CN115807034B - Application of UGT84A1 gene in regulation and control of anthocyanin synthesis - Google Patents

Abstract

The invention discloses an application of UGT84A1 gene in regulating anthocyanin synthesis, and relates to the field of biotechnology, wherein the application comprises the steps of enabling the function of the UGT84A1 gene to be lost so as to reduce anthocyanin content or enabling the UGT84A1 gene to be overexpressed so as to increase anthocyanin content. The invention utilizes UGT84A1 gene to control synthesis of anthocyanin in plant body, and provides powerful technical support for improving the anthocyanin content of pasture so as to improve the quality of pasture.

Description

Application of UGT84A1 gene in regulation and control of anthocyanin synthesis

Technical Field

The invention belongs to the technical field of biology, and relates to application of UGT84A1 gene in anthocyanin synthesis regulation.

Background

Glycosyltransferases are enzymes that transfer an active sugar to a different acceptor molecule, such as a protein, nucleic acid, lipid, small molecule substance, etc., to alter its stability, solubility, biological activity, localization, etc. (Hou et al, 2004; 2001). Glycosylation is a common chemical modification in organisms, catalyzed by glycosyltransferases, which is an important mechanism for regulating plant growth and development and intracellular material balance. Uridine Diphosphate (UDP) -glycosyltransferases (UGT) in the glycosyltransferase family play the most important role in glycosylation modification mechanisms (Rahimi et al, 2019). UGT members have a conserved amino acid sequence at the C-terminus consisting of 44 amino acids, known as the PSPG region (plant secondary product glycosyltransferase), which is associated with the recognition binding of UDP, when this region is mutated, glycosyltransferase activity is lost (Huang et al, 2021; li et al, 2001). While N-terminal amino acid sequences are often diverse, and are thought to be involved in recognition of substrates, which are typically molecular species with-OH, -COOH, -NH2, -SH (Lim and Bowles, 2004). UGT members typically have UDP-sugar as the sugar donor, including UDP-glucose, UDP-galactose, UDP-rhamnose, etc., with UDP-glucose being the most common sugar donor (Lim and Bowles, 2004).

Anthocyanin is a water-soluble flavonoid substance and has important value for the health of human and animals. The study shows that anthocyanin has various biological activities such as oxidation resistance, inflammation resistance, cancer resistance and the like, and can prevent cardiovascular diseases (Fairie-Jones et al, 2017; gan et al, 2020; reis et al, 2016). Therefore, the anthocyanin has important nutritional value and pharmacological value and important research value in crop improvement.

Then, at present, there are relatively few studies on how to control anthocyanin synthesis from the gene level.

Disclosure of Invention

In order to realize rapid cultivation of plants capable of controlling anthocyanin synthesis, the invention discovers that the anthocyanin content in the plants can be improved by over-expressing the UGT84A1 gene, and the anthocyanin content in the plants can be reduced by losing the function of the UGT84A1 gene.

In order to achieve the technical purpose of the invention, the first aspect of the invention provides application of UGT84A1 gene in regulating anthocyanin synthesis.

In particular, the application comprises at least any one of B1) to B3):

b1 Increasing anthocyanin accumulation by increasing UGT84A1 gene expression in plants;

b2 Reducing anthocyanin accumulation by inhibiting UGT84A1 gene expression in a plant;

b3 The UGT84A1 gene or a biological agent for promoting the expression of the UGT84A1 gene or a biological agent for inhibiting the expression of the UGT84A1 gene is used for preparing a preparation for regulating the anthocyanin content of plants.

Wherein the plant is cruciferous or leguminous.

Preferably, the plant is Arabidopsis thaliana or alfalfa.

Wherein, the increase of anthocyanin accumulation by increasing UGT84A1 gene expression in plants is achieved by increasing the number of active genes by genetic engineering means, comprising:

the UGT84A1 gene is ligated into an over-expression vector and the host cell is transfected, which is capable of transfecting the plant and integrating the gene of interest into the chromosome of the plant.

In particular, the reduction of anthocyanin accumulation by inhibiting the expression of UGT84A1 gene in plants is by genetic engineering means to disable UGT84A1 gene function.

In particular, the loss of UGT84A1 gene function by genetic engineering means includes insertion of a Tnt transposon into the UGT84A1 gene.

