CN115806984B - Circular RNA and vector and application of vector - Google Patents

Abstract

The invention discloses a circular RNA, a vector and an application of the vector, wherein the circular RNA comprises an antisense sequence which can be specifically combined with target RNA through base complementation pairing, and a 5 'connecting sequence and a 3' connecting sequence which are connected to two sides of the antisense sequence; the 5 'linker sequence may be complementarily paired with the 3' linker sequence to form a stem-loop structure. Vectors include circular RNA, a torsionase linked to a3 'linker sequence, a torsionase linked to a 5' linker sequence, a promoter and an expression vector. The invention makes mRNA specifically bind with precursor signal through antisense sequence in circular RNA to obstruct the entering of splicing factor to regulate RNA splicing process, can be used for regulating exon skipping at RNA level, thereby cutting off pathogenic exon to correct pathogenic mutation, and can be used for preparing medicine for regulating exon skipping and preparing medicine for treating diseases caused by genetic variation.

Description

Circular RNA and vector and application of vector

Technical Field

The invention relates to the field of biotechnology, in particular to a circular RNA, a vector and application of the vector.

Background

RNA splicing is an important step in eukaryotic gene expression, and by the interaction of small nuclear ribo-protein complexes, the introns within the primary transcript are excised and the exons are joined together in an orderly fashion. Different splice forms form proteins of different lengths or functions, greatly increasing the diversity of proteins. RNA splicing is affected by a variety of factors, mainly including sequences of cis-acting elements on RNA, splice regulatory proteins or factors, post-transcriptional modifications, etc., and abnormal splicing can lead to disorder of physiological functions and is a direct cause of many diseases. It is estimated that 35-50% of human diseases are caused by abnormal gene splicing, including some cancers and genetic diseases, and the like, and the purposeful deregulation of the splicing process provides a new idea for the treatment of these diseases. Antisense oligonucleotides (Antisense oligonucleotides, ASO) are chemically synthesized single stranded oligonucleotides that can efficiently bind to cis-regulatory elements on target RNAs by base-complementary pairing rules, regulating RNA splicing. Some antisense oligonucleotide drugs have been approved clinically for the treatment of some genetic disorders, such as Spiraza, for the treatment of Spinal Muscular Atrophy (SMA).

Although antisense oligonucleotide drugs have achieved a certain clinical efficacy in the treatment of certain diseases, improving the quality of life of patients, they still have certain limitations. For example, the ASO delivery mode is single, cannot function for a long time, needs continuous administration, and has expensive chemical synthesis cost; more importantly, some ASO therapies have very limited efficacy and still require confirmation of efficacy. There is therefore a need to develop new methods of modulating RNA splicing.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a circular RNA, a vector and application of the vector.

In order to achieve the above object, the present invention provides a circular RNA comprising an antisense sequence capable of specifically binding to a target RNA by base complementary pairing, and a 5 'linker sequence and a 3' linker sequence linked to both sides of the antisense sequence; the 5 'connecting sequence and the 3' connecting sequence can be complementarily matched and connected to form a stem-loop structure;

the target RNA is one of a 51 # exon of a DMD gene, a 13 # exon of a MET gene, a 14 # exon of a MET gene, a 2 # exon of a KRAS gene, a3 # exon of a KRAS gene, a 7 # exon of a STAT3 gene and a 8 # exon of a STAT3 gene.

The circular RNA, further, the DNA sequence of the 5' connecting sequence is shown as SEQ ID NO. 1; the DNA sequence of the 3' connecting sequence is shown as SEQ ID NO. 2.

The circular RNA is further characterized in that the antisense sequence is an antisense sequence of a target DMD gene No. 51 exon, and the DNA sequence is shown in any one of SEQ ID NO.3 to SEQ ID NO. 7;

the antisense sequence is an antisense sequence of a targeting MET gene No.13 exon fragment, and the DNA sequence is shown in SEQ ID NO. 8;

the antisense sequence is an antisense sequence of a targeting MET gene No.14 exon fragment, and the DNA sequence is shown in SEQ ID NO.9 or SEQ ID NO. 10;

the antisense sequence is the antisense sequence of the KRAS gene No.2 exon fragment, and the DNA sequence is shown as SEQ ID NO. 11;

the antisense sequence is the antisense sequence of the KRAS gene No.3 exon fragment, and the DNA sequence is shown as SEQ ID No. 12;

the antisense sequence is an antisense sequence of a STAT3 gene 7 exon fragment, and the DNA sequence is shown in SEQ ID NO. 13;

the antisense sequence is the antisense sequence of the 8 exon fragment of the STAT3 gene, and the DNA sequence is shown as SEQ ID NO. 14.

