CN115804838A - Porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof - Google Patents
Porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN115804838A CN115804838A CN202211336438.8A CN202211336438A CN115804838A CN 115804838 A CN115804838 A CN 115804838A CN 202211336438 A CN202211336438 A CN 202211336438A CN 115804838 A CN115804838 A CN 115804838A
- Authority
- CN
- China
- Prior art keywords
- antigen
- type
- haemophilus parasuis
- inactivated vaccine
- mycoplasma hyopneumoniae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to a porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and a preparation method thereof, belonging to the field of vaccines. The triple inactivated vaccine comprises porcine circovirus type 2 antigen, mycoplasma hyopneumoniae antigen, haemophilus parasuis type 4 antigen and haemophilus parasuis type 5 antigen, wherein the concentration of the porcine circovirus type 2 antigen is 30-50ug/ml, the concentration of the mycoplasma hyopneumoniae antigen is 110-130ug/ml,the concentration of Haemophilus parasuis type 4 antigen is (4-6) × 10 8 cfu/ml, the concentration of Haemophilus parasuis type 5 antigen is (4-6) x 10 8 cfu/ml. The triple inactivated vaccine provided by the invention can achieve four-prevention by one injection, reduce the times of immunity and stress, and practically solve the problem of the pig industry.
Description
Technical Field
The invention belongs to the field of vaccines, and particularly relates to a porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and a preparation method thereof.
Background
Porcine circovirus type 2 (PCV 2 for short) is the main pathogen of multisystemic wasting of weaned Pigs (PMWS). PMWS originated in canada at the earliest and is rapidly occurring and prevalent in europe and america and in some countries of asia, including china. In addition to PMWS, diseases such as Porcine Dermatitis Nephrotic Syndrome (PDNS), porcine respiratory disease syndrome (PRDC), proliferative Necrotizing Pneumonia (PNP), porcine reproductive disorder, congenital tremor, enteritis and the like are also important related to PCV2 infection, which causes serious economic loss to the pig industry. The PCV2 infected pigs are in a severe immunosuppressed state and are an important reason for PMWS occurrence, and the pathogenicity of the PMWS is mainly characterized by lesions of immune system damage, lymphocyte reduction, lymph node enlargement and the like.
Mycoplasmal pneumonia of swine (MHP) causes a chronic respiratory infectious disease in contact with swine, and is ubiquitous in all parts of the world. The sick pigs are mainly manifested by cough and asthma, growth retardation, low feed conversion rate and basically normal body temperature. Mycoplasma hyopneumoniae is often mixed with other pathogens to cause infection with increased severity and is one of the most important diseases causing economic loss in the swine industry.
Haemophilus parasuis (HPS for short) is a commensal bacterium of the upper respiratory tract of pigs. When the maternal antibody protection is lost after group transfer and weaning and the immunity is reduced due to other diseases, HPS infection shows symptoms such as serositis and meningitis and mainly occurs after weaning and during nursing.
PMWS and swine mycoplasma pneumonia belong to immunosuppressive diseases, lead to the decline of immunity of swinery and create conditions for the pathogenesis of HPS, PCV2, MHP and HPS are often mixed and infected, so that the morbidity and the death of pigs are caused, and the development of the swine industry in China is seriously influenced. However, only relevant single vaccine or bivalent vaccine exists in the current commercial vaccines, and the problem that the frequency of immunization is too high, so that pigs are stressed only exists. In addition, drug treatment tends to be ineffective due to the emergence of resistant strains resulting from prior antibiotic abuse. Therefore, the development of the porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine has important significance.
The patent application with the application number of CN201210221969.2 discloses a vaccine composition, which comprises inactivated porcine circovirus type 2 antigen, inactivated haemophilus parasuis (inactivated haemophilus parasuis serum type 4 and serum type 5), inactivated mycoplasma hyopneumoniae and a vaccine adjuvant, wherein the vaccine adjuvant is one or a combination of any several of aluminum hydroxide Gel, mineral oil, carbomer (Carbomer), gel01 (SCIPIC, france), propolis, ISA206 (SCIPIC, france) and ISA760VG (SCIPIC, france). The vaccine composition can prevent three diseases of porcine circovirus disease, swine mycoplasmal pneumonia and haemophilus parasuis by injecting one needle. However, the mycoplasma hyopneumoniae antigen in the vaccine composition is less immunogenic and the immune protective ability needs to be further improved.
Disclosure of Invention
The invention aims to provide a porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and a preparation method thereof.