In particular, the loss of UGT84A1 gene function by genetic engineering means includes inhibition of UGT84A1 gene expression by RNAi.

Wherein, the suppression of UGT84A1 gene expression by RNAi is realized by constructing an RNAi expression vector and transferring the RNAi expression vector into alfalfa plants, so as to further suppress the expression of UGT84A1 gene.

In particular, the loss of UGT84A1 gene function by genetic engineering means includes knocking out the UGT84A1 gene using gene editing.

Wherein the gene editing includes, but is not limited to CRISPR, TALEN.

To achieve the technical object of the present invention, a second aspect of the present invention provides an application of UGT84A1 mutant in reducing anthocyanin accumulation in plants, wherein the UGT84A1 mutant contains UGT84A1 gene inserted into Tnt transposon.

In order to achieve the technical purpose of the invention, the invention provides the application of the UGT84A1 over-expression vector in improving the anthocyanin accumulation in plants.

In order to achieve the technical object of the present invention, a fourth aspect of the present invention provides a method for promoting anthocyanin content in plants, comprising: obtaining the plants with high expression UGT84A1 genes by genetic engineering means.

In order to achieve the technical object of the present invention, a fifth aspect of the present invention provides a method for reducing anthocyanin content in plants, comprising: the plants with suppressed UGT84A1 expression were obtained by inserting Tnt transposon into UGT84A1 or suppressing UGT84A1 gene expression by RNAi or knocking out UGT84A1 gene in the plants using gene editing.

In order to achieve the technical object of the present invention, a sixth aspect of the present invention provides a method for cultivating a plant, by increasing the expression level of UGT84A1 protein in a recipient plant, to obtain a transgenic plant; the transgenic plants have increased anthocyanin levels compared to the recipient plants.

In order to achieve the technical object of the present invention, a seventh aspect of the present invention provides a method for cultivating a plant, by reducing the expression level of UGT84A1 protein in a recipient plant, to obtain a plant; the anthocyanin content in the plant is reduced compared to the recipient plant.

The invention has the beneficial effects that the UGT84A1 gene is utilized to enable the UGT to be over-expressed or lose the function in plants, so that plants with increased or reduced anthocyanin content can be quickly cultivated, and the improvement of pasture quality provides powerful technical support.

Drawings

FIG. 1 is a graph of the results of the identification of mtugt84a1 mutants at the DNA and RNA level of example 1, wherein 1A represents the insertion position of Tnt1 at the mtugt84a1-2 mutant; 1B represents that the mutant is homozygote, and 1C represents the expression result of the MtUGT84A1 gene in the mutant;

FIG. 2 is a graph showing the results of phenotypic analysis of mtugt84a1 mutant in example 1, wherein FIG. 2A is a photograph of hypocotyl and petiole of seedling material after germination of wild type and mutant, FIG. 2B is a photograph of leaf and petiole of wild type and mutant at the seedling stage (30 days of emergence), FIG. 2C is a photograph of phenotype of whole plant grown for 3 months of wild type and mutant material, FIG. 2D is an enlarged photograph of branching of plant of FIG. C, FIG. 2E is a result of measurement of petiole length of wild type and mutant material, FIG. 2F is a result of measurement of anthocyanin content of wild type and mutant material, and FIG. 2G is a result of measurement of plant height of wild type and mutant material; FIG. 2H is a graph showing the results of the internode length measurement of wild-type and mutant materials, and FIG. 2I is a graph showing the results of the internode number measurement of wild-type and mutant materials;

FIG. 3 is the result of analysis of the expression of anthocyanin synthesis genes in example 2;

FIG. 4 is the anthocyanin glycoside content measurement results of the wild-type and mutant materials in example 3, wherein FIG. 4A shows the anthocyanin paeoniflorin 3-O-glucoside (Peonidin 3-O-glucoside) content measurement results of the wild-type and mutant materials, and FIG. 4B shows the anthocyanin Delohinidin 3-O-glucoside content measurement results of the wild-type and mutant materials;

FIG. 5 is a result of examining the glycosylation activity of MtUGT84A1 in example 4, 5A represents the paeoniflorin glycosylation activity, 5B represents the delphinidin glycosylation activity

FIG. 6 is a graph of the predicted positions of 6 light responsive elements and 2 jasmonic acid responsive elements on the MtUGT84A1 promoter, FIG. 6A is a graph showing the expression level of MtUGT84A1 in wild-type and mutant materials after treatment with different light intensities (NIL indicates normal light, HIL strong light), FIG. 6C is the color of the phenotypic stem and leaf stalk of the wild-type and mutant materials under different light intensities, and FIG. 6D is the anthocyanin content in the wild-type and mutant materials under different light intensities, as measured in example 5.

