAGCCCCCCGTGCCCTGTGTCCCTGAGCAGACGGAGTATGCCACCATTGTCTTTCCTAGCGGAATGGGCACCTCATCCCCCGCCCGCAGGGGCTCAGCTGACGGCCCTCGGAGTGCCCAGCCACTGAGGCCTGAGGATGGACACTGCTCTTGGCCCCTCTGA。

it is understood that the above-mentioned nucleic acid sequence as a specific means for encoding the sequence of the gene fragment of the PD-1 protein does not constitute a limitation on the PD-1 gene fragment of the invention.

Furthermore, the PD-1 gene fragment may also be a homologue of the sequence shown in FIG. 1, which homologue can be expressed using a common eukaryotic promoter, and the promoter preceding the homologue of the sequence may be altered by one or more nucleic acid substitutions, insertions or deletions, but these alterations have no effect on the promoter function, and the expression level of the PD-1 protein may be increased by altering the sequence of the promoter, even by replacement of a promoter from a different species.

PD-1 gene fragment homologues also include a class of polynucleic acids having a base sequence capable of hybridizing with the polynucleic acids of the PD-1 gene fragment under standard conditions according to the general method of Molecular biology described in Molecular Cloning/A laboratory Manual.

Further, in order to insert the PD-1 gene fragment into the AAV vector, 5'-CCTCAGC,3' -GGAGTCG was ligated to one end of the PD-1 gene fragment and 5'-GAATTC,3' -CTTAAG was ligated to the other end to effect recombination of the PD-1 gene fragment and the AAV vector by restriction enzymes NotI and EcoR I.

The second aspect of the present invention provides a transformant comprising the above-described PD-1 protein expression vector.

In some embodiments, the above transformants include a host cell and a PD-1 protein expression vector transformed into the host cell. The host cell can obtain an expression product containing the PD-1 protein through expressing a vector or nucleic acid in the genome of the vector.

Specifically, a cell containing the PD-1 protein expression vector is prepared by packaging the PD-1 protein expression vector into a corresponding host cell, so that the host cell can express the PD-1 protein.

In some embodiments, the host cell is an Escherichia coli cell, a HEK293 cell, a Hela cell, or a Vero cell. Among them, the preferred choice is eukaryotic cells, the more preferred choice is HEK293 cells, and the more preferred choice is HEK293 cells with good stability for passage 10-30 generations. HEK293 cells are commercially available cells commonly found in the art.

A third aspect of the invention provides a pharmaceutical composition comprising:

the PD-1 protein expression vector and a pharmaceutically or physiologically acceptable drug carrier. The drug carrier is a system which can change the mode of the drug entering a subject and the distribution of the drug in the body, control the release rate of the drug and deliver the drug to a target organ.

Suitable pharmaceutically acceptable carriers can be obtained in a manner well known to those of ordinary skill in the art. For example, sufficient information regarding pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences. Pharmaceutically acceptable carriers in the compositions may comprise liquids such as water, phosphate buffered saline, ringer's solution, physiological saline, balanced salt solution, glycerol or sorbitol and the like. In addition, auxiliary substances such as lubricants, glidants, wetting or emulsifying agents, pH buffering substances and stabilizers, such as albumin and the like, may also be present in these carriers.

In some embodiments, the pharmaceutical carrier comprises at least one of a filler, a diluent, and an excipient.

It is understood that the pharmaceutical composition provided by the invention can be expressed in a subject for a long time after the PD-1 protein expression vector is delivered into the subject by the pharmaceutical vector

The fourth aspect of the present invention provides a use of the above PD-1 protein expression vector, the above transformant, or the above pharmaceutical composition for the preparation of a medicament for the treatment of cancer.

In some embodiments, the cancer comprises non-small cell lung cancer.

The fifth aspect of the present invention provides a method for constructing a PD-1 protein expression vector, comprising: obtaining a PD-1 gene segment, adopting PCR to amplify the PD-1 gene segment, and inserting the PCR amplified segment on an AAV vector to obtain a PD-1 protein expression vector.

In some embodiments, the PD-1 gene fragment can be artificially extracted by reverse transcription or can be artificially synthesized directly.