Based on the same or similar technical conception, the invention also provides a vector, which comprises the circular RNA, a torsionase connected with a3 'connecting sequence, a torsionase connected with a 5' connecting sequence, a promoter and an expression vector.

The vector, further, the torsion ribozyme linked to the 5 'linkage sequence is a ribozyme capable of generating a free hydroxyl group at the 5' end; the torsional ribozyme linked to the 3 'linker sequence is a ribozyme that can produce a 2',3 '-cyclic phosphate at the 3' end. Further, the torsionase linked to the 5' linked sequence is torsionase P3U 2A; the torsionase connected on the 3' connecting sequence is torsionase P1;

the DNA sequence of the torsionase P3U 2A is shown as SEQ ID NO. 15;

the DNA sequence of the torsionase P1 is shown in SEQ ID NO. 16.

The vector further comprises an RNA polymerase III promoter. Further, the RNA polymerase III promoter is a human U6 promoter.

The vector, further, the expression vector is a plasmid or a viral vector. Further, the viral vector is an AAV vector or a lentiviral vector.

Based on the same or similar technical conception, the invention also provides application of the vector in preparing medicines for regulating and controlling exon skipping.

Based on the same or similar technical conception, the invention also provides application of the vector in preparing medicines for treating diseases caused by genetic variation.

For the above application, further, the genetic variation causes the disease to be duchenne's muscle weakness caused by variation of exon 51 of DMD gene.

Compared with the prior art, the invention has the advantages that:

the invention provides a circular RNA which can regulate the RNA splicing process by specifically binding an antisense sequence in the circular RNA to a precursor messenger mRNA and preventing the entry of a splicing factor, and can be used for regulating exon skipping at the RNA level, thereby cutting off a pathogenic exon to correct the pathogenic mutation. Compared with antisense oligonucleotides (ASOs), the circular RNA does not need chemical modification, and has low synthesis cost. Furthermore, circular RNAs can be produced by genetic coding, which is suitable for use in a variety of viral delivery systems.

Drawings

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.

FIG. 1 is a schematic diagram of the principle of circular RNA mediated exon skipping in examples 1 to 5 of the invention.

FIG. 2 is a schematic representation of plasmid-expressed circular RNA in example 6 of the present invention.

FIG. 3 shows exon skipping of the circular RNA mediated minigene plasmid of example 7 of the present invention.

FIG. 4 is a schematic representation of the expression of circular RNA by AAV vectors in example 8 of the invention.

FIG. 5 shows that delivery of circular RNA via AAV restored expression of dydrophin protein in example 8 of the present invention was performed by skipping exon 51 in the DMDdel50 model.

FIG. 6 is a graph showing exon skipping of endogenous transcript MET, KRAS, STAT3 mediated by circular RNA in example 16 according to the present invention.

Detailed Description

The invention is further described below in connection with specific preferred embodiments, but it is not intended to limit the scope of the invention.

The materials and instruments used in the examples below are all commercially available.

Example 1:

a circular RNA of the present invention comprises an antisense sequence capable of specifically binding to a target RNA by base-pairing, and a 5 'linker sequence and a 3' linker sequence attached to both sides of the antisense sequence.

The antisense sequence can be specifically combined with the target RNA through base complementation pairing, the length of the antisense sequence is 50-250 nucleotides, and the target RNA is precursor mRNA.

The 5 'linker sequence may be complementary to the 3' linker sequence, unable to bind to the target RNA, and about 10-30 nucleotides in length.

The nucleotide sequence of the 5' connecting sequence in the embodiment is shown in SEQ ID NO.1, and specifically comprises the following steps:

AACCATGCCGACTGATGGCAG。

the nucleotide sequence of the 3' connecting sequence in this example is shown in SEQ ID NO.2, and specifically:

CTGCCATCAGTCGGCGTGGACTGTAG。

the nucleotide sequence of the antisense sequence is shown in SEQ ID NO.3, and specifically comprises the following steps:

ACAGCAAAGAAGATGGCATTTCTAG。

example 2:

the nucleotide sequence of the antisense sequence of the circular RNA is shown in SEQ ID NO.4, and specifically comprises the following steps:

GCAGGTACCTCCAACAGCAAAGAAGATGGCATTTCTAGTTTGGAGATGAC, the remaining structure is the same as in example 1.