FIG. 7 is a graph showing phenotypes of examples 6 at different MeJA concentrations, wherein FIG. 7A is a photograph showing the phenotypes of the wild type and the mutant, FIG. 7B is a statistical result of the leaf stalk lengths of the wild type and the mutant, FIG. 7C is a measurement result of the coronary anthocyanin content, and FIG. 7D is a result of the expression of the MtUGT84A1 gene;

FIG. 8 is a alfalfa phenotype overexpressing MtUGT84A1 in example 7, wherein FIG. 8A is a photograph of the bud stems of 2 plants of the overexpressing material and the wild-type material, FIG. 8B is a photograph of the plants of 2 plants of the overexpressing material and the wild-type material, FIG. 8C is the result of the expression of the MtUGT84A1 gene of 2 plants of the overexpressing material and the wild-type material, and FIG. 8D is the result of the anthocyanin content of the overexpressing material and the wild-type material;

FIG. 9 is a photograph of plants over-expressing MtUGT84A1 Arabidopsis phenotype in example 7, wherein FIG. 9A is a photograph of 3 plants over-expressing material and wild type material, and FIG. 9B is a photograph of leaves of 3 plants over-expressing material and wild type material; FIG. 9C shows the results of detecting the expression level of MtUGT84A1 gene of 3 strains of over-expressed material and wild type material. FIG. 9D shows anthocyanin content determination results for 3 strains of over-expressed material and wild-type material.

Detailed Description

The invention will now be described with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. Unless otherwise indicated, the technical means employed in the examples are conventional means well known to those skilled in the art, and the reagents and products employed are also commercially available. The various processes and methods not described in detail are conventional methods well known in the art, the sources of the reagents used, the trade names and those necessary to list the constituents are all indicated at the first occurrence, and the same reagents used thereafter, unless otherwise indicated, are the same as those indicated at the first occurrence.

Example 1 Source of MtUGT84A1 Gene

According to the invention, more than 50 parts of medicago terrestris Tnt1 mutant materials are subjected to phenotype screening and are compared with wild medicago terrestris R108, so that medicago terrestris mutants mtugt84a1-1 (NF 17856) and mtugt84a1-2 (NF 7002) with suppressed anthocyanin accumulation and short plants are obtained. The mutant materials and wild-type materials described above were all purchased from Nobel institute (Noble Research Institute, ardmere, OK, USA).

0028. To identify the genes responsible for the phenotype of the mutant, we sequenced the mutant, with reference to published articles (Li et al, 2019). The flanking sequence of Tnt1 was sequenced using the Tnt transposon specific fragment as probe, enriching for the DNA fragment with Tnt1, and identifying the insertion position of Tnt 1. The primers used for sequencing are:

Tnt1FW：ACAGTGCTACCTCCTCTGGATG；

Tnt1Re ：CAGTGAACGAGCAGAACCTGTG；

F：ATGACATACG AAGATCCCAT TAA；

R：CTAGATGTTAACATTATTAATTAAT。

the sequencing results are shown in Table 1, and total 11 genes are within a confidence range, with the highest probability of enrichment of Mtr1g107285 on chromosome 1 and Mtr2g033880 on chromosome 2. The technical purpose of the invention can be achieved by cutting 50 mutant leaves, mixing and extracting DNA, selecting flanking sequences of 11 genes at both ends of Tnt in Table 1, designing primers, and adopting a conventional method in the field and designing primers according to flanking sequences at both ends of Tnt 1. The amplified bands of 11 genes in the mixed DNA were then detected by PCR. The results showed that only the detection of Mtr1g107285 did not amplify the band, and that the phenotype of this mutant was due to the Tnt insertion of the Mtr1g107285 gene. Mtr1g107285 encodes uridine diphosphate-glucosyltransferase (uridine diphosphate (UDP) -glucosyltransferase, UGT), which shows 50.9% homology to arabidopsis thaliana AtUGT84A1, and thus is designated MtUGT84A1, NF17856 is designated MtUGT84A1-1.