The invention provides a triple inactivated vaccine, which comprises a porcine circovirus type 2 antigen, a porcine mycoplasma hyopneumoniae antigen, a haemophilus parasuis type 4 antigen and a haemophilus parasuis type 5 antigen, wherein the concentration of the porcine circovirus type 2 antigen is 30-50ug/ml, the concentration of the porcine mycoplasma hyopneumoniae antigen is 110-130ug/ml, and the concentration of the haemophilus parasuis type 4 antigen is (4-6) multiplied by 10 8 cfu/ml, the concentration of Haemophilus parasuis type 5 antigen is (4-6). Times.10 8 cfu/ml。
Further, the concentration of the porcine circovirus type 2 antigen is 40ug/ml, the concentration of the mycoplasma hyopneumoniae antigen is 120ug/ml, and the concentration of the haemophilus parasuis type 4 antigen is 5 multiplied by 10 8 cfu/ml, concentration of Haemophilus parasuis type 5 antigen 5X 10 8 cfu/ml。
Further, the porcine circovirus type 2 antigen is PCV2 Cap protein.
Further, the mycoplasma hyopneumoniae antigen is inactivated mycoplasma hyopneumoniae bacteria.
Further, the preparation method of the inactivated mycoplasma hyopneumoniae thalli comprises the following steps: inoculating mycoplasma hyopneumoniae strain seeds to a culture medium for culturing for 48-72 hours, harvesting a bacterial liquid, concentrating, centrifuging, collecting precipitates, washing, ultrasonically crushing, and adding an inactivating agent for inactivation to obtain the mycoplasma hyopneumoniae strain seed; preferably, the power of the ultrasonic crushing is 20-50W, and the time is 10-30 minutes; the inactivating agent is diethylene imine, and the final concentration of the inactivating agent is 3mmol/L.
Further, the haemophilus parasuis type 4 antigen is inactivated haemophilus parasuis type 4 thallus.
Further, the Haemophilus parasuis type 5 antigen is inactivated Haemophilus parasuis type 5 thallus.
Further, the triple inactivated vaccine also comprises an adjuvant, and the mass ratio of the adjuvant to the total amount of the 4 antigens is 1: (8-10), preferably 1:9.
further, the adjuvant is selected from one or a mixture of more than two of 15A, ISA and Gel02, and is preferably Gel02.
The invention also provides a preparation method of the triple inactivated vaccine, which comprises the following steps: mixing porcine circovirus type 2 antigen, mycoplasma hyopneumoniae antigen, haemophilus parasuis type 4 antigen, haemophilus parasuis type 5 antigen and adjuvant uniformly to obtain the product.
Compared with the prior art, the invention has the following beneficial effects:
1. compared with the commercial porcine circovirus type 2 and mycoplasma hyopneumoniae bivalent inactivated vaccine (recombinant baculovirus CP08 strain + JM strain) and the porcine circovirus type 2 and haemophilus parasuis bivalent inactivated vaccine (SH strain +4 JS strain +5 ZJ strain), the antibody generated after the immunization of the porcine circovirus type 2, mycoplasma hyopneumoniae and haemophilus parasuis (type 4 and type 5) bivalent inactivated vaccine provided by the invention is not reduced. However, at the same time, the triple inactivated vaccine provided by the invention can achieve four-prevention by one injection, reduce the times of immunity and stress, and practically solve the problem of the pig industry.
2. Compared with the control triple inactivated vaccine obtained by the preparation method described in the patent application with the reference number of CN201210221969.2, the immunogenicity of the mycoplasma hyopneumoniae antigen in the triple inactivated vaccine provided by the invention is obviously improved, and the immune protective capability is obviously improved.
Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.
The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
FIG. 1: schematic flow chart of triple inactivated vaccine preparation.
FIG. 2: SDS-PAGE results of the expression Cap protein.
FIG. 3: and (3) expressing Cap protein electron microscope detection results.
Detailed Description
The reagents and raw materials used in the following examples and experimental examples are not specifically described and are commercially available.
Example 1: preparing triple quadrivalent inactivated vaccine of porcine circovirus type 2, mycoplasma hyopneumoniae and haemophilus parasuis (type 4 and type 5)
The preparation flow diagram is shown in figure 1.