Example 3:

the nucleotide sequence of the antisense sequence of the circular RNA is shown in SEQ ID NO.5, and specifically comprises the following steps:

CCAAGCTCGGTTGAAGTCTGCCAGTGCAGGTACCTCCAACAGCAAAGAAGATGGCATTTCTAGTTTGGAGATGACAGTTTCCTTAGTAACCACAGATTGT, the remaining structure is the same as in example 1.

Example 4:

the nucleotide sequence of the antisense sequence of the circular RNA is shown in SEQ ID NO.6, and specifically comprises the following steps:

CAGAGACAGCCAGTCTGTAAGTTCTGTCCAAGCTCGGTTGAAGTCTGCCAGTGCAGGTACCTCCAACAGCAAAGAAGATGGCATTTCTAGTTTGGAGATGACAGTTTCCTTAGTAACCACAGATTGTGTCACTAGAGTAACAGTCTGACT, the remaining structure is the same as in example 1.

Example 5:

the nucleotide sequence of the antisense sequence of the circular RNA is shown in SEQ ID NO.7, and specifically comprises the following steps:

CAGATCACCCACCATCACTCTCTGTGATTTTATAACTCGATCAAGCAGAGACAGCCAGTCTGTAAGTTCTGTCCAAGCTCGGTTGAAGTCTGCCAGTGCAGGTACCTCCAACAGCAAAGAAGATGGCATTTCTAGTTTGGAGATGACAGTTTCCTTAGTAACCACAGATTGTGTCACTAGAGTAACAGTCTGACTGGCAG, the remaining structure is the same as in example 1.

Example 6:

a vector of the present invention comprising the circular RNA of any one of examples 1 to 5, a torsionase 1 linked to the 5 'end of the circular RNA, and a torsionase 2 linked to the 3' end of the circular RNA, a plasmid vector and a human U6 promoter. FIG. 2 is a schematic diagram of the structure of a carrier according to example 2 of the present invention.

Wherein the torsionase 1 is torsionase P3U 2A, and the nucleotide sequence is shown as SEQ ID NO.15, and specifically comprises the following steps:

GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT。

the torsionase 2 is torsionase P1, the nucleotide sequence of which is shown in SEQ ID NO.16, and specifically comprises:

AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC。

the construction method of the vector comprises the following steps:

1. the vectors of this example were synthesized by means of a qing-ke organism. The DNA sequence of the vector is specifically:

the sequence comprises torsionase P3U 2A (bold portion), torsionase P1 (italic portion), 5 'linker sequence (double underlined portion), 3' linker sequence (single underlined portion), the lowercase portion is the position to insert, which is now the sequence containing the cleavage site, facilitating the subsequent insertion of other antisense RNAs.

2. PCR amplification of the synthetic gene sequence.

2.1, designing a primer: primer F: aaggacgaaacaccgGCCATCAGTCGCCGGTCCCA.

Primer R: ttgtctcgaggtcgagaattcAAAAAAGCGTGGACTGTACC).

2.2, PCR reaction: according toMax DNA Polymerase (Takara#R045) the reaction system was configured under the following reaction conditions: pre-denaturation at 95 ℃ for 5min; 35 cycles were performed following a denaturation at 98℃for 10sec, an annealing at 55℃for 15sec, and an elongation at 72℃for 10 sec; finally, the temperature is 72 ℃ for 5min.

2.3, construction of plasmids: the PCR product obtained was recovered and purified by gel, and then constructed between the cleavage sites of pGL3 plasmid BsaI and EcoRI by a seamless cloning kit (Novazal#C112), to construct an empty plasmid for circular RNA expression. The synthetic gene sequence is expressed by driving a U6 promoter.

3. Ligation of target RNA-specific circular RNAs:

3.1 linearizing the empty plasmid described above with BsaI (NEB#R3733) restriction enzyme, the reaction system is: 4. Mu.l BsaI enzyme, 5. Mu.l rCutSmart ^TM Buffer, 4. Mu.g of the empty plasmid of step 2, was made up to 50. Mu.l with no-nucleic acid water to give a reaction system, which was incubated overnight at 37 ℃.