In some embodiments, the PCR amplification primers comprise an upstream primer having a sequence shown in SEQ ID NO.2 and a downstream primer having a sequence shown in SEQ ID NO. 3;

SEQ ID NO.2：5’-CCTCAGCATGCAGATCC-3’；

SEQ ID NO.3：3’-CTTGGCCCCTCTGACTTAAG-5’。

as used herein, the term "primer" refers to an oligonucleotide, whether naturally occurring in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions that induce synthesis of a primer extension product that is complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency of amplification, but may alternatively be double stranded. If double stranded, the primers are first treated to separate their strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to prime the synthesis of extension products in the presence of the inducing agent. The exact length of the primer will depend on many factors, including temperature, source of primer, and use of the method. For example, in some embodiments, the primer ranges from 10-100 or more nucleotides (e.g., 10-300, 15-250, 15-200, 15-150, 15-100, 15-90, 20-80, 20-70, 20-60, 20-50 nucleotides, etc.).

Embodiments of the present invention will be described in detail with reference to examples.

Example 1

1. Obtaining PD-1 gene fragment

In this example, a DNA template comprising the sequence shown in SEQ ID NO.1 was constructed, and PCR reaction was performed using primers 5'-CCTCAGCATGCAGATCC and 3' -CTTGGCCCCTCTGTACTTAAG to obtain an amplified PD-1 gene fragment solution.

The PCR reaction system is as follows: in a 50ul reaction system, 1ul of the nucleotide sequence enriched by PCR, 1ul of each of the primers, 4ul of dNTP, 10ul of 5 Xbuffer solution, 1ul of Taq enzyme, and a double distilled water supplement system are added to 50ul. The PCR reaction program is: (1) pre-denaturation at 95 ℃ for 5 min; (2) denaturation at 93 ℃ for 45 seconds; (3) annealing at 56 ℃ for 30 seconds; (4) Extension at 72 ℃ for 40 seconds, and the procedures (2) - (4) were repeated for 30 cycles; (5) extension at 72 ℃ for 10 minutes. After the PCR is finished, the PCR amplified fragment is collected by purification after being recovered by gel electrophoresis, so as to obtain PD-1 gene fragment solution. Wherein, the used PCR kit can be a DP219-03 kit of the Tiangen biochemical technology.

2. Construction of expression vector for PD-1 protein

The PD-1 gene fragment solution and the pAAV-MCS2 plasmid obtained in the example 1 were subjected to enzyme digestion with two enzymes, not I and EcoR I (purchased from NewEngland), in a system of: PD-1 gene fragment solution/plasmid 4ul, not I and EcoR I each 1ul, 10 Xbuffer solution 2ul, double distilled water 12ul, enzyme digestion conditions for 37 degrees C water bath 4 hours. The product after double digestion is subjected to ligation reaction by using T4 ligase (purchased from Invitrogen) in the following reaction system: adding 10ul of the digested PD-1 protein expression vector, 1ul of the digested pAAV-MCS2 plasmid, 1ul of T4 ligase, 2.5ul of 10 Xbuffer solution and 10.5ul of double distilled water, wherein the connection condition is 16 ℃ overnight, so as to obtain the PD-1 protein expression vector AAV-PD-1 shown in figure 1.

3. Packaging, purification and titer detection of expression vectors

HEK293 cells were used as packaging cells and cultured in DMEM medium containing 10% fetal bovine serum. When the cell generated fusion degree is 80% -85%, co-transfecting HEK293 cells (purchased from ATCC) with constructed three plasmids pAAV-PD1, pAAV-RC (purchased from Invitrogen) and pAAV-Helper (purchased from Invitrogen) by using a Lipo3000 transfection method, wherein the total amount of the three plasmids is 10.5ug (wherein the addition ratio of XXX vector: pAAV-RC vector: pAAV-Helper vector is 1.1), the addition amount of a transfection reagent Lipo3000 is 21ul, mixing the two solutions into DMEM, complementing the total volume to be 1ml, and standing for 15 minutes; the transfection is started.

Adding 1ml of the mixed solution after standing into each 10 cm-dish, and culturing in a carbon dioxide incubator under the condition of 5% CO ₂ And cultured at 37 ℃ for 24 hours, the medium was replaced with fresh one, and the cells were collected after culturing for another 48 hours. Freezing and thawing the cells in-80 refrigerator for three times, and adding Dnase I and RAnd (3) nase A with the final concentration of 0.1mg/ml, performing water bath at 37 ℃ for 30 minutes, centrifuging at 3000g for 30 minutes, collecting the supernatant into a 50ml centrifuge tube, filtering by using a 0.45um filter, and collecting the supernatant again to obtain the virus crude extract.

The virus extract was purified according to the literature (Hum Gene ther.2001Jan 1,12 (1): 71-6). Adding 2ml heparin-agarose into the chromatographic column, balancing with 50ml 1XPBS, passing the virus crude extract through the column, washing the column with 25ml 0.15M NaCl solution for 2 times, eluting the virus with 15ml 0.4M NaCl solution, concentrating the virus liquid with a concentration column, and keeping at-80 deg.C for later use.