1. Antigen preparation
1.1PCV2 antigen preparation
Synthesizing a corresponding codon-optimized gene sequence (the gene sequence is (SEQ ID NO. 1): ATGACGTATCCAAGGAGGCGTTTCCGCAGACGAAGACACCGCCCCCGCAGCCATCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCCCCGCCACCGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAACACCCGCCTCTCCCGCACCATCGGTTATACTGTCAAGAAAACCACAGTCAGAACGCCCTCCTGGAATGTGGACATGATGAGATTTAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCTCACTGTGCCCTTTGAATACTACAGAATAAGGAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCAATCACCCAGGGTGACAGGGGAGTGGGCTCCACTGCTGTTATTCTAGATGATAACTTTGTAACAAAGGCCAATGCCCTAACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCACTCCCGGTACTTTACCCCAAAACCTGTCCTTGATGGGACAATCGATTACTTCCAACCCAATAACAAAAGAAATCAACTCTGGCTGAGACTACAAACTACTGGAAATGTAGACCATGTAGGCCTCGGCACTGCGTTCGAAAACAGTATATACGACCAGGACTACAATATCCGTATAACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCACTTAACCCTAAGTAA) according to a GeneBank porcine circovirus type 2 Cap protein sequence, purifying, connecting with a pFastBacDual vector, transforming into a TOP10 competent cell, transforming an expression donor plasmid pFast2d-Cap with correct sequencing into a DH10Bac competent cell, screening blue white spots, identifying a positive colony, and transfecting a successfully identified recombinant rod into an Sf9 cell to obtain a recombinant baculovirus Bac-Cap. Inoculating the constructed baculovirus expression vector of the porcine circovirus type 2 Cap protein to HighFive cells according to MOI =0.2, culturing for 9 days at 27 ℃, harvesting cell cultures, centrifuging for 15 minutes at 8000rpm, collecting supernatant, purifying the supernatant through ion exchange, collecting eluent, and filtering by using a 0.22um filter to obtain PCV2 Cap protein solution.
The amino acid sequence of the expressed Cap protein is (SEQ ID NO. 2): MTYPRRRFRRRRHRPRSHLGQILRRRPWLVHPRHRYRWRRKNGIFNTRLSRTIGYTVKKTTVRTPSWNVDMMRFNINDFLPPGGGSNPLTVPFEYYRIRKVKVEFWPCSPITQGDRGVGSTAVILDDNFVTKANALTYDPYVNYSSRHTITQPFSYHSRYFTPKPVLDGTIDYFQPNNKRNQLWLRLQTTGNVDHVGLGTAFENSIYDQDYNIRITMYVQFREFNLKDPPLNPK.
The SDS-PAGE electrophoresis result of the expressed Cap protein is shown in figure 2, and the size of the expressed protein is about 28 kDa. Analysis by transmission electron microscopy revealed that the expression of Cap protein formed VLPs (FIG. 3). The purity of the purified protein is 88.9 percent by HPLC detection, and the content of the target protein is 212ug/ml.
1.2 MHP antigen preparation
The mycoplasma hyopneumoniae strain (AH strain) seeds are inoculated into a FRIIS culture medium containing 20 percent of serum and 3mg/ml of glucose according to the inoculation ratio of 10 percent (v/v), the culture is carried out for 48 to 72 hours at 37 ℃, and when the color of the culture medium is changed to yellow and the pH value is about 6.8, the bacterium liquid is harvested. The prepared AH strain whole cell culture was concentrated by 300kDa hollow fiber, centrifuged at 10000 rpm for 30 minutes, collected, and the precipitate was washed with PBS repeatedly for 3 times. Crushing the concentrated and purified bacterial liquid by an ultrasonic system (the ultrasonic power is 20-50W, and the time is 10-30 minutes), adding BEI (Chinese full name: diethylene imine) with the final concentration of 3mmol/L, inactivating the bacterial liquid for 24 hours at 37 ℃, stopping inactivation by using sodium thiosulfate with the final concentration of 3mmol/L after inactivation is finished, obtaining MHP solution, and storing the MHP solution at 2-8 ℃.
Total protein content was measured to be 10.8mg/ml using the BCA Total protein assay.