3.2, ligation of antisense sequences: agarose gel electrophoresis recovery, ligation of circular RNAs of examples 1 to 5, wherein the method of ligating short DNA sequences of <80bp is:

the DNA of single strand is synthesized chemically, and the DNA fragments of double strand are formed by PCR annealing (5 min at 95 ℃, 0.1s (-2 ℃/cycle, down to 85 ℃) 6cycle at 95 ℃, 0.1s (-0.1 ℃/cycle, down to 25 ℃) 601cycle at 85 ℃ and 4++ infinity, and the DNA fragments are connected with the linearization carrier through a Trans kit T4 DNA Ligase (FL 101-01), and the reaction system and the conditions strictly follow the operation flow of the kit.

For ligations of longer fragments (> 100 bp), the following method was used for ligation:

the seamless cloning PCR primer was designed to amplify specific antisense sequences and ligated with linearization vectors via a seamless cloning kit ((nuuzate #c112)).

4. After the connection of the vectors, the vectors are transformed, monoclonal is selected, after the connection is verified to be correct by sequencing, shaking bacteria are expanded, and all experimental operations follow the fourth edition of molecular cloning experimental guidelines. The endotoxin-removed plasmid was extracted with a kit (D6950-02 Endo-free Plasmid Mini Kit) to give circular RNA plasmid 1 (containing circular RNA of example 1), circular RNA plasmid 2 (containing circular RNA of example 2), circular RNA plasmid 3 (containing circular RNA of example 3), circular RNA plasmid 4 (containing circular RNA of example 4), circular RNA plasmid 5 (containing circular RNA of example 5) for use in cell transfection.

Comparative example 1:

the difference from example 6 is that the vector is a linear antisense RNA expression vector that cannot be circularized, and the rest of example 6 is the same.

Example 7:

use of the vector of example 2 in the manufacture of a medicament for modulating reporter system mediated exon skipping.

1. The minigene plasmid was constructed from the mouse DMD gene and used to assess the ability of exon skipping.

1.1, the pCDNA3.1 plasmid vector was digested with restriction enzyme (HindIII, ecoRI) for 4 hours at 37℃and purified using a gel recovery kit (Whole formula gold #EG 101-01), to obtain a linearized plasmid vector.

1.2, designing three pairs of seamless cloning PCR primers to amplify the No. 50 exon and the continuous partial No. 50 intron fragment of the mouse DMD gene, amplify the No. 51 exon and partial intron fragments at two sides of the exon, and amplify the E52 exon and the immediately adjacent E51 intron fragment.

Wherein the primer pair for amplifying the 50 # exon and the continuous 50 # intron fragments of the mouse DMD gene is as follows:

E50-F：ctagcgtttaaacttaagcttAGGAAGTTAGAAGATCTGAGG；

E50-R:TCAGGATTTATCTATGCTGCCACGATTACTCTGCTTC。

wherein the primer pair for amplifying the 51 # exon and the partial intron fragments at two sides of the mouse DMD gene is as follows:

E51-F:AGTAATCGTGGCAGCATAGATAAATCCTGAAAATTCC；

E51-R:TATCTGGATTCATGCTCAGCTCAATTGAGCTAATTAT。

wherein the primer pair for amplifying the E52 exon and the immediately following E51 intron fragment of the mouse DMD gene is:

E52-F:GCTCAATTGAGCTGAGCATGAATCCAGATAGTTAGAA；

E52-R:tgctggatatctgcagaattcTTCGATCAGTAATGATTGTT。

1.3, PCR reaction system: according toMax DNA Polymerase (Takara#R045) to configure a reaction system.

1.4, PCR reaction conditions are: pre-denaturation at 95 ℃ for 5min; 35 cycles were performed following a denaturation at 98℃for 10sec, an annealing at 55℃for 15sec, and an elongation at 72℃for 10 sec; finally, the temperature is 72 ℃ for 5min.

1.5, carrying out gel recovery after amplification to obtain a purified PCR product, and connecting three sections of purified PCR fragments and a linearized vector by using a seamless cloning kit (full-scale gold #E101-01) to obtain a recombinant vector.

1.6, after the obtained recombinant vector is transformed into DH5 alpha escherichia coli, a monoclonal is selected, and further, the minigene plasmid which is successfully constructed is obtained through sanger sequencing verification.