TABLE 1 Tnt1 insertion sites

。

The inventor researches that Tnt transposons of the medicago truncatula mutant MtUGT84A1-1 (NF 17856) and MtUGT84A1-2 (NF 7002) are inserted at different loci of the MtUGT84A1 gene. Tnt1 was inserted 1,252 bp downstream of the mtugt84a1-1 mutant ATG and Tnt1 was inserted 830 bp downstream of the mtugt84a1-2 mutant ATG, both mutants being pure and as shown in FIGS. 1A and 1B. The RNA level assay showed that insertion of Tnt1 resulted in no expression of the MtUGT84A1 gene in both mutants (fig. 1C).

It can be seen that insertion of Tnt1 resulted in no expression of the MtUGT84A1 gene in both mutants, resulting in inhibition of anthocyanin accumulation.

Wherein, the nucleotide sequence of the MtUGT84A1 Gene is shown as GenBank: gene ID: 25485386 Gene number MTR_1g 107285.

Of course, the person skilled in the art can also apply other conventional techniques in the art to reduce or not express the MtUGT84A1 gene in the plant body, for example, by constructing an RNAi expression vector to transfer into the plant, so as to interfere with the expression of the UGT84A1 gene or inhibit the expression of the UGT84A1 gene, and can also use a gene editing technique to edit the UGT84A1 gene in the plant, for example, CRISPR knockout of the UGT84A1 gene or TALEN editing of the UGT84A1 gene.

Example 2 phenotypic identification of mutant materials

1. Culture of mutant materials

The alfalfa mutant mtugt84a1-1 (NF 17856), mtugt84a1-2 (NF 7002) and wild type R108 from alfalfa (Medicago truncatula) from Norbeol institute (Noble Research Institute, ardmere, OK, USA) were grown in culture using an incubator, specifically:

the alfalfa seeds are lightly rubbed on fine sand paper to remove hard skin, the seeds are spread on wet filter paper, the wet filter paper is put in a refrigerator for hydration for two days at the temperature of 4 ℃, and the alfalfa seeds are germinated and grown in an incubator with the illumination period of 16 h (light)/8 h (dark) at the temperature of 24 ℃ for 4 days until two leaves stretch, so as to obtain the alfalfa mutant mtugt84a1-1 (NF 17856) seedlings and wild-type R108 seedlings of the caltrops.

Mixing imported soil, vermiculite and northeast black soil according to a ratio of 1:1:1, subpackaging into small flowerpots, wetting the soil in advance, transplanting the seedlings for 4 days into the soil for continuous culture, wherein the culture photoperiod is 16 h (light)/8 h (dark), and the humidity is as follows: 70%, temperature: and (3) obtaining plants at 24 ℃.

2. Phenotypic identification

The growth state and anthocyanin content of the mutant and wild alfalfa in the seedling stage and the adult stage are observed, and the specific phenotype observation results are shown in figure 2.

As can be seen from fig. 2A, the color of the hypocotyl of the mutant at the seedling stage is lighter than that of the wild type R108, because the color of the hypocotyl of the wild type 108 at the seedling stage is purple, and the color of the hypocotyl of the mutant at the seedling stage is emerald, resulting in the lightening of the color of the hypocotyl of the mutant at the seedling stage and the color of the leaves and stems throughout the growth stage in fig. 2A. At the same time, the spots peculiar to the wild type leaves disappeared, the whole leaf was light-colored (fig. 2B), and the mutant strain height and internode length were significantly lower than those of the wild type (fig. 2C, fig. 2D). The mutant petiole length was significantly shorter than the wild type (fig. 2E), the anthocyanin content measurement results showed that the anthocyanin content of both mutants was significantly reduced (fig. 2F), and the plant height statistics for the wild type and the mutants showed that the plant height and internode length of the mutants were significantly lower than those of the wild type (fig. 2G, fig. 2H), and the number of nodes was significantly greater than that of the wild type (fig. 2I). It can be seen that the mutants have a phenotype of accumulation of anthocyanin content and inhibition of growth and development.