1.3 Preparation of HPS 4-type antigen
Inoculating 2% (v/v) of Haemophilus parasuis type 4 strain (HY strain) seed in TSB culture medium containing 10% newborn calf serum and 0.01% NAD, fermenting at 37 deg.C and 180-200 rpm with dissolved oxygen controlled by about 30%, and culturing for 8-12 hr until OD is reached 600 When the value is more than or equal to 2.0, the fermentation culture is harvested. Centrifuging the harvested bacterium liquid for 30 minutes at 10000 r/min, collecting thalli precipitate, redissolving the thalli precipitate by PBS, adjusting the thalli concentration to (2.5-4) multiplied by 10 9 cfu/ml. Adding formaldehyde solution with the final concentration of 0.4% into the re-dissolved bacterial liquid, and inactivating the mixture for 24 to 48 hours at the temperature of 37 ℃ at the speed of 120 to 150 r/min to obtain HPS 4 type solution for later use.
1.4 Preparation of HPS 5-type antigen
Inoculating 2% (v/v) of Haemophilus parasuis type 5 strain (CX strain) seed into TSB culture medium containing 10% newborn bovine serum and 0.01% NAD, fermenting and culturing at 37 deg.C 180-200 r/min with dissolved oxygen controlled about 30%, when OD is reached 600 And harvesting the fermentation culture when the value is more than or equal to 2.0. Centrifuging the harvested bacterium liquid for 30 minutes at 10000 r/min, collecting thalli precipitate, redissolving the thalli precipitate by PBS, adjusting the thalli concentration to (2.5-4) multiplied by 10 9 cfu/ml. Adding formaldehyde solution with the final concentration of 0.4% into the re-dissolved bacterial liquid, and inactivating the mixture for 24 to 48 hours at the temperature of 37 ℃ at the speed of 120 to 150 r/min to obtain HPS 5 type solution for later use.
2. Preparation method of triple inactivated vaccine
Uniformly mixing the PCV2 Cap protein solution, the MHP solution, the HPS 4 type solution and the HPS 5 type solution with the Gel02 adjuvant, and controlling the mass ratio of the Gel02 adjuvant to the 4 antigens to be 1:9, preparing to obtain the final concentration containing 40ug/ml PCV2 Cap protein, 120ug/ml MHP thallus and 5 × 10 8 cfu/ml inactivated HPS type 4 bacteria and 5X 10 8 Triple tetravalent inactivated vaccine of cfu/ml inactivated HPS 5 type thallus.
In order to demonstrate the advantageous effects of the present invention, the following experimental examples are provided.
Experimental example 1: immunogenicity testing of MHP antigens
1. Vaccine preparation
Comparing the method for preparing the triple inactivated vaccine in example 1 of the present invention with the method for preparing the triple inactivated vaccine in CN201210221969.2, it can be seen that the main difference between the two methods is that the method for preparing the MHP solution is different, for example, CN201210221969.2 is not subjected to ultrasonic purification treatment.
Thus, this experiment prepared a MHP solution that was not sonicated for purification: the mycoplasma hyopneumoniae strain (AH strain) seeds are inoculated into a FRIIS culture medium containing 20 percent of serum and 3mg/ml of glucose according to the inoculation ratio of 10 percent (v/v), the culture is carried out for 48 to 72 hours at 37 ℃, and when the color of the culture medium is changed to yellow and the pH value is about 6.8, the bacterium liquid is harvested. The prepared AH strain whole cell culture was concentrated by 300kDa hollow fiber, centrifuged at 10000 rpm for 30 minutes, collected, and the precipitate was washed with PBS repeatedly for 3 times. Adding formaldehyde with the final concentration of 0.3% (V/V) into the concentrated and purified bacterium solution, inactivating the bacterium solution at 37 ℃ for 24 hours to obtain MHP solution after inactivation is finished, and storing the MHP solution at 2-8 ℃.
Then taking PCV2 Cap protein solution, MHP solution without ultrasonic purification treatment, HPS 4 type solution and HPS 5 type solution, and uniformly mixing with Gel01 adjuvant, and controlling the mass ratio of the Gel01 adjuvant to 4 antigens to be 1:9, preparing to obtain the final concentration of 1 × 10 containing 20ug/ml PCV2 Cap protein 8 CCU/first MHP, 1X 10 9 CFU/first HPS type 4 and 1X 10 9 CFU/head HPS 5 triple tetravalent inactivated vaccine as control triple inactivated vaccine.
2. Assessment of MHP antibody levels after immunization
3 piglets, each 2.0ml, were immunized with the triple inactivated vaccine prepared in example 1 of the present invention and the control triple inactivated vaccine, respectively. The test pigs are boosted once 21 days after the first immunization according to the same dose, and all test pigs are subjected to MHP antibody detection after 21 days after the first immunization and 21 days after the second immunization respectively, and the detection results are shown in Table 1.