2. 293T cell lines were grown in a medium containing 10% Fetal Bovine Serum (FBS), 1% blueCulturing in DMEM basal medium containing mycin and streptomycin at 37deg.C, 5% CO ₂ Is cultured under the condition of (2).

3. To assess the working efficiency of circular RNAs on minigene system, 293T cells were seeded in 12-well plates, 1.5x10 per well ⁵ Individual cells. After 24h, the original medium was discarded and 0.5ml of fresh medium was added.

4. The treatment is carried out according to the following method:

treatment group 1 (treated group): 0.5. Mu.g of minigene plasmid and 1. Mu.g of circular RNA plasmid 1 were co-transfected with lip3000 reagent.

Treatment group 2: 0.5. Mu.g of minigene plasmid and 1. Mu.g of circular RNA plasmid 2 were co-transfected with lip3000 reagent.

Treatment group 3: 0.5. Mu.g of minigene plasmid and 1. Mu.g of circular RNA plasmid 3 were co-transfected with lip3000 reagent.

Treatment group 4: 0.5. Mu.g of minigene plasmid and 1. Mu.g of circular RNA plasmid 4 were co-transfected with lip3000 reagent.

Treatment group 5: 0.5. Mu.g of minigene plasmid and 1. Mu.g of circular RNA plasmid 5 were co-transfected with lip3000 reagent.

Control group (confl group): 0.5ug minigene plasmid and 1ug control 1 circular RNA plasmid were co-transfected with lip3000 reagent.

Blank-group): cells transfected with minigene plasmid vector alone.

5. 24h after transfection, 2ml of fresh medium was changed, cells were harvested after 48h of transfection, RNA was purified by trizol (Sieimeravid # 15596026) RNA extraction and RNA was inverted to CDNA using the kit (Takara # RR 047).

6. To verify the ratio of exon skipping, the cDNA sequence was amplified by PCR.

6.1, PCR primer:

CDNA-E50-F:CCTGGACTGAGCACTACT；

CDNA-E50-R:GCAGCAGTAATGAGTTCTTC。

6.2, PCR reaction conditions: according toMax DNA Polymerase (Takara#R045) instruction manualPlacing a reaction system, wherein the reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; 35 cycles were performed following a denaturation at 98℃for 10sec, an annealing at 55℃for 15sec, and an elongation at 72℃for 10 sec; finally, the temperature is 72 ℃ for 5min.

6.3, agarose gel electrophoresis experiments of PCR products obtained after amplification, determining the jump proportion of the targeted exons, and further confirming the jump accuracy by sanger sequencing of jump sequences. Further evaluating the effect of the complementary sequence length on the jump ratio, adopting the plasmid construction and cell transfection method, amplifying the CDNA sequence by PCR, and determining the jump ratio of the targeted exon.

See fig. 3 for results: in the figure, A is a gel electrophoresis diagram, triangles indicate bands of exon skipping, B is a sanger sequencing result of the exon-skipping bands and the non-skipping bands, and C is a quantitative result of the exon-skipping efficiency. We observed that the exon skipping efficiency was very low below 50bp for the complementary sequence and relatively stable for lengths greater than 100bp (FIG. 3A). Complete skipping of E51 was further confirmed by sequencing of the skip band (FIG. 3B).

Example 8:

a vector of the present invention comprises the circular RNA of example 5, a torsionase 1 linked to the 5 'end of the circular RNA, and a torsionase 2, AAV viral vector and human U6 promoter linked to the 3' end of the circular RNA. Fig. 4 is a schematic diagram of the carrier structure of the present embodiment.

AAV delivery systems are delivery vehicles commonly used in clinical gene therapy, and this experiment was chosen to test on the DMD gene in order to test whether AAV vectors can be used to deliver circular RNAs. The DMD gene encodes a dystrophin protein, and mutations in this gene typically result in the non-expression of the protein, causing duchenne muscular dystrophy. Patients exhibit systemic muscle damage and are very difficult to survive over the age of 30 years.

The vector of the embodiment is applied to the preparation of a medicament for treating the duchenne muscle weakness caused by DMD gene variation.