The titer of the AAV-PD-1 virus is detected by using a qPCR method, and the titer of the AAV is 4.3X10 ¹³ v.g/ml。

Example 2

Raji cells used in this example were purchased from the cell bank of Chinese academy of sciences, PD-1 protein (cat # 10377-H08H-B) and anti-PD-1 antibody (anti-PD-1) were purchased from Shanghai Yi Qiaoshenzhou (cat # 10377-MM 23), and human peripheral blood cells (PBMC) were purchased from Miaoshun Biotechnology (Shanghai) Co., ltd. AIM-V, DMEM/F12, fetal bovine serum, PBS were purchased from Thermo. T cell sorting kits were purchased from Miltenyi.

Raji cell culture: raji cells were cultured in DMEM/F12 containing 10% fetal bovine serum at 37 ℃ with 5% CO ₂ Wherein the Raji cells do not express PD-1.

Human T cell culture: separating human peripheral blood cells according to the T cell sorting kit, culturing the separated T cells under 37 ℃ and 5% CO ₂ Wherein the human T cell expresses PD-1.

The cells were cultured in a 96-well plate, and anti-PD-1 antibody was added and analyzed. Cultured Raji cells and human T cells were seeded into 96-well plates at 25000 cells per well. The specific inoculation is shown in the following table:

wherein the culture medium is added in an amount of 100ul per well

Adding A1, B1 and C1: DMEM/F12 in 10% serum;

adding A2, B2 and C2: AIM-V medium;

adding A3, B3 and C3: DMEM/F12 and Raji cells in 10% serum;

adding A4, B4 and C4: DMEM/F12 and Raji cells in 10% serum and packaged rAAV virus constructed this time 2.5 x10 ⁶ ；

A5, B5, C5: AIM-V medium and human T lymphocytes;

a6, B6, C6: PD-1 protein is coated in advance, and then 10% serum DMEM/F12 is added;

after addition according to the above conditions, the well plate was placed at 37 ℃ and 5% CO ₂ Culturing in an incubator for 2 hours, adding 1ng/ml anti-PD-1 with the volume of 10ul into each hole, culturing in the incubator for 16 hours, cleaning, and detecting the luminous intensity by using an enzyme-labeling instrument.

The results are shown in table 1:

TABLE 1

	1	2	3	4	5	6
							A	0	0	0.823	38.624	62.831	130.672
B	0	0	1.139	47.297	79.362	206.376
							C	0	0	0.362	43.820	73.735	163.284

As can be seen from Table 1, raji cells which do not express PD-1 can express PD-1 and combine with anti-PD-1 after adding the PD-1 protein expression vector constructed by the invention and inserting the recombinant AAV vector with PD-1 gene, and the PD-1 protein expression vector constructed by the invention can express a certain amount of PD-1 protein in cells, and the expression amount can reach more than half of the expression amount of human T lymphocytes under the same condition.

The technical features of the above embodiments can be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the above embodiments are not described, but should be considered as the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above examples only show several embodiments of the present invention, and the description thereof is specific and detailed, but not to be construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent should be subject to the appended claims.

Claims

1. A PD-1 protein expression vector is characterized by comprising an AAV vector, wherein a PD-1 gene segment is inserted between enzyme cutting sites of a multiple cloning site of the AAV vector.

2. The expression vector of claim 1, wherein the PD-1 gene segment has the sequence shown in SEQ ID No. 1.

3. The expression vector according to claim 2, wherein the cleavage site of the multiple cloning site is a cleavage site of restriction enzymes NotI and EcoRI.

4. A transformant comprising the expression vector according to any one of claims 1 to 3.

5. The transformant according to claim 4, wherein the transformant comprises a host cell and the expression vector transformed into the host cell.

6. The transformant according to claim 5, wherein the host cell is an Escherichia coli cell, an HEK293 cell, a Hela cell or a Vero cell.

7. A pharmaceutical composition, comprising:

the expression vector of any one of claims 1 to 3, and a pharmaceutically or physiologically acceptable pharmaceutical carrier.

8. The pharmaceutical composition of claim 7, wherein the pharmaceutical carrier comprises at least one of a filler, a diluent, and an excipient.

9. Use of the expression vector according to any one of claims 1 to 3, the transformant according to claims 4 to 6, or the pharmaceutical composition according to claim 7 for the preparation of a medicament for the treatment of cancer.

10. The use of claim 9, wherein the cancer is non-small cell lung cancer.