The results show that the level of MHP antibody generated after the triple inactivated vaccine prepared in the invention example 1 is used for immunization is obviously higher than that of the control triple inactivated vaccine.
TABLE 1 MHP challenge protection results
3. MHP lung lesion index reduction rate after toxic attack
The triple inactivated vaccine prepared in the embodiment 1 of the invention and the control triple inactivated vaccine are injected with 5 head (2.0 ml/head) of PCV2, MHP, HPS 4 type and HPS 5 type antigen-antibody negative piglets with 3-4 weeks of age through neck muscles respectively. The vaccine is boosted once 21 days after the first immunization according to the same route of dosage. Non-immune control group was set up 5 heads. 21 days after the second immunization, 5.0ml of virulent JX strain tissue virus for mycoplasma hyopneumoniae test is injected into each trachea. After 28 days of continuous observation after the challenge, all test pigs were examined by dissection and the percentage of the average lung area of the lung tissue with the retroversion of the dorsal and ventral surfaces of the left and right apical lobes, left and right diaphragmatic lobes, right and left diaphragmatic lobes, and accessory lobes, which had undergone pancreatic sarcoidosis, to the area of the lung lobes was observed. And (3) judging according to 28-point marking and grading standards of the lung lesion index of the mycoplasma hyopneumoniae, wherein compared with a virus attacking control group, the reduction rate of the lung lesion index of the immune group is not lower than 60%, and the immune virus attacking protection is judged. The immunoprotection results after MHP challenge are shown in table 2.
TABLE 2 MHP challenge protection results
The result shows that the lung lesion index reduction rate of the triple inactivated vaccine prepared in the embodiment 1 of the invention after immune challenge is far higher than that of the control triple inactivated vaccine.
Experimental example 2: screening experiment for preparation of triple inactivated vaccine
1. Adjuvant screening
Referring to the method of example 1, 15A, ISA and Gel02 adjuvants are respectively adopted to prepare the triple inactivated vaccines of porcine circovirus type 2, mycoplasma hyopneumoniae and haemophilus parasuis (type 4 and type 5), so that each adjuvant prepared vaccine contains the same amount of antigen. Specific formulation information is as follows in table 3. 12 PCV2, MHP, HPS type 4 and HPS type 5 antigen-antibody negative piglets of about 21 days old are screened and randomly divided into 4 groups, and 3 piglets in each group. Each adjuvant vaccine immunized 3 piglets, 2.0ml each. PCV2 antibody, MHP antibody, HPS 4 type and HPS 5 type antibody detection were performed in all test pig blood samples taken 21 days after primary immunization and 21 days after secondary immunization, respectively. The results are shown in Table 4.
Comparing the antibody detection result and the vaccine dosage form, the antibody level of the vaccine prepared by the Gel02 adjuvant is higher in the antibody generation stage and after the second immunization, and the vaccine has excellent penetration.
Table 3 vaccine formulation and immunization information
TABLE 4 detection of antibodies after vaccine immunization
2. Antigen matching and compatibility studies
Triple inactivated vaccines of porcine circovirus type 2, mycoplasma hyopneumoniae, haemophilus parasuis (type 4, type 5) were prepared using Gel02 adjuvant according to the method of example 1, while single vaccines of the same antigen content were prepared. Specific formulation information is shown in table 5 below. 15 PCV2, MHP, HPS 4 type and HPS 5 type antigen-antibody negative piglets of about 21 days old are screened and randomly divided into 5 groups, and 3 piglets in each group are selected. Each vaccine immunized 3 piglets, 2.0ml each. The test pigs were boosted once at the same dose 21 days after the first immunization, and tested for PCV2 antibodies, MHP antibodies, HPS 4-type and HPS 5-type antibodies in blood taken from all test pigs 21 days after the first immunization and 21 days after the second immunization, respectively. The results are shown in Table 6.
The results show that the antibodies generated by each antigen of the prepared concatenated inactivated vaccine are not lower than those generated by the corresponding single vaccine, which indicates that the compatibility of each antigen is good.
Table 5 vaccine formulation and immunization information
TABLE 6 detection of antibodies after vaccine immunization
Experimental example 3: vaccine safety test
Method according to example 1The final concentration of 40ug/ml PCV2 Cap protein, 120ug/ml MHP, 5X 10 were prepared with Gel02 adjuvant 8 cfu/ml HPS type 4 and 5X 10 8 10 Balb/C mice, each 0.5ml, were injected intraperitoneally with 10 triple tetravalent inactivated vaccines of cfu/ml HPS 5 type, and 10 additional mice were used as an immunization control group for 10 consecutive days. The results of the security inspection are shown in Table 7.