The application method comprises the following steps:

1. cell culture: the C2C12 cells are mouse skeletal muscle myoblasts and can be efficiently differentiated into polynuclear myofibers,C2C12 cells were seeded in 12-well plates (5X 10) ⁴ Individual cells/well), the degree of aggregation of the cells was between 50% and 70% after 24 hours, and the differentiation medium was changed (the composition of the differentiation medium includes: DMEM basal medium, 2% horse serum, 1% penicillin and streptomycin), fluid changes every other day, and cells begin to fuse gradually. After 5-7 days of culture, cell fusion is completed, and most of the culture dishes are polynuclear myofibers. Can be used to test AAV infection experiments.

2. Circular RNAs targeting the DMD gene 51 exon were screened for packaging of AAV by the guangzhou peyronie company.

3. After the virus packaging is completed, in vitro bone in vitro infection experiments are carried out. The method comprises the following steps: AAV virus was added 5-7 days after C2C12 skeletal muscle precursor cells were fused (moi=3x10) ⁵ ) After 7 days of virus infection, cells were harvested, trizol was added to extract total RNA, and the RNA was inverted to CDNA with the kit (Takara#RR047). To verify exon skipping efficiency, the proportion of targeted exons that were skipped was determined by PCR amplification of the CDNA sequence.

4. In DMD ^del50 Test of circular RNA in model mice whether they can work in vivo: injection of packaged AAV to DMD by intramuscular injection ^del50 Intramuscular injection of 20 μl,5×10, per muscle in the mouse model (mouse exon 50 deleted) ¹⁰ Viral particles. Two weeks after intramuscular injection, RNA and protein from mouse muscle were extracted and analyzed for exon skipping by RT-PCR. And detecting whether the protein is recovered or not through a west-blot.

Fig. 5 is a detection result. In the figure, A is an electrophoresis gel diagram after the AAV is infected by C2C12, triangles indicate bands of exon skipping, B is a quantitative diagram of exon skipping efficiency of the A, C is an electrophoresis diagram of exon skipping after the AAV is locally injected intramuscularly, and D is a western-blot result, and shows that dystrophin is recovered in muscle tissues of mice after the AAV is injected.

As can be seen from the figures: deletion of E50 in this mouse model resulted in non-expression of the dyshin protein, and skipping E51 restored the protein coding reading frame, resulting in a functional protein.

Example 9:

a circular RNA plasmid vector, wherein the antisense sequence is targeted MET gene No.13 exon, and the nucleotide sequence of the antisense sequence is described in SEQ ID No.8, specifically:

ACCATTTCTGTAGTTGGGCTTACACTTCGGGCACTTACAAGCCTATCCAAATGAGGAGTGTGTACTCTTGCATCGTAGCGAACTAATTCACTGCCCAGATCTTAAAACAGAGAGAAAGAAAGAGCTTGTTAAAGACGGCTATCATGGGCCCCAGGAGACTTTGACCCAGTGCCCAGAACTCAT。

the remaining structure was the same as in example 6.

Example 10:

a circular RNA plasmid vector, wherein the antisense sequence is targeted MET gene No.14 exon (E14-DS), and the nucleotide sequence is shown in SEQ ID NO.9, and specifically comprises the following components:

GTTGCTTTCACCATTGTCTAAGTTCCTAATCTGCAAAGGCCAAAGATAAAATGCTTACTGGAAAATCGTATTTAACAAAAAGCTGAGTGGAAATACTTACCTCTTCCTATGACTTCATTGAAATGCACAATCAGGCTACTGGGCCCAATCACTACATGCTGCACTGCCTGGACCAGCTCTGGATTTAGAGCACTGAGGTC。

the remaining structure was the same as in example 6.

Example 11:

a circular RNA plasmid vector, wherein the antisense sequence is targeted MET gene No.14 exon (E14-ESE), and the nucleotide sequence is shown in SEQ ID NO.10, specifically:

ATTGAAATGCACAATCAGGCTACTGGGCCCAATCACTACATGCTGCACTGCCTGGACCAGCTCTGGATTTAGAGCACTGAGGTCAATGTGGACAGTATTTTGCAGTAATGGACTGGATATATCAGAGTCCCCACTAGTTAGGATGGGGGACATGTCTGTCAGAGGATACTGCACTTGTCGGCATGAACCGTTCTGAGATG。

the remaining structure was the same as in example 6.

Example 12:

a circular RNA plasmid vector, wherein the antisense sequence is targeted KRAS gene No.2 exon, and the nucleotide sequence is shown in SEQ ID NO.11, specifically:

CTATAATGGTGAATATCTTCAAATGATTTAGTATTATTTATGGCAAATACACAAAGAAAGCCCTCCCCAGTCCTCATGTACTGGTCCCTCATTGCACTGTACTCCTCTTGACCTGCTGTGTCGAGAATATCCAAGAGACAGGTTTCTCCATCAATTACTACTTGCTTCCTGTAGGAATCCTGAGAAGGGAGAAACACAGT。

the remaining structure was the same as in example 6.

Example 13:

a circular RNA plasmid vector, wherein the antisense sequence is targeted KRAS gene No.3 exon, and the nucleotide sequence is shown in SEQ ID NO.12, specifically:

CTGTCTTGTCTTTGCTGATGTTTCAATAAAAGGAATTCCATAACTTCTTGCTAAGTCCTGAGCCTGTTTTGTGTCTACTGTTCTAGAAGGCAAATCACATTTATTTCCTACTAGGACCATAGGTACATCTTCAGAGTCCTTAACTCTTTTAATTTGTTCTCTGGGAAAGAAAAAAAAGTTATAGCACAGTCATTAGTAAC。

the remaining structure was the same as in example 6.

Example 14:

a circular RNA plasmid vector, wherein the antisense sequence is a target STAT3 gene No.7 exon, and the nucleotide sequence is shown in SEQ ID NO.13, specifically:

CAGTTTTCTAGCCGATCTAGGCAGATGTTGGGCGGGCCTCCAATGCAGGCAATCTGTTGCCGCCTCTTCCAGTCAGCCAGCTCCTCGTCCGTGAGAGTTTTCTGCACGTACTCCATCGCTGACAAAAGCCCCGCCAGCTCACTCACGATGCTCTGGTTGGAAACCAAAACAAAGTCAGAAAACATTTCCTCAGACTGTCT。

the remaining structure was the same as in example 6.

Example 15:

a circular RNA plasmid vector, wherein the antisense sequence is a targeted STAT3 gene No.8 exon, and the nucleotide sequence is shown in SEQ ID NO.14, specifically:

CTTTTCATTAAGTTTCTAAACAGCTCCACGATTCTCTCCTCCAGCATCGGCCGGTGCTGTACAATGGGGTCCCCTTTGTAGGAAACTTTTTGCTGCAACTCCTCCAGTTTCTTAATTTGTTGACGGGTCTGAAGTTGAGATTCTGCTAATGACGTTATCCTGCCAATAAATTAAGAAAGATGCTAATTACCAAAGTGAAT。

the remaining structure was the same as in example 6.

Example 16:

use of the vector of examples 9 to 15 for the preparation of a medicament for modulating exon skipping in an endogenous gene. To further confirm whether the method of loop RNA mediated exon skipping is applicable to other endogenous genes, we constructed the vector transfected 293T cells of examples 8 to 14 as the treatment group and the cells transfected with the linear loop RNA plasmid as the control group. The application method comprises the following steps:

1. 293T cells were usedIs cultured in DMEM basal medium containing 10% Fetal Bovine Serum (FBS), 1% penicillin and streptomycin at 37deg.C and 5% CO ₂ Is cultured under the condition of (2).

2. 293T cells were seeded in 12-well plates at 1.5X10 per well ⁵ After 24h, the original medium was discarded, 0.5ml of fresh medium was added, 1.5. Mu.g of the circular RNA plasmid of any one of examples 9 to 15 was transfected, and after 24h, 2ml of fresh medium was changed, and after 48h, the cells were harvested.

3. RNA was purified by trizol RNA extraction and inverted to CDNA using the kit (Takara#RR047).

4. The exon skipping efficiency was verified by PCR amplification of the CDNA sequence as follows:

4.1, designing a primer pair according to MET genes:

MET-F：TCTTCAACCGTCCTTGGA；MET-R：CACTTCGCAGGCAGATTC。

primer pairs were designed based on the KRAS gene:

KRAS-F：AGAGTGCCTTGACGATAC；KRAS-R：CACACTTTGTCTTTGACTTC。

primer pairs were designed according to STAT3 gene:

STAT3-F：AGTGACCAGGCAGAAGAT；STAT3-R：TTAGTAGTGAACTGGACGC。

4.2, PCR reaction system: according toMax DNA Polymerase (Takara#R045) to configure a reaction system,

4.3, PCR reaction procedure: pre-denaturation at 95 ℃ for 5min; 35 cycles were performed following a denaturation at 98℃for 10sec, an annealing at 55℃for 15sec, and an elongation at 72℃for 10 sec; finally, the temperature is 72 ℃ for 5min.