Example 3 analysis of anthocyanin in mtugt84a1 mutant

1. Detection of anthocyanin synthesis-related genes

In order to determine the link of changing anthocyanin synthesis pathways, the inventor carries out sequencing analysis on RNA of the mutant and wild type, and finds that anthocyanin synthesis genes MtCHS, mtCHI, mtF H and MtDFR are obviously up-regulated, and the detection result of the qRT-PCR method is shown in figure 3. Wherein, the primers used for qRT-PCR are:

MtActin11 F:CAAAAGATGGCAGATGCTGAGGAT；

MtActin11 R:CATGACACCGGTATGACGAGGTCG。

AtActin2/8 F:ACGGTAACATTGTGCTCAGTGGTG；

AtActin2/8 R:CTTGGAGATCCACATCTGCTGGA。

MtUGT84A1 F:GCAAAGGGTGCCACTGTTAT；

MtUGT84A1 R:AGAGCTCTGAAGGCTGAACG。

MtF3H F:CATCAAGCACCACAGAATGG；

MtF3H R:GGGAAAGAGGTGTTGATGGA。

MtCHS F: GCAGTCATTGTTGGCTCTGA ；

MtCHSR: GGAATGCCTCAAACAATGCT。

MtCHI F：TCAATCACCGCAATCACTGT ；

MtCHI R：TCCATTTGGCAGCTAGTGAA。

MtDFR F： TCAAGTGGTTCTGCTGTTTCA；

MtDFR R：GCTTAGGGCAAACAAAACGA。

MtMYC2 F ：CCTGAACTTGGAATGGAGGA；

MtMYC2 R ：CTTGGTTGGCCTTGTTTGAT。

of course, the skilled artisan can also design primers using conventional methods.

From fig. 3, it can be seen that after the MtUGT84A1 gene is mutated, the anthocyanin synthesis gene is up-regulated, which indicates that the decrease of anthocyanin content in MtUGT84A1 mutant is not caused by the defect of synthesis stage, and it can be seen that MtUGT84A1 plays a feedback regulation role in anthocyanin synthesis pathway, thereby finely regulating anthocyanin balance.

2. Qualitative and quantitative analysis of anthocyanin

Since the total anthocyanin content of the mtugt84a1 mutant is significantly lower than that of the wild type, and the anthocyanin synthesis gene is up-regulated, it can be seen that the reduction in anthocyanin content is not caused by anthocyanin synthesis defects. Thus, the invention performs liquid chromatography-tandem mass spectrometry analysis on anthocyanin in wild type and mtugt84a1 mutants. The results showed that the content of various anthocyanin glycosides in mtugt84a1 mutant was significantly reduced, including paeoniflorin 3-oxo-glucoside and its derivatives paeoniflorin 3, 5-oxo-diglucoside and paeoniflorin 3-oxo (6-oxo-malonyl-D-glucoside) were reduced to 20%, 24% and 20% of wild type, respectively, and delphinidin 3-oxo-glucoside and its derivatives, morning glory 3-oxo-glucoside were reduced to 38% and 30% of wild type, respectively (fig. 4, table 1). Some of the flavonol glycosides, such as quercetin 3-oxo-glucoside and rutin, are also significantly lower than the wild type, and procyanidin B2 is also significantly reduced. The results show that the content of main anthocyanin such as anthocyanin 3-oxo-glucoside and the like is obviously reduced after the MtUGT84A1 gene is mutated.

TABLE 2 flavonoid metabolite content of wild type and mutant materials

。

Example 4 in vitro detection of glycosylation of paeoniflorin and delphinidin by MtUGT84A1

The present invention also detects the glycosylation activity of MtUGT84A1 in vitro, further revealing the effect of MtUGT84A1 on anthocyanin glycosylation. Specifically, mtUGT84A1 and MtUGT84A1 delta PSPG (deletion of UDP binding domain PSPG) are respectively connected with a carrier with GST tag, and Escherichia coli BL21 is transformed, and the protein with GST tag is purified in vitro. Taking glucose as a sugar donor, and respectively carrying out incubation reaction on each protein and paeoniflorin and delphinidin. The results show that MtUGT84A1 is capable of glycosylating paeoniflorin and delphinidin in vitro. With paeoniflorin 3-oxo-glucoside and delphinidin 3-oxo-glucoside as controls, absorption peaks were detected at 7min and 6min, respectively, whereas neither GST tag protein nor MtUGT84A1 Δpspg protein was able to glycosylate both anthocyanidins (as shown in fig. 5). It can be seen that MtUGT84A1 is capable of glycosylating paeoniflorin and delphinidin in vitro, thereby affecting anthocyanin accumulation.