The results show that: the vaccine prepared for immunizing the injection part of the mouse has good absorption, no abnormal spirit and ingestion in an immune group, and basically consistent weight gain with that of a control group.
TABLE 7 safety checks
Experimental example 4: vaccine efficacy test
A final concentration of 40ug/ml PCV2 Cap protein, 120ug/ml MHP, 5X 10 protein was prepared using Gel02 adjuvant as in example 1 8 cfu/ml HPS type 4 and 5X 10 8 The triple tetravalent inactivated vaccine of cfu/ml HPS 5 type is injected into 20 piglets, 2.0 ml/head, of PCV2, MHP, HPS 4 type and HPS 5 type antigen-antibody negative piglets with 3-4 weeks old through neck muscle. The vaccine is boosted once 21 days after the first immunization according to the same route of dosage. A non-immunized control group was set up for 20 heads. The toxicity attacking protective efficacy test is carried out 21 days after the second immunization.
Part PCV2
21 days after the second immunization, 5 immune groups and 5 control groups are randomly selected, and are subjected to toxicity attack by using virulent ZJ/C strain by PCV2 test, wherein each immune group is dripped into a nose by 1.0ml, and the neck is injected into muscle by 2.0ml. And (5) killing 14 days after the virus attack, and taking the lung and inguinal lymph nodes for virus separation and immunohistochemistry. PCV2 immunohistochemistry positive or virus separation positive in any tissue is judged to be pathogenic. Lung and inguinal lymph node immunohistochemistry and virus isolation were both negative and judged as protective. The PCV2 challenge protection results are shown in Table 8. The control group attacked the virus 5/5 of the disease, and the immune group protected 4/5 of the disease.
TABLE 8 PCV2 challenge protection results
MHP part
21 days after the second immunization, 5 animals of the immunization group and the control group were randomly selected, and 5.0ml of virulent JX strain tissue virus for the test of Mycoplasma hyopneumoniae was injected into each trachea. After 28 days of continuous observation after the challenge, all test pigs were examined by dissection and the percentage of the average lung area of the lung tissue with the retroversion of the dorsal and ventral surfaces of the left and right apical lobes, left and right diaphragmatic lobes, right and left diaphragmatic lobes, and accessory lobes, which had undergone pancreatic sarcoidosis, to the area of the lung lobes was observed. And (3) judging according to 28-point marking and grading standards of the lung lesion index of the mycoplasma hyopneumoniae, wherein compared with a virus attacking control group, the reduction rate of the lung lesion index of the immune group is not lower than 60%, and the immune virus attacking protection is judged. The immunoprotection results after MHP challenge are shown in Table 9. The lung lesion of the immune group is reduced by 69.2 percent, and the protection is realized.
TABLE 9 MHP challenge protection results
HPS type 4 moiety
On 21 days after the second immunization, 5 animals of the immunized group and the control group were randomly selected, and 3.0mL (containing 6.0X 10 of H.parasuis type 4 HY strain) was intraperitoneally injected 9 CFU). After continuously observing for 14 days after the toxin is attacked, the disease can be judged to be the attack of any one of the following diseases: (1) death; (2) raising the body temperature to 40.5 deg.C or above for at least 2 days; (3) clinical symptoms such as mental depression, lying, anorexia, dyspnea, lameness and the like appear; (4) multiple serositis (pleuritis, pericarditis, peritonitis, etc.), arthritis, and cellulosic exudates on the surface of the lungs or in the abdominal cavity can be seen by autopsy. Otherwise, the protection is judged. The immunoprotection results after HPS type 4 challenge are shown in table 10. The control group of the attacking virus is attacked by 5/5 of the disease, and the immune group is protected by 5/5 of the disease.
TABLE 10 HPS type 4 challenge protection results
HPS type 5 moiety
21 days after the second immunization, 5 individuals of the immunized group and the control group were randomly selected, and 3.0mL (containing 6.0X 10 of the type 5 strain of Haemophilus parasuis) of the strain CX was intraperitoneally injected into each of the immunized and control groups 9 CFU). After continuously observing for 14 days after the toxin is attacked, the disease can be judged to be the attack of any one of the following diseases: (1) death; (2) raising the body temperature to 40.5 deg.C or above for at least 2 days; (3) clinical symptoms such as mental depression, lying, anorexia, dyspnea, lameness and the like appear; (4) multiple serositis (pleuritis, pericarditis, peritonitis, etc.), arthritis, and cellulosic exudates on the surface of the lungs or in the abdominal cavity can be seen by autopsy. Otherwise, the protection is judged. The immunoprotection results after HPS type 5 challenge are shown in table 11. The control group is attacked by virus 5/5, and the immune group is protected by virus 4/5.