The results of the analysis are shown in FIG. 6. In the figure, A is a gel electrophoresis chart, and B is the sanger sequencing result of the exon-skipping band and the non-skipping band. From the figures we can observe a clear exon skipping phenomenon in MET13 or 14 exons, KRAS gene 2 exons, STAT3 gene 7 exons treatment group (panel a), further confirming the skipping event by sanger sequencing of the skip band (panel B).

The above description is only of the preferred embodiment of the present invention, and is not intended to limit the present invention in any way. While the invention has been described in terms of preferred embodiments, it is not intended to be limiting. Any person skilled in the art can make many possible variations and modifications to the technical solution of the present invention or equivalent embodiments using the method and technical solution disclosed above without departing from the spirit and technical solution of the present invention. Therefore, any simple modification, equivalent substitution, equivalent variation and modification of the above embodiments according to the technical substance of the present invention, which do not depart from the technical solution of the present invention, still fall within the scope of the technical solution of the present invention.

Claims (8)

1. A circular RNA comprising an antisense sequence capable of specifically binding to a target RNA by base complementary pairing, and a 5 'linker sequence and a 3' linker sequence attached to both sides of the antisense sequence; the 5 'connecting sequence and the 3' connecting sequence are complementarily matched and connected to form a stem-loop structure;

the target RNA is one of a 51 # exon of a DMD gene, a 13 # exon of a MET gene, a 14 # exon of a MET gene, a 2 # exon of a KRAS gene and a 7 # exon of a STAT3 gene;

the DNA sequence of the 5' connecting sequence is shown as SEQ ID NO. 1; the DNA sequence of the 3' connecting sequence is shown as SEQ ID NO. 2;

the antisense sequence is targeted DMD gene No. 51 exon antisense sequence, and the DNA sequence is shown as SEQ ID NO.4 or SEQ ID NO. 7;

or, the antisense sequence is an antisense sequence of a targeting MET gene No.13 exon fragment, and the DNA sequence is shown in SEQ ID NO. 8;

or, the antisense sequence is an antisense sequence of a targeting MET gene No.14 exon fragment, and the DNA sequence is shown in SEQ ID NO.9 or SEQ ID NO. 10;

or, the antisense sequence is an antisense sequence of a targeting KRAS gene No.2 exon fragment, and the DNA sequence is shown as SEQ ID NO. 11;

or, the antisense sequence is an antisense sequence of a targeted STAT3 gene 7 exon fragment, and the DNA sequence is shown in SEQ ID NO. 13.

2. A vector comprising the circular RNA of claim 1, a torsionase linked to a3 'linker sequence, a torsionase linked to a 5' linker sequence, a promoter and an expression vector.

3. The vector of claim 2, wherein the torsional ribozyme linked to the 5 'linker sequence is a ribozyme that produces a free hydroxyl group at the 5' end; the torsional ribozyme linked to the 3 'linker sequence is a ribozyme that produces a 2',3 '-cyclic phosphate at the 3' end;

and/or, the promoter is an RNA polymerase iii promoter;

and/or the expression vector is a plasmid or a viral vector.

4. The vector of claim 2, wherein the torsionase linked to the 5 'linker sequence is torsionase P3U 2A and the torsionase linked to the 3' linker sequence is torsionase P1;

the DNA sequence of the torsionase P3U 2A is shown as SEQ ID NO. 15;

the DNA sequence of the torsionase P1 is shown in SEQ ID NO. 16.

5. The vector of claim 3, wherein the RNA polymerase iii promoter is a human U6 promoter; the virus vector is an AAV vector or a lentiviral vector.

6. Use of a vector according to any one of claims 2 to 5 for the preparation of a medicament for modulating exon skipping.

7. Use of a vector according to any one of claims 2 to 5 in the manufacture of a medicament for the treatment of a disease caused by genetic variation.

8. The use according to claim 7, wherein the genetic variation causing disease is duchenne's muscle weakness caused by variation in exon 51 of DMD gene.