Example 5 light-induced MtUGT84A1 regulates anthocyanin accumulation

Anthocyanin synthesis and accumulation is regulated by light (Jaakola et al, 2002 Steyn et al, 2002). Therefore, the invention also analyzes the promoter of MtUGT84A1 gene ATG front 2 kb, finds 6 light response elements on the promoter and six light color vertical lines in FIG. 6A, and simultaneously finds two jasmonic acid response elements and two dark color line segments in FIG. 6A, which implies that the expression of MtUGT84A1 is regulated by light, and firstly detects whether the MtUGT84A1 gene responds to different light intensities. Wild-type and mutant material were subjected to intense light treatment (450 mol m-2 s-1). The results showed that the expression level of MtUGT84A1 in wild-type material was significantly increased (fig. 6B), the color of the stems and petioles of wild-type material was significantly deepened (fig. 6C), the anthocyanin content was also significantly increased, and the phenotype and anthocyanin content of mutant material were not significantly different (fig. 6D) after the intense light treatment as compared to the normal light (150 mol m-2 s-1).

It can be seen that strong light induced expression of MtUGT84A1, thereby promoting anthocyanin accumulation.

Example 6 MtUGT84A1 Regulation of alfalfa growth in Tribulus terrestris by the jasmonic acid signaling pathway

Analysis of the MtUGT84A1 gene promoter revealed a MeJA responsive element on the promoter (fig. 6A). Thus, the present invention detects changes in wild type and mtugt84a1 mutant phenotypes at different concentrations of MeJA. Wild type and mutant materials were subjected to 20M MeJA and the phenotype of each material was then examined. The results showed that when MeJA was applied externally in hydroponics, wild type growth was inhibited, plant height and petiole length were similar to the phenotype of the mutant growth inhibition, and the color of the stem was significantly darkened, while the phenotype of the mutant was not significantly altered (fig. 7A, B). The anthocyanin content measurement results showed that the wild type material anthocyanin content was significantly increased after 20M MeJA treatment, and the anthocyanin content in the mutants was not significantly different (fig. 7C). The expression level detection result showed that the expression of MtUGT84A1 gene was elevated by MeJA induction (fig. 7D). The research result shows that the phenotype of the inhibited growth of the MtUGT84A1 mutant is probably caused by the excessive in-vivo jasmonic acid content, and the up-regulation of the expression quantity of the MtUGT84A1 under the induction of the jasmonic acid plays an important role in anthocyanin accumulation regulation.

From the test results of examples 4 to 6, it can be seen that the MtUGT84A1 gene plays an important role in anthocyanin accumulation regulation.

Example 7 overexpression test of MtUGT84A1 Gene

In order to further prove the functions of the MtUGT84A1, the CDS sequence of the MtUGT84A1 is connected with an over-expression vector pCAMBIA1302 to obtain a 35S/MtUGT 84A1 high-expression vector, and then the vector is transferred into agrobacterium EHA105 and GV3101, and finally the vector is respectively transferred into wild type medicago truncatula and wild type arabidopsis thaliana to obtain medicago truncatula over-expression materials and arabidopsis thaliana over-expression materials.

Wherein the CDS sequence is obtained by https:// plants:. Org/medicago_truncatum/Info/Index, SEQ ID NO. 25485386, methods for transforming alfalfa (Cosson et al, 2006), methods for transforming Arabidopsis (Clough and Bent, 1998).

1. Phenotypic verification of alfalfa overexpressing material

Two overexpressing materials with significantly higher expression levels than the wild-type were selected for phenotypic testing, and the results are shown in FIG. 8. The color of the hypocotyl and stem of the overexpressing material was significantly darker than that of the wild-type (fig. 8A-C), and the anthocyanin content measurement results showed that the overexpressing material was significantly higher than that of the wild-type (fig. 8D). It can be seen that overexpression of the MtUGT84A1 gene promotes accumulation of alfalfa anthocyanin in Tribulus terrestris.

2. Phenotypic validation of Arabidopsis overexpressing materials

Three arabidopsis overexpression materials with significantly higher expression levels than the wild type were selected for phenotypic detection, as shown in fig. 9, the results showed that the color of the rosette leaves of the arabidopsis with the over-expression of MtUGT84A1 was significantly darker than that of the wild type (fig. 9A-C), and the anthocyanin content measurement results showed that the anthocyanin content of the overexpression materials was significantly higher than that of the wild type (fig. 9D). Further described, the MtUGT84A1 gene is capable of promoting plant anthocyanin accumulation.

In summary, loss of the function of the MtUGT84A1 gene resulted in inhibition of anthocyanin accumulation in the mutant material compared to the mutant and wild-type materials, while the MtUGT84A1 gene over-expression material promoted anthocyanin accumulation.

Therefore, the UGT84A1 gene in the plant body is highly expressed by a person skilled in the art through a conventional genetic engineering means, so that anthocyanin content in the plant can be promoted or transgenic plants can be cultivated; the UGT84A1 gene is lost through a molecular biotechnology means, so that anthocyanin accumulation in plants can be reduced or transgenic plants can be cultivated.

The invention is not limited to the specific embodiments illustrated, but any equivalent modifications of the technical solution of the invention will be covered by the claims of the invention by a person skilled in the art from reading the present specification.

Claims (7)

1. Use of the ugt84a1 gene for regulating anthocyanin synthesis in medicago truncatula, characterized in that said use is any one of B1) to B3):

   b1 Increasing anthocyanin accumulation by increasing UGT84A1 gene expression in herba Tribuli;

   b2 Reducing anthocyanin accumulation by inhibiting the expression of UGT84A1 gene in medicago truncatula;

   b3 The UGT84A1 gene or a biological agent for promoting the expression of the UGT84A1 gene or a biological agent for inhibiting the expression of the UGT84A1 gene is used for preparing a preparation for regulating the anthocyanin content of the medicago truncatula.
2. 2. Use according to claim 1, wherein B1) is the ligation of the UGT84A1 gene to an over-expression vector and the transfection of host cells capable of transfecting medicago truncatula and integrating the gene of interest into the chromosome of medicago truncatula.
3. 3. Use according to claim 1, wherein said B2) reducing anthocyanin accumulation by inhibiting UGT84A1 gene expression in medicago truncatula is by genetic engineering means to disable UGT84A1 gene function selected from any one of C1) to C3):

   c1 Insertion of the Tnt transposon into the UGT84A1 gene;

   c2 Inhibition of UGT84A1 gene expression by RNAi;

   c3 Using gene editing to knock out UGT84A1 gene in medicago truncatula.
4. 4. A method for promoting anthocyanin content in medicago truncatula is characterized in that a plant with high expression UGT84A1 gene is obtained through a genetic engineering means.
5. 5. A method for reducing anthocyanin accumulation in medicago truncatula, characterized in that it is selected from any one of D1) to D3):

   d1 Insertion of the Tnt transposon into the UGT84A1 gene;

   d2 Inhibition of UGT84A1 gene expression by RNAi;

   d3 Using gene editing to knock out UGT84A1 gene in medicago truncatula.
6. 6. A method for cultivating medicago truncatula is characterized in that the transgenic medicago truncatula is obtained by increasing the expression level of UGT84A1 protein in receptor medicago truncatula; compared with the receptor medicago sativa, the anthocyanin content of the transgenic medicago sativa is increased.
7. 7. A method for cultivating medicago tribulus is characterized in that the medicago tribulus is obtained by reducing the expression quantity of UGT84A1 protein in a receptor plant; reduced anthocyanin content in alfalfa;

   wherein the expression level of the UGT84A1 protein is obtained by inserting a Tnt transposon into the UGT84A1 gene; or inhibiting UGT84A1 gene expression in a plant by RNAi; or knocking out UGT84A1 gene in medicago truncatula by utilizing gene editing.

Images