TABLE 11 HPS 5 type challenge protection results
Experimental example 5: comparison with commercial vaccine efficacy
A final concentration of 40ug/ml PCV2 Cap protein, 120ug/ml MHP, 5X 10 protein was prepared using Gel02 adjuvant as in example 1 8 cfu/ml HPS type 4 and 5X 10 8 Triple tetravalent inactivated vaccine cfu/ml HPS 5 type.
Comparison with commercial vaccines: the bivalent inactivated vaccine (recombinant baculovirus CP08 strain + JM strain) for porcine circovirus type 2 and mycoplasma hyopneumoniae is purchased from national drug group animal health products Co., ltd; the bivalent inactivated vaccine (SH strain +4 type JS strain +5 type ZJ strain) of porcine circovirus type 2 and haemophilus parasuis is purchased from Puleco bioengineering GmbH.
15 PCV2, MHP, HPS 4 type and HPS 5 type antigen-antibody negative piglets of about 21 days old are screened and randomly divided into 3 groups, and 5 piglets in each group are selected. Each vaccine immunized 5 piglets, 2.0ml each. PCV2 antibody, MHP antibody, HPS 4 type and HPS 5 type antibody detection were performed in all test pig blood samples taken 21 days after primary immunization and 21 days after secondary immunization, respectively. The results are shown in Table 12. The antibody generated after the triple inactivated vaccine is prepared and immunized is not lower than that of the existing commercial multiple inactivated vaccine.
TABLE 12 post vaccine antibody detection results
In conclusion, the invention provides the porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and the preparation method thereof, the triple inactivated vaccine can achieve four-prevention by one injection, reduce the times of immunity and stress, and practically solve the problem of the pig industry.
Claims (10)
1. A triple inactivated vaccine, characterized in that: it comprises porcine circovirus type 2 antigen, mycoplasma hyopneumoniae antigen, haemophilus parasuis type 4 antigen and haemophilus parasuis type 5 antigen, wherein the concentration of the porcine circovirus type 2 antigen is 30-50ug/ml, the concentration of the mycoplasma hyopneumoniae antigen is 110-130ug/ml, and the concentration of the haemophilus parasuis type 4 antigen is (4-6) multiplied by 10 8 cfu/ml, the concentration of Haemophilus parasuis type 5 antigen is (4-6) x 10 8 cfu/ml。
2. The triple inactivated vaccine of claim 1, wherein: the concentration of the porcine circovirus type 2 antigen is 40ug/ml, the concentration of the porcine mycoplasma pneumoniae antigen is 120ug/ml, and the concentration of the haemophilus parasuis type 4 antigen is 5 multiplied by 10 8 cfu/ml, concentration of Haemophilus parasuis type 5 antigen 5X 10 8 cfu/ml。
3. The triple inactivated vaccine according to claim 1 or 2, characterized in that: the porcine circovirus type 2 antigen is PCV2 Cap protein.
4. The triple inactivated vaccine according to claim 1 or 2, characterized in that: the mycoplasma hyopneumoniae antigen is inactivated mycoplasma hyopneumoniae thallus.
5. The triple inactivated vaccine of claim 4, wherein: the preparation method of the inactivated mycoplasma hyopneumoniae thalli comprises the following steps: inoculating mycoplasma hyopneumoniae strain seeds to a culture medium for culturing for 48-72 hours, harvesting a bacterial liquid, concentrating, centrifuging, collecting precipitates, washing, ultrasonically crushing, and adding an inactivating agent for inactivation to obtain the mycoplasma hyopneumoniae strain seed; preferably, the power of the ultrasonic crushing is 20-50W, and the time is 10-30 minutes; the inactivating agent is diethylene imine, and the final concentration of the inactivating agent is 3mmol/L.
6. The triple inactivated vaccine according to claim 1 or 2, characterized in that: the haemophilus parasuis type 4 antigen is inactivated haemophilus parasuis type 4 thallus.
7. The triple inactivated vaccine according to claim 1 or 2, characterized in that: the haemophilus parasuis type 5 antigen is inactivated haemophilus parasuis type 5 thallus.
8. The triple inactivated vaccine according to any one of claims 1 to 7, characterized in that: the antigen-antibody complex also comprises an adjuvant, and the mass ratio of the adjuvant to the total amount of the 4 antigens is 1: (8-10), preferably 1:9.
9. the triple inactivated vaccine according to claim 8, wherein: the adjuvant is selected from one or a mixture of more than two of 15A, ISA and Gel02, and is preferably Gel02.
10. The preparation method of the triple inactivated vaccine as claimed in any one of claims 1 to 9, is characterized in that: the method comprises the following steps: mixing porcine circovirus type 2 antigen, mycoplasma hyopneumoniae antigen, haemophilus parasuis type 4 antigen, haemophilus parasuis type 5 antigen and adjuvant uniformly to obtain the product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211336438.8A CN115804838A (en) | 2022-10-28 | 2022-10-28 | Porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211336438.8A CN115804838A (en) | 2022-10-28 | 2022-10-28 | Porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115804838A true CN115804838A (en) | 2023-03-17 |
Family
ID=85482954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211336438.8A Pending CN115804838A (en) | 2022-10-28 | 2022-10-28 | Porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115804838A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117330764A (en) * | 2023-12-01 | 2024-01-02 | 北京瑞阳瑞泰生物科技有限公司 | Veterinary vaccine efficacy test method |
-
2022
- 2022-10-28 CN CN202211336438.8A patent/CN115804838A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117330764A (en) * | 2023-12-01 | 2024-01-02 | 北京瑞阳瑞泰生物科技有限公司 | Veterinary vaccine efficacy test method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101117627B (en) | Pig epidemic diarrhea virus attenuated vaccine strain and uses thereof | |
| CN104862286B (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application | |
| EP2271663B1 (en) | Novel avian astrovirus | |
| CN105327344B (en) | Vaccine composition and the preparation method and application thereof containing porcine circovirus 2 type antigen Yu haemophilus parasuis antigen | |
| CN114854697B (en) | Trivalent inactivated vaccine of porcine rotavirus G4-G5-G9 and preparation method and application thereof | |
| CN112779193B (en) | Virulent strain of mycoplasma synoviae and application thereof | |
| KR102336158B1 (en) | Vaccine Composition Against Porcine Epidemic Diarrhea Virus and Porcine Rotavirus | |
| CA2652049C (en) | Vaccination of young animals against lawsonia intracellularis infections | |
| KR102243374B1 (en) | Vaccine Composition Against Bovine Coronavirus, Bovine Rotavirus and Bovine Viral Diarrhea Virus | |
| CN111789941B (en) | Bivalent inactivated vaccine for mycoplasma pneumonia and chlamydia psittaci disease of goats and preparation method thereof | |
| JP7303306B2 (en) | Foot-and-mouth disease virus-like particle antigen, vaccine composition thereof, preparation method and application | |
| CN110201153B (en) | Triple inactivated vaccine for rabbit viral hemorrhagic disease, pasteurellosis and bordetella disease and preparation method thereof | |
| AU640516B2 (en) | Haemophilus paragallinarum vaccine | |
| CN115804838A (en) | Porcine circovirus, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof | |
| CN108704128B (en) | Canine distemper parvovirus bigeminal subunit vaccine | |
| CN113943714A (en) | Cat calicivirus strain and application thereof | |
| CN104450559A (en) | New mycoplasma hyopneumoniae strain and vaccine composite of new mycoplasma hyopneumoniae | |
| AU2013342269B2 (en) | Attenuated Mannheimia haemolytica vaccines and methods of making and use | |
| CN112294953A (en) | PCV2 type baculovirus vector, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof | |
| CN109867713B (en) | Canine distemper genetic engineering subunit vaccine | |
| JP2023520803A (en) | Foot-and-mouth disease virus-like particle antigen, its vaccine composition, preparation method and use | |
| CN111808826A (en) | Porcine type-A seneca virus SVA/CH-Fuj strain and application thereof | |
| CN101420975A (en) | Vaccine against mycoplasma PRRSV | |
| CN109134619A (en) | Porcine circovirus 2 type antigen, the immunogenic composition of its preparation, preparation method and application | |
| CN110540579A (en) | avibacterium paragallinarum antigen protein, vaccine composition containing avibacterium paragallinarum antigen, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |