CN115792238A - Method for screening and determining TCR interacting with specific antigen and interaction strength of TCR interacting with specific antigen - Google Patents

Abstract

The invention relates to a method for screening and determining TCR interacted with a specific antigen and interaction strength thereof, which is implemented by utilizing a yeast display and yeast mating system to screen and determine TCR interacted with the specific antigen and interaction strength thereof. And calculating the value of the fold difference (fold change) of each TCR sequence screened and determined, thereby determining the TCR interacting with the specific antigen and the strength of the interaction with the specific antigen.

Description

A TCR that screens and determines the interaction with a specific antigen and its interaction with a specific antigen Interaction strength method

technical field

The invention relates to a method for screening and determining the TCR interacting with a specific antigen and its interaction strength with a specific antigen. The method of the invention is a method for screening and determining the interaction with a specific antigen by using yeast display and yeast mating TCR and its interaction strength with specific antigens. According to the method of the present invention, TCR and pMHC are respectively displayed on the surface of yeast of different mating types, and then the yeast mating experiment is carried out, and then the interaction between TCR and pMHC in the yeast mating system is doubled. Somatic yeast cells were used to screen and determine the TCR and its interaction strength with specific antigens. At the same time, by calculating the fold change value of each TCR sequence determined by the screening, the TCR interacting with the specific antigen and its interaction strength with the specific antigen are determined.

Background technique

TCR (T cell receptor, T cell antigen receptor) is a specific T cell receptor on the surface of T cells. It is a molecule that can recognize endogenous/exogenous antigens, and can kill and clear specific damaged cells. At the same time, it can mediate immune response and play an important role in immune response and immune regulation. This receptor is also the molecular structure of T cells that specifically recognize and bind antigen peptide-MHC molecules, and usually exists in the form of complexes with CD3 molecules in T cell surface. In the process of T cell antigen recognition, the receptor TCR is closely combined with the pMHC (antigen molecule polypeptide or peptide-MHC) presented by the major histocompatibility complex (Major Histocompatibility Complex, MHC), thereby activating T cells, namely After T cells are stimulated by antigens, they differentiate, proliferate, and transform into activated T cells, which produce the immune effect of direct killing of antigens and synergistic killing of cytokines released by activated T cells. Tumor cell immunotherapy (TCR-T) is a treatment method that uses T cells that specifically bind to target tumor antigens to kill and eliminate tumor cells.

TCR recognition of pMHC to activate the immune response is crucial to maintaining the health of the human body, and the high-affinity TCR evolved in vitro can improve the anti-tumor ability of engineered T cells. Among them, the molecule that best represents the T cell response characteristics is the TCR hypervariable region CDR3 (the third complementarity determining region), which is the main antigen-binding site of the TCR. The study of the TCR CDR3 library will provide a basis for the physiological and pathological characteristics of T cells. provides the basis for a comprehensive analysis.

At present, the methods for researching and screening high-affinity TCRs are mainly carried out through phage display and yeast display.

The essence of phage display technology is a screening technology. Different foreign genes were inserted into the phage vectors, and with the passage of the phage, the foreign proteins would be displayed on the surface of the phage to form a phage library.

Yeast display technology is a eukaryotic protein expression system, which uses the yeast cell surface display system (with perfect protein post-translational modification and secretion mechanism) to immobilize and display heterologous eukaryotic proteins on the surface of yeast cells, which has been screened in protein libraries , protein directed evolution, high-affinity antibody sorting, antigen/antibody library construction, affinity maturation, vaccine production, immune biocatalysis, and biosensors. The current yeast display technology mostly takes pMHC in the form of tetrameric protein as the research object, and screens the sequence of TCR.

For example, Kranz and other research groups include Holler et al., 2000; (Holler, PD, Holman, PO, Shusta, EV, O'Herrin, S., Wittrup, KD, and Kranz, DM (2000). In vitro evolution of a T cell receptor with high affinity for peptide/MHC.Proc.Natl.Acad.Sci.97,5387–5392;) Richman et al.,2006; (Richman, SA, Healan, SJ, Weber, KS, Donermeyer, DL, Dossett, ML, Greenberg, PD, Allen, PM, and Kranz, DM (2006). Development of a novel strategy for engineering high-affinity proteins by yeast display. Protein Eng. Des. Sel. 19, 255–264;) Shusta et al. , 2000; (Shusta, EV, Holler, PD, Kieke, MC, Kranz, DM, and Wittrup, KD (2000). Directed evolution of a stable scaffold for T-cell receptor engineering. Nat. Biotechnol. 18, 754–759;) Smith et al al., 2015 (Smith, SN, Harris, DT, and Kranz, DM (2015). T Cell Receptor Engineering and Analysis Using the Yeast Display Platform. In Yeast Surface Display, (Humana Press, New York, NY), pp.95 –141.) Successfully displayed the V region of scTCR (single-chain TCR) on the surface of yeast through Linker connection, and constructed a mutant library of 10 ⁵ TCRs obtained by random mutation in vitro, and obtained high-affinity binding to the target antigen through flow cytometry screening TCR, the technology in this document uses the cloning method of expressing the TCR mutant library in the form of a plasmid and traditional enzyme-cut ligation. In addition, Chinese researchers, such as Professor Huang Shulin of Guangdong College of Pharmaceutical Sciences, successfully realized the yeast display of scTCR (Shao et al., 2010) (Shao, HW, Guo, HP, Huang, XL, Zhang, WF, and Huang, SL(2010).The construction and yeast surface display of single chain T cell receptor(scTCR).J.Guangdong Pharm.Coll.).

This method of artificial library construction breaks through the limitations of natural T cell library screening, and increases the efficiency of screening while maintaining the antigen specificity of TCR. However, the above literatures all use scTCR expressed in the form of plasmids.

Existing technologies for screening TCR sequences have their own problems. For example, the screening of TCRs by constructing cell mutation libraries of TCR sequences is often limited by the transfection efficiency of cells, and the capacity of the obtained cell mutation libraries is limited, and The cost of culturing cells is more; such as Li et al., 2005 (Li, Y., Moysey, R., Molloy, P.E., Vuidepot, A.-L., Mahon, T., Baston, E., Dunn, S.,Liddy,N.,Jacob,J.,Jakobsen,B.K.,etal.(2005).Directed evolution of human T-cell receptors with picomolaraffinities by phage display.Nat.Biotechnol.23,349–354.), The TCR mutation library to be studied is displayed on the surface of M13 phage by phage display technology, and MHC protein is used for screening, but because the protein synthesis and folding mechanism of phage is different from that of eukaryotes, not all TCR sequences can be obtained in phage Very good expression; in addition, the existing screening method using yeast display technology also needs to rely on purified MHC protein (DavidM. Kranz research group), which is time-consuming and laborious; the T The TCRs identified by the screening method of identifying the TCR sequence by sequencing the cells are all relatively low-affinity TCRs. In addition, the screening method must be purified by MHC tetramer protein, and the methods that require protein purification technology are time-consuming, laborious and expensive. and poor commercial viability.

In the patent ZL 202011473454.2 of Lan Xun Laboratory in 2020, it is recorded that the modified yeast mating system is used to study and screen antigens that can bind to specific TCRs, and it is possible to study the interaction between TCRs and antigens without protein purification, and to screen out Antigens capable of binding to specific TCRs. In this method, one TCR is displayed on the surface of yeast, and an antigen mutation library is displayed on another yeast, so as to screen the target antigen that binds to a specific TCR. However, in this patent application, only target antigens that bind to specific TCRs can be screened, and it is not disclosed whether the system can be used to screen TCRs that bind to specific antigens, nor does it disclose or suggest how to determine the interaction strength between TCR and pMHC.

In the process of constructing the pMHC mutant library, the modified pMHC library receiving vector was used to construct the flux through the Golden Gate cloning method. There are still technical issues with the cumbersome build process.

Therefore, how to screen the TCR that binds to a specific antigen with low cost and high specificity and at the same time determine the strength of the interaction between the screened TCR sequence and the specific antigen has always been an unresolved problem in the art.

Contents of the invention

In view of the above-mentioned problems in the prior art, the present invention provides a method that can realize random mutation of TCR CDR3 region and screen high-affinity TCR sequences. In the method of the present invention, by using yeast display and yeast mating system, TCR and pMHC proteins are respectively displayed on the surface of different mating type yeasts, and then yeast mating experiments are performed on different mating type yeasts integrating TCR and pMHC, and then through the yeast mating system The diploid signal formed by the interaction between TCR and pMHC is used to screen high-affinity TCR sequences. At the same time, the interaction strength between the screened TCR and the specific antigen is determined by calculating the fold change value of each of the determined TCR sequences.

The method involved in the present invention uses the yeast display and yeast mating system to specifically screen out one or more TCRs with high affinity for a specific antigen (such as a tumor antigen), and simultaneously determine one or more TCRs that are compatible with the specific antigen. Antigen interaction strength. The TCR screened by the method of the present invention can be applied to cell therapy such as TCR-T.

In one aspect, the present invention provides a method for screening and determining the TCR interacting with a specific antigen and the strength of its interaction with the specific antigen, comprising:

(a) displaying the specific antigen-MHC complex (pMHC) and the TCR library on the surface of yeast of different mating types;

(b) cocultivating the yeasts of different mating types;

(c) screening out yeast cell diploids, and determining the TCR sequence in the yeast cell diploids;

(d) calculating the fold change (fold change) value of each TCR sequence determined;

From this, the TCRs interacting with a specific antigen and the strength of their interaction with a specific antigen are determined.

Preferably, in some embodiments, the TCR-displaying yeast cell expresses the TCR in an integrated form.

Preferably, in some embodiments, the yeast cell displaying pMHC expresses pMHC in an integrated form.

Those skilled in the art can understand that mating-deficient yeast cells can be obtained by any conventional technical method in the art. In some embodiments, the mating-deficient yeast cell is a yeast cell in which the Sag1 gene has been deleted.

In some embodiments, the yeast cell is Saccharomyces cerevisiae, preferably the Saccharomyces cerevisiae is EBY100 strain or a genetically modified strain of EBY100 strain (such as Younger, D., Berger, S., Baker, D. & Klavins, E. High-throughput Characterization of protein–protein interactions by reprogramming yeast mating. Proc. Natl. Acad. Sci. 114, 12166–12171 (2017) described).

In some embodiments, both MHC and TCR are human.

Those skilled in the art can understand that the TCR sequence in yeast cell diploid can be determined by any conventional technical means in the art, such as first-generation sequencing (such as sanger sequencing), second-generation sequencing, third-generation sequencing and other methods. Preferably, in some embodiments, the TCR sequence in yeast cell diploids is determined using next-generation sequencing.

Those skilled in the art can also understand that any conventional technical means in the art can be used to construct the TCR library (such as using gene synthesis, using random mutation primers, etc.). Preferably, in some embodiments, the TCR library can be constructed by using random mutation primers for PCR amplification.

Preferably, in some embodiments, the TCR sequences in the TCR library differ in CDR3 sequences.

In some embodiments, the TCR library is constructed using Gibson Assembly's cloning method. In some embodiments, the cloning method using Gibson Assembly is as shown in the Examples herein.

In yet another aspect, the present invention also provides a use of the screened TCR in cell therapy such as TCR-T.

Description of drawings

Figure 1: Schematic diagram of the strategy for constructing a TCR library

Figure 2: A graph showing the fold change values of different TCRs and specific pMHCs in the TCR library;

Figure 3: Graph showing the results of flow cytometry in a validation experiment, showing the strength of the interaction between TCR and pMHC (expressed as mean fluorescence intensity (MFI)).

Figure 4: Positive correlation between interaction strength expressed as mean fluorescence intensity (MFI) and as fold change value calculated using Spearman's correlation coefficient.

Detailed ways

The terms used herein are explained below, but the present invention is not limited by the following explanations.

1. Definition

The practice of the present invention will employ, unless specifically indicated otherwise, protocols within the skill of the art in chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology, cell biology, stem cell , cell culture, and conventional methods of transgenic biology, many of which are described below for illustrative purposes. Such techniques are explained fully in the literature. See, eg, Sambrook, et al, Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al, Molecular Cloning: A Laboratory Manual (1982) ; Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning A Practical Approach, vol. I&II (IRLPress, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York York,1991); Oligonucleotide Synthesis(N.Gait, Ed.,1984);Nucleic Acid Hybridization(B.Hames&S.Higgins,Eds., 1985);Transcription and Translation(B.Hames&S.Higgins,Eds., 1984); Animal Cell Culture (R. Freshney, Ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984); Fire et al., RNA Interference Technology: From Basic Science to Drug Development (Cambridge University Press, Cambridge, 2005); Schepers , RNA Interference in Practice (Wiley-VCH, 2005); Engelke, RNA Interference (RNAi): The Nuts&Bolts of siRNA Technology (DNA Press, 2003); Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology; HumanPress, Totowa, NJ, 2004); Sohail, Gene Silencing by RNA Interference: Technology and Application (CRC, 2004); Clarke and Sanseau, microRNA: Biology, Function & Expression (Nuts & Bolts series; DNA Press, 2006); Immobilized Cells And Enzymes (IRL Press, 1986); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J.H.Miller and M.P.Caloseds., 1987, Cold Spring Harbor Laboratory); Harlow and Lane, Antibodies, ( Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D.M. Weir and C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, (Blackwell Scientific Publications, Oxford, 1988); Embryonic Stem Cells: Methods and Protocols (Methods in Molecular Biology) (Kurstad Turksen, Ed., 2002); Embryonic Stem Cells : Volume I: Isolation and Characterization (Methods in Molecular Biology) (Kurstad Turksen, Ed., 2006); Embryonic Stem Cell Protocols: Volume II: Differentiation Models (Methods in Molecular Biology) (Kurstad Turksen, Ed., 2006); Human Embryonic Stem Cell Protocols (Methods in Molecular Biology) (Kursad Turksen Ed., 2006); Mesenchymal Stem Cells: Methods and Protocols (Methods in Molecular Biology) (Darwin J. Prockop, Donald G. Phinney, and Bruce A. Bunnell Eds., 2008); Hematopoietic Stem Cell Protocols (Methods in Molecular Medicine) (Christopher A.Klug, and Craig T.Jordan Eds., 2001); Hematopoietic Stem Cell Protocols (Methods in Molecular Biology) (Kevin D. Bunting Ed., 2008) Neural Stem Cells: Methods and Protocols (Methods in Molecular Biology) (Leslie P. Weiner Ed., 2008); Hogan et ah, Methods of Manipulating the Mouse Embyro (2nd Edition, 1994); Nagy et al, Methods of Manipulating the Mouse Embryo (3rd Edition, 2002), and The Zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), 4th Ed., (Univ. of Oregon Press, Eugene, OR, 2000).

All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are defined below.

As used herein, the term "about" or "approximately" refers to a change of up to 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% in quantity, level, value, amount, frequency, percentage, dimension, size, volume, weight or length. In one embodiment, the term "about" or "approximately" refers to ±15%, ±10%, ±9% around a reference amount, level, value, quantity, frequency, percentage, dimension, size, amount, weight or length , ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% amount, level, value, amount, frequency, percentage, scale, size, amount , weight or length range.

As used herein, the term "substantially/essentially" means about 90%, 91%, compared to a reference amount, level, value, amount, frequency, percentage, dimension, size, amount, weight, or length , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher in quantity, level, value, amount, frequency, percentage, dimension, size, amount, weight, or length. In one embodiment, the term "substantially the same" refers to a quantity, level, value, quantity, frequency, A percentage, measure, size, amount, weight, or length range.

As used herein, the term "substantially free" when used to describe a composition such as a cell population or a culture medium means free of a specified substance, for example 95% free, 96% free, 97% free, 98% free A composition that is free, 99% free of the specified substance, or is undetectable as measured by conventional means. A similar meaning applies to the term "absent" when referring to the absence of a particular substance or component of a composition.

Throughout this specification, unless the context requires otherwise, the terms "comprising", "including", "containing" and "having" are to be understood as implying the inclusion of stated steps or elements or steps or groups of elements, but not the exclusion of any other steps or elements or steps or groups of elements. In certain embodiments, the terms "comprising," "including," "containing," and "having" are used synonymously.

"Consisting of" means including, but limited to, anything following the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present.

"Consisting essentially of" is meant to include any element listed after the phrase "consisting essentially of" and is limited to activities or actions specified in the disclosure that do not interfere with or contribute to the listed element other elements. Thus, the phrase "consisting essentially of" is intended to indicate that the listed elements are required or mandatory, but that no other elements are optional, and depending on whether they affect the activity or action of the listed elements and may or may not exist.

Throughout this specification, references to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "an embodiment," "another embodiment," or "further embodiments" A combination thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner in one or more embodiments.

"Adherent" refers to the attachment of cells to a container, eg, to a sterile plastic (or coated plastic) cell culture dish or flask, in the presence of an appropriate medium. Certain types of cells cannot be maintained or grow in culture unless they adhere to the cell culture vessel. Certain classes of cells ("non-adherent cells") are maintained and/or proliferated in culture without attachment.

"Culture" or "cell culture" refers to the maintenance, growth and/or differentiation of cells in an in vitro setting. "Cell culture medium", "culture medium", "culture medium", "medium", "supplement" and "medium supplement" refer to nutritional compositions for growing cell cultures.

"Culture" or "cell culture" refers to a cultured substance, such as a cell, and/or a medium in which a cultured substance, such as a cell, is present.

"Cultivate" refers to the maintenance, propagation (growth) and/or differentiation of cells outside a tissue or organism, eg, in sterile plastic (or coated plastic) cell culture dishes or flasks. "Cultivation" may utilize a culture medium as a source of nutrients, hormones, and/or other factors that help to propagate and/or maintain cells.

"Ingredient" means any compound or other material, whether chemical or biological in origin, that can be used in a cell culture medium to maintain and/or promote cell growth and/or differentiation. The terms "component", "nutrient" and "ingredient" are used interchangeably. Conventional ingredients for cell culture media may include, but are not limited to, amino acids, salts, metals, sugars, lipids, nucleic acids, hormones, vitamins, fatty acids, proteins, and the like. Other components that promote and/or maintain ex vivo or in vitro cell culture can be selected by those of ordinary skill in the art as needed for the desired effect.

"Isolate" means to separate and collect a composition or material from its natural environment, eg, separation of individual cells or cell cultures from a tissue or body. In one aspect, a cell population or composition is substantially free of cells and materials with which it is associated in nature. "Isolated" or "purified" or "substantially pure" with respect to a target cell population means at least about 50%, at least about 75%, at least about 85% of the target cells comprising the total cell population , at least about 90%, and in particular embodiments, at least about 95% pure cell population. The purity of a cell population or composition can be assessed by appropriate methods well known in the art. For example, a substantially pure population of totipotent cells refers to at least about 50%, at least about 75%, at least about 85%, at least about 90%, and in particular embodiments, at least about A population of cells that is about 95%, and in certain embodiments, about 98% pure.

"Passage" refers to the act of subdividing and plating cells onto multiple cell culture surfaces or vessels when the cells have proliferated to the desired extent. In some embodiments, "passaging" refers to subdividing, diluting, and plating cells. When cells are passaged from a primary culture surface or vessel to a subsequent set of surfaces or vessels, the subsequent culture may be referred to herein as "subculture" or "first passage" or the like. Each subdivision and plating into a new culture vessel is considered a passage.

"Plating" refers to placing one or more cells in a culture vessel such that the cells adhere to and spread on the cell culture vessel.

"Proliferation" refers to the property of a cell dividing into two substantially equal cells or a population of cells increasing in number (eg, to replicate).

"Propagation" or "expansion" refers to growing (eg, replicating via cell proliferation) cells of a tissue or outside an organism, eg, in sterile containers, eg, plastic (or coated plastic) cell culture dishes or flasks.

The term "vector" or "expression vector" as used herein refers to a vector comprising a nucleic acid sequence encoding at least a portion of a gene product capable of being transcribed. In some cases, the RNA molecule is then translated into a protein, polypeptide or peptide. In other cases, these sequences are not translated, eg, in the production of antisense molecules or ribozymes. Expression vectors may contain various control sequences, which refer to nucleic acid sequences required for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. Vectors and expression vectors may contain, in addition to control sequences that control transcription and translation, nucleic acid sequences that have other functions and are described below.

The term "gene" as used herein is defined as a coding unit for a functional protein, polypeptide or peptide. It is understood that the functional term includes genomic sequences, cDNA sequences, and small engineered gene segments that express or are adapted to express proteins, polypeptides, domains, peptides, fusion proteins, and mutants.

The term "polynucleotide" or "nucleic acid" as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Accordingly, as used herein, nucleic acid and polynucleotide are used interchangeably. Nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides and hydrolysis to nucleosides.

The term "polypeptide" as used herein is defined as a chain of amino acid residues, usually having a defined sequence. As used herein the term polypeptide is used interchangeably with the term protein. Polypeptides and peptides of the invention can be modified by various amino acid deletions, insertions and/or substitutions. In specific embodiments, the modified polypeptide and/or peptide is capable of modulating an immune response in a subject. In some embodiments, wild-type proteins or peptides are used. In some embodiments, modified proteins or polypeptides are used to generate pMHC.

As used herein, the term "purified" refers to a polypeptide that is substantially free from association with other proteins or polypeptides, eg, as a purified product of recombinant host cell culture or from a non-recombinant source.

In the context of antibody or TCR binding, the term "specifically binds" refers to the high affinity and/or high affinity and/or high Affinity binding. Binding of an antibody or TCR to these epitopes is generally stronger than binding of the same antibody or TCR to any other epitope or any other polypeptide not comprising that epitope.

The antigen or antigen-derived peptide or polypeptide useful in the present invention may be any antigen or antigen-derived peptide or polypeptide of interest to the researcher.

The term "promoter" as used herein is defined as a DNA sequence recognized by a cellular synthesizer, or an introduced synthesizer, which is required to initiate the specific transcription of a gene.

As used herein, the terms "transfection", "transduction" or "transformation" are used interchangeably and refer to the process by which exogenous DNA is introduced into a host cell. Transfection (or transduction) can be achieved by any of a number of methods, including electroporation, microinjection, gene gun delivery, retroviral infection, lipofection, superfection, and the like. Transfection (or transduction or transformation) is divided into two ways: stable transfection (or transduction or transformation) and transient transfection (or transduction or transformation). Stable transfection (or transduction or transformation) refers to the integration of foreign DNA into the genome of the host cell. Transient transfection (or transduction or transformation) means that the foreign DNA introduced into the host cell does not necessarily integrate into the genome of the host cell.

The term "integrated form" as used herein refers to the integration of exogenous DNA into the genome of the host cell after it is introduced into the host cell. In the host cell, the exogenous DNA can continuously express the corresponding mRNA or protein in the host cell.

The term "mating type" or "conjugative type" as used herein refers to two mating types in fungi that can mate with each other to produce sexual spores. There are two mating types in yeast called alpha and a. It is generally understood by those skilled in the art that yeast of different mating types cannot conjugate.

The term "mating deficient" as used herein means that due to some changes in yeast cells, yeasts of different mating types cannot mate in conventional co-cultivation. Those skilled in the art can prepare or obtain mating-deficient yeast by using conventional methods in the art (such as gene mutation, gene editing technology, treatment with corresponding compounds, etc.). In some embodiments, conventional techniques in the art can be used to delete the Sag1 gene in yeast cells, thereby obtaining mating-deficient yeast.

The term "overexpression" used herein refers to an increase in the expression level of the corresponding target gene in the host cell. The gene of interest can be overexpressed using any conventional technical means in the art, including but not limited to introducing an exogenous gene of interest into the host cell, using a compound (inhibitor or agonist) or gene editing technology (such as CRISPRi) to increase the gene of interest in the host cell The expression of the target gene is thus obtained by the host cell overexpressing the target gene.

The term "plasmid form" as used herein means that the exogenous DNA is not integrated into the genome of the host cell after it is introduced into the host cell, but relies on the self-replicating elements on the plasmid for independent replication and amplification. However, during the process of host cell proliferation or passage, it is necessary to maintain the selection pressure on the plasmid. Once the selection pressure is lost, the exogenous DNA may be lost, so that the amount of the exogenous DNA will continue to decrease during the process of host cell proliferation or passage, so that the exogenous DNA can express the corresponding mRNA or protein in the host cell volume will continue to decrease.

The term "interaction strength" as used herein refers to the strength of binding of a molecule to its ligand, which can be characterized by the term "equilibrium dissociation constant (KD)" as used herein, and its unit is molar concentration (M or mol/L). The equilibrium dissociation constant can be measured by techniques known in the art, such as Surface Plasmon Resonance (SPR, Surface Plasmon Resonance) technique. In some embodiments, for example, Moritz, A. et al. High-throughput peptide-MHC complex generation and kinetic screenings of TCRs with peptide-receptive HLA-A*02:01 molecules. Sci. Immunol. 4, eaav0860 (2019) can be used Measured in the manner described in .

The term "negative control group" as used herein refers to any negative control used in conventional experimental methods known to those skilled in the art, which is a group that has not received any type of treatment in the experiment or that the corresponding effect is not expected to occur by those skilled in the art , so this group should not show any change during the experiment, which is used to control for unknown variables during the experiment. Specifically, in some embodiments, for example when studying the interaction of an antigen (termed "antigen A") with a type of TCR (termed "TCR-A"), the negative control group may be a protein expressing antigen A The co-cultivation of yeast and yeast cells expressing TCR known in the art that does not bind to antigen A, and the negative control group can also be yeast cells expressing TCR-A and expressing antigens known in the art that do not bind to TCR-A co-culture of yeast cells.

"Modified protein" or "modified polypeptide" or "modified peptide" refers to a protein or polypeptide whose chemical structure (particularly its amino acid sequence) has been altered relative to a wild-type protein or polypeptide. In some embodiments, a modified protein or polypeptide or peptide has at least one altered activity or function (recognizing that a protein or polypeptide or peptide may have multiple activities or functions). It is particularly contemplated that an activity or function of the modified protein or polypeptide or peptide may be altered, but on the other hand retain a wild-type activity or function, such as immunogenicity or, in the case of pMHC formation, immunogenicity The ability of the system to interact with other cells.

The "next-generation sequencing" described herein refers to the determination of "DNA sequence or DNA fragment sequence" on a conventional next-generation sequencing platform using the next-generation sequencing method commonly understood by those skilled in the art. In some embodiments, the next-generation sequencing includes the step of PCR amplifying the fragment to be sequenced and introducing a sequencing linker sequence and a barcode sequence, and determining the sequence by a next-generation sequencing platform.

The term "random mutation primer" as used herein refers to the base form of mutation with NNK (N represents any nucleotide, K represents G or T) at the desired introduction mutation position, the non-mutation position and the two sides of the template DNA The strands have complementary positions, and the 3' end of the primer is more than 20bp complementary to the template DNA.

The term "determining the sequence" as used herein refers to the process of obtaining the nucleotide sequence of the nucleic acid or deoxyribonucleic acid of the corresponding sample by conventional techniques in the art. For example, the corresponding sequence can be detected by performing sequencing by a first-generation sequencing method (eg, sanger sequencing method) or a next-generation sequencing method. In some embodiments, next generation sequencing methods can be used to perform sequencing to detect the corresponding sequences.

The term "number of reads" used herein refers to the number of read fragments for the sequence of the DNA fragment to be sequenced in one sequencing of the next generation sequencing method.

The term "pathogen" as used herein refers to a specific causative agent of a disease and may include, for example, any bacteria, virus or parasite.

The term "disease" as used herein refers to interruption, cessation or disorder of a bodily function, system or organ. Preferred diseases include infectious diseases.

2. Preparation of Nucleic Acids

Nucleic acids used herein include, but are not limited to, all nucleic acid sequences obtained by any available method in the art (including but not limited to recombinant methods, ie cloning nucleic acids from recombinant libraries or cell genomes using conventional cloning techniques and PCR, etc.). In addition, nucleic acid encompasses may include mutations, including, but not limited to, mutations to nucleotides or nucleosides by methods known in the art. A nucleic acid may comprise one or more polynucleotides. In some embodiments, the nucleic acid is contained within a viral vector. In some embodiments, the viral vector is a retroviral or lentiviral vector.

In some embodiments, nucleic acids for use in the invention can be prepared by any technique known in the art, such as chemical synthesis, enzymatic production, or biological production. Nucleic acids can be recovered or isolated from biological samples. It may be recombinant or it may be native or endogenous to the cell (produced from the genome of the cell). In some embodiments, the nucleic acid fragments of interest can be amplified by gene amplification techniques such as PCR (polymerase chain reaction), using chemically synthesized or intracellular nucleic acids as templates, and thus obtain sufficient amounts of Nucleic acid sequence or nucleic acid sequences of interest.

Nucleic acid synthesis can also be performed according to standard methods. Non-limiting examples of synthetic nucleic acids (such as synthetic oligonucleotides) include nucleic acids chemically synthesized in vitro using phosphotriester, phosphite, or phosphoramidite chemistry and solid-phase techniques or by deoxynucleoside triphosphate H - Phosphate intermediates. A variety of different nucleotide synthesis mechanisms have been disclosed.

Nucleic acids can be isolated using known techniques. In particular embodiments, methods of isolating small nucleic acid molecules and/or isolating RNA molecules can be used. Chromatography is a method used to separate or separate nucleic acids from proteins or from other nucleic acids. The method may involve gel matrix electrophoresis, filter columns, alcohol precipitation and/or other chromatography. If nucleic acids from cells are to be used or evaluated, methods generally involve lysing the cells with a chaotropic agent (such as guanidine isothiocyanate) and/or a detergent (such as N-lauroyl sarcosine), followed by performing a procedure to isolate specific RNA populations. method.

3. Protein expression

In some embodiments, any of the promoters can be used to express a protein of interest (eg, pMHC or TCR) on the surface of yeast cells or T cells. In some embodiments, the promoter used to express a protein (eg, pMHC or TCR) is constitutive. There are a variety of constitutive promoters known in the art, including but not limited to the TEF1 and glyceraldehyde-3-phosphate dehydrogenase promoters. In some embodiments, the promoters used to express pMHC on the surface of yeast cells in the present invention are constitutive promoters commonly used in yeast such as pGPD, pTEF1, pTEF2, pADH1, GAP, etc. In some embodiments, pGPD is used to promote expression of pMHC in yeast. In some embodiments, the promoter used to express a polypeptide (eg, pMHC or TCR) is inducible. Inducible promoters are useful when one of skill in the art desires to control when a polypeptide of interest is expressed. Many inducible promoters are known in the art, including but not limited to GAL1, POX3 and LIP2 promoters. Those skilled in the art are aware of suitable constitutive and inducible promoters that function in cells of interest, such as yeast cells or T cells.

In some embodiments, yeast cell transformation can be performed by various methods known in the art, such as lithium acetate transformation, electroporation, and the like. In some embodiments, yeast cell transformation is performed using electroporation. In some embodiments, a target sequence plasmid containing both ends of the homology arm required for integration with the yeast genome can be constructed, the target sequence can be recovered by digesting the plasmid, and the linearized fragment can be transformed into yeast cells to obtain Yeast cells with integrated gene expression, so that yeast cells can continuously and stably express the protein or polypeptide of interest.

In some embodiments, T cells can be transfected by various methods known in the art, such as virus-mediated transfection, electroporation, and the like.

4. Yeast cells

Yeast cells useful in the present invention are known in the art and include Saccharomyces cerevisiae, Hansenula polymorpha, Schizosaccharomyces pombe, Kluyvern lactate Yeast (Kluyveromyces lactis), Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichiamethanolica, Pichia mongolica Yeast (Pichiagui Ilermondii) and Candida maltosa. In some embodiments, preferably, the yeast used in the methods, systems, uses or cultures described herein is Saccharomyces cerevisiae. More preferably, in some embodiments, the yeast is EBY100 strain or a genetically engineered strain of EBY100 strain. As used herein, "genetically modified strain" refers to changing the mating type of the original strain, etc., on the basis of the original strain, using conventional genetic manipulation means in the field, or modifying one, two, three, or four of the original strain. One or more genes are deleted, replaced or mutated, or one, two, three, four or more genes are exogenously expressed in the original strain, or the chromosomes of the original strain are fused or rearranged. Preferably, in some embodiments, the yeast is a MATalpha yeast strain derived from the EBY100a strain, such as Younger, D., Berger, S., Baker, D. & Klavins, E. High-throughput characterization of protein–protein interactions by reprogramming yeastmating. Described in Proc. Natl. Acad. Sci. 114, 12166–12171 (2017).

5. Yeast culture system

In some embodiments, yeast can be cultured using any yeast medium commonly used in the art. In some embodiments, the yeast medium is complete medium YPD medium.

In some embodiments, the yeast cells displaying the TCR library and the yeast cells displaying the pMHC are co-cultured for 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours or longer or any After the aforementioned values are taken as the range constituted by the endpoint or any value therein (preferably 22 hours), the yeast cell diploids are screened, and the TCR sequences of the yeast cell diploids are detected.

In some preferred embodiments, yeast cells displaying TCR and yeast cells displaying pMHC in logarithmic growth phase are used for co-culture.

6. Determination of Interaction Strength

Those skilled in the art can understand that any method known in the art can be used to determine the interaction strength between pMHC and TCR, such as the interaction strength can be characterized by measuring the KD value (equilibrium dissociation constant) between a specific TCR and a specific pMHC The strength of the specific TCR and specific pMHC can also be determined by flow cytometry. For example, a purified specific pMHC-coupled fluorophore can be used to co-incubate with yeast displaying a specific TCR, and then the fluorescence intensity of the fluorophore can be detected by flow cytometry to characterize the strength of the interaction between the pMHC and the TCR. Those skilled in the art can understand that, for example, the mean fluorescence intensity, the geometric mean fluorescence intensity or the median fluorescence intensity (more preferably, using the mean fluorescence intensity) in flow cytometry can be used to determine or calculate according to methods in the art The fluorescence intensity is used to characterize the interaction strength between the pMHC and TCR. Those skilled in the art can understand that, for example, methods such as conventional controls in the art (such as negative controls) can be used to determine or calculate the interaction strength, for example, the average fluorescence intensity of the negative control group can be used as the background level, and the average fluorescence intensity of the experimental group The average fluorescence intensity value obtained by subtracting the average fluorescence intensity of the negative control group from the intensity was taken as the average expression level.

The inventors have surprisingly found that the value of the fold change (fold change) determined using the method of the present invention has a positive correlation with the interaction strength measured using the above-mentioned conventional methods in the art. Thus, according to the method of the present invention, the interaction strength between the screened TCR and a specific pMHC can be calculated or determined through the fold change value. Those skilled in the art can understand that the interaction strength between the corresponding TCR and pMHC can be characterized by the value of the fold change.

In some embodiments, the positive correlation can be analyzed using Spearman's correlation coefficient. In statistics, Spearman's correlation coefficient is often denoted by the Greek letter ρ. It is a nonparametric measure of the dependence of two variables. It evaluates the correlation of two statistical variables using a monotonic equation. If there are no repeated values in the data, and when two variables are perfectly monotonically correlated, the Spearman correlation coefficient is +1 or -1. In the Spearman correlation coefficient, the absolute value of the coefficient represents the magnitude of the correlation. 0.7 and above represent high correlation, P value represents significance, and P value less than 0.05 represents statistical significance.

7. Calculation and determination of fold change

The calculation and determination of the fold change (fold change) used in the present invention include the following steps: (1) the number of each TCR sequence screened out in yeast diploid cells (ie the number of reads of a specific TCR sequence) divided by the measured The number of all TCR sequences (that is, the number of reads of all TCR sequences) to obtain a ratio value (ie, " _measured ratio"); (2) divide the _measured ratio by the _measured value of ratio for the negative control group (ie, " _{measured ratio control} ") , to obtain the fold change value of each TCR sequence in the library.

In some embodiments, before calculating the fold change (fold change) value, a correction can be made to _{the measured} ratio and _{the compared measured} ratio. In some embodiments, all TCR sequences measured include TCR sequences with more than one stop codon in the TCR region, and the correction method is to use one of the measured TCR sequences containing more than one stop codon in the TCR region. The number of TCR sequences (or the average number of TCR sequences with more than one stop codon in the TCR region) is divided by the measured number of all TCR sequences to obtain a ratio value (ie "ratio _{internal reference} "). Before dividing the _actual ratio _measurement by the ratio control measurement, divide the ratio _measurement and the ratio _{control measurement} by the ratio _{internal reference} to obtain the ratio _{measurement correction} and the ratio _{control measurement correction} respectively, and then divide the ratio _{measurement correction} by the ratio _{control measurement correction} to obtain the difference multiple ( fold change).

Example

This example mainly introduces a method for screening high-affinity TCRs, which does not require time-consuming and laborious protein purification operations, and can rapidly screen high-affinity TCRs.

Example 1 Displaying pMHC on the surface of yeast cells

The specific experimental steps are:

The antigen-MHC complex (pMHC) to be studied was synthesized using conventional methods in the art. In this example, SL9-HLA-A*0201 (SEQ ID NO:1) and TAX-HLA-A*0201 (SEQ ID NO: 2) Illustrate by example. The amino acid sequence of TAX is: LLFGYPVYV; the amino acid sequence of SL9 is SLYNTVATL.

When synthesizing SL9-HLA-A*0201 (SEQ ID NO:1) and TAX-HLA-A*0201 (SEQ ID NO:2) by conventional methods in the art, NheI and XhoI restriction endonucleases were respectively introduced at both ends Restriction sites.

SL9-HLA-A*0201 (SEQ ID NO:1), TAX-HLA-A*0201 (SEQ ID NO:2) were respectively synthesized using NheI (NEB, R3131L) and XhoI (NEB, R0146L) restriction enzymes , ysynalpha_DEST plasmid vector (SEQ ID NO: 3) digestion. According to the conditions shown in Table 1, enzyme digestion was carried out in a 37°C water bath for 3 hours.

Table 1 Conditions of enzyme digestion reaction

Use 1.5% DNA agarose gel (Biowest, 111860) (according to the mass (g) volume (ml) ratio of agarose and 1xTAE buffer (use 50XTAE (solarbio, T1060) to prepare, dilute with ddH ₂ O) is 1.5:100 preparation), under 120V voltage, electrophoresis was carried out for 40 minutes, and then the target fragments were cut out under ultraviolet light, and the corresponding fragments were recovered using the gel recovery reagent (Shanghai Bocai, K132) box. Then, according to the connection conditions shown in Table 2, the digested SL9-HLA-A*0201 (SEQ ID NO:1) and the digested TAX-HLA-A*0201 (SEQ ID NO:2) were respectively combined with The digested ysynalpha_DEST plasmid vector (SEQ ID NO: 3) was ligated. The ligation reaction was performed at room temperature for 20 minutes.

Table 2 Conditions of ligation reaction

The ligation product was transformed into Escherichia coli DH5α (Kangwei Century, CW0808H) using conventional methods (such as heat transfer or electroporation), and finally the vector of ysynalpha-pMHC (ie ysynalpha-SL9-HLA- A*0201 vector and ysynalpha-TAX-HLA-A*0201). Afterwards, the SL9 region in ysynalpha-SL9-HLA-A*0201 was mutated using conventional methods in the art, and the 3 bases corresponding to the third amino acid of the SL9 sequence were mutated into a stop codon, thereby obtaining ysynalpha-SL9 3*-HLA-A*0201 carrier. The above-mentioned ysynalpha-pMHC vector also contains a gene sequence encoding blue fluorescent protein.

The resulting vector sequence was verified to be correct by using Sanger sequencing.

After digesting the obtained ysynalpha-pMHC vector with PmeI enzyme (NEB, R0560L), the gel was cut and recovered to obtain vectors containing pMHC (ie TAX-HLA-A*0201, SL9-HLA-A*0201 or SL9 3*-HLA -A*0201) linearized fragment of the target fragment. The linearized fragment also includes the above-mentioned gene sequence encoding blue fluorescent protein.

Transform the fragment of the linearized ysynalpha-pMHC vector into EBY100 yeast strain by conventional lithium acetate transformation method or electroporation method to obtain yeast cells displaying pMHC, namely yeast cells expressing SL9-HLA-A*0201, expressing Yeast cells of TAX-HLA-A*0201 and yeast cells expressing SL9 3*-HLA-A*0201. The yeast cells are also integrated to express a blue fluorescent protein, which can be used for screening.

Example 2 Construction of TCR library

The 868TCR sequence (SEQ ID NO: 4) was synthesized using conventional methods in the field, and Nhei and XhoI restriction endonuclease sites were introduced at both ends of the synthesis.

Use NheI (NEB, R3131L) and XhoI (NEB, R0146L) restriction endonucleases to digest TCR and ysyna_DEST plasmid (SEQ ID NO: 5) according to the conditions shown in Table 1 above in a water bath (model) at 37°C for 3 Hour.

Use 1.5% DNA agarose gel (source and model: Biowest, 111860) (according to the mass (g) volume (ml) ratio of agarose and 1xTAE buffer (use 50XTAE (solarbio, T1060) to prepare, dilute with water) is 1.5: 100 for preparation), under the voltage of 120V, electrophoresis was carried out for 40min, and then the target fragments were cut out under the ultraviolet light, and the corresponding fragments were recovered with the Shanghai Boca Gel Recovery Reagent (K132) box. Then according to the connection conditions shown in Table 2, connect at room temperature for 20 minutes.

Use conventional methods (such as heat transfer or electroporation) to transform the ligation product into Escherichia coli DH5α (source and model: Kangwei Century, CW0808H), cultivate and amplify the transformed Escherichia coli according to conventional methods in the art, and The plasmid is extracted to finally obtain the ysyna-TCR vector for expression in an integrated form, that is, the ysyna-868TCR vector. The resulting vector sequence was verified to be correct by using Sanger sequencing. The plasmid vector serves as a template for subsequent preparation of the TCR library.

Using ysyna-868TCR as a template, according to the conventional primer design method in the field, design 2 pairs of primers to amplify the TCR sequence, and obtain 2 PCR products (fragment 1 and fragment 2, respectively). Fragment 1 and fragment 2 are both related to The ysyna_DEST plasmid vector has 15 bp homology arms, and Fragment 1 and Fragment 2 have 20 bp homology to each other. Among them, a pair of primers are NNK random mutation reverse primers covering the TCR CDR3 region. Except for the mutation site, the positions of the other primers are consistent with the template.

The primers were synthesized by conventional methods in the art and purified by PAGE. Amplify using 2X Phanta Max Master (Vazyme, P515-03) according to the PCR system shown in Table 3 and the PCR amplification conditions shown in Table 4.

Table 3 PCR system conditions

2x PCR buffer 25 Plasmid 10ng Primer F 1μl Primer R 1μl ddH2O Add to 50μl

Table 4 PCR reaction conditions

Use 1.5% DNA agarose gel (Biowest, 111860) (prepared according to the mass (g) volume (ml) ratio of agarose and 1xTAE buffer (use 50XTAE (solarbio, T1060) to prepare and dilute with water) 1.5:100) , under the voltage of 120V, electrophoresis was performed for 40 minutes, and then the target fragments were cut out under the ultraviolet light, and the corresponding fragments (ie fragment 1 and fragment 2) were recovered with the Shanghai Boca Gel Recovery Reagent (K132) box. The concentration was measured with Nanodrop (Thermo, NanoDrop 2000).

At the same time, the ysyna_DEST plasmid vector was digested with NHEI and XHOI under the digestion conditions described in Table 1, and then recovered using the Shanghai Boca Gel Recovery Reagent (K132) kit. The concentration was measured with Nanodrop (Thermo, NanoDrop 2000).

The seamless cloning kit Gibson kit (Beiyuntian, D7010M) was used for Gibson cloning, and the reaction system is shown in Table 5.

Table 5 Gibson cloning system

2x seamless Buffer 10μl Fragment 1 60ng Fragment 2 60ng carrier 20ng ddH₂O Add to 20μl

The reactions in Table 5 were carried out at a constant temperature of 50°C for 30 minutes. Carry out alcohol precipitation to reaction product, step is as follows;

1. Take out the mixture after the above PCR reaction, add 1/10 volume of 3M sodium acetate (3mol/L, PH=5.2, Solarbio, A1070), and mix well so that the final concentration of sodium acetate is 0.3mol/L;

2. Add 2 times the volume of ethanol (McLean, E809056) of the total volume of the mixture in the above step 1 (pre-cooled with ice before adding), mix well, and place it at -20°C for 15 to 30 minutes;

3. Centrifuge at 12,000g for 10 minutes, carefully remove the supernatant, and use a pipette gun or vacuum pump to suck off all the droplets on the tube wall;

4. Add 700μl of 70% ethanol (prepared with water and absolute ethanol), centrifuge at 12000g for 2 minutes, and use a pipette gun or vacuum pump to suck all the droplets on the tube wall;

5. Open the cap of the centrifuge tube at room temperature and place it on the laboratory table to evaporate the remaining liquid to dryness;

6. Add 30 μl of ddH ₂ O to dissolve the DNA precipitate in the centrifuge tube, and measure the DNA concentration with Nanodrop (Thermo, NanoDrop2000).

Using conventional methods in this field, the product after alcohol precipitation was electrotransferred into TOP10 electroporation-competent (Shanghai Weidi, DE1010), and electroporation was performed according to the instructions. The specific steps are as follows:

1. Take the 0.1cm electric shock cup and cup lid out of the storage solution and place them upside down on clean absorbent paper for 5 minutes. After draining the water, place it upright for 5 minutes to allow the ethanol to fully evaporate. Insert it into ice immediately after the ethanol has evaporated. The top of the electrode cup is 0.5cm away from the ice surface so that the lid can be easily covered, and the ice is allowed to stand for 5 minutes to fully cool down.

2. Take the TOP10 electrotransfer competent (Shanghai Weidi, DE1010) cells stored at -80°C and insert them into ice for 5 minutes, wait for them to melt, add the target DNA (plasmid or ligation product) and mix gently by hand at the bottom of the EP tube. Avoid creating air bubbles and immediately plunge into ice.

The DNA concentration does not exceed 100ng/μl, and the volume does not exceed 5μl/50μl competent.

3. Use a 200 μl pipette tip (cut off the 0.5cm pipette tip with a knife) to quickly move the competent-DNA mixture into the electric shock cup to avoid the generation of air bubbles, and cover the cup.

4. Start the electroporation instrument, set the parameters: C=25μF, PC=200Ω, V=1.8kV (BioRad electroporation instrument), quickly put the electroporation cup into the electroporation tank, and quickly insert it into the ice after electroporation.

After 5.2 minutes, take out the electric shock cup from the ice, put it at room temperature, add 1ml of sterile S.O.C. 50ml conical centrifuge tube, etc.), add S.O.C. medium to the centrifuge tube to 10ml. Inclined at 45 degrees, placed on a shaker, recovered at 37°C, 225rpm for 60 minutes.

6. Collect the bacteria by centrifuging at 5000rpm for one minute, resuspend and smear all the bacteria on 2-5 15cm S.O.C plates containing corresponding antibiotics. Place the plate upside down and incubate overnight in a 37°C incubator for 13-17 hours.

After obtaining the plate, scrape and collect all the Escherichia coli with a scraper (source and model: Becelide, BL6013039) into a 50ml centrifuge tube for subsequent plasmid extraction.

Centrifuge the bacteria at 3000 rpm for 15 minutes to collect the bacteria, and use Tiangen's plasmid extraction kit (source and model: Tiangen, DP117) for plasmid extraction. After extraction, the plasmid vector containing the TCR mutation library was detected using Nanodrop.

Use PmeI (neb, R0560L) to digest the extracted plasmid vector containing the TCR mutation library, and digest the fragments including ARS314, TCR, TRP and fluorescent protein; recover the fragments from the gel;

The recovered TCR library is transformed into EBY100(MATa) yeast by conventional lithium acetate transformation method or electroporation method. EBY100(MATa) yeast integrates and expresses a red fluorescent protein at the same time, which can be detected in subsequent flow cytometry experiments. fluorescence. Screen single clones on SC-TRP plates; scrape all yeast colonies with a scraper, centrifuge, and resuspend in SC-TRP medium; cryopreserve as yeast cells expressing or displaying TCR libraries.

Formulation of table 6 SC-TRP medium

YNB (amino acid free) (BD, 291940) 6.7g Sc-trp DO (Clontech, 630413) 0.74g Glucose (Sigma, G8270) 20g ddH₂O Add water to 1L Adjust pH value Adjust the pH to 5.8 with aqueous NaOH

Example 3 TCR Screening

The yeast cells expressing the TCR library and the yeast cells expressing the pMHC sequence were cultured overnight in YPD medium with shaking (220 rpm), and the culture temperature was 30°C.

The formula of table 7 YPD medium

Peptone (BD, 211677) 10g Glucose (Sigma, G8270) 10g Yeast extract (BD, 212750) 5g Tryptophan (sigma, T0254) 0.16g

On the second day, use a spectrophotometer (Youke, 723N visible spectrophotometer) to transfer from OD=0.1, cultivate for about 4-5 hours, and the yeast growth reaches the exponential phase (OD=0.4), and the yeast expressing the TCR library and Yeast expressing pMHC was put into 96-well V-shaped deep-well plate for co-cultivation, the total culture volume of each well was 1ml, the OD value of the yeast expressing the TCR library in each well was 0.0125, and the OD value of the yeast expressing the antigen library in each well was The value is 0.0375.

The yeast mating experiment was carried out in a shaker set at 30°C and 220RPM, mixed for 22 hours, and the expression library yeast cells were added according to the size of the constructed TCR mutation library (according to the amount of 100 times the library capacity determined above to achieve Coverage, for example, 1OD is equal to 10 ⁷ /ml of yeast cells, if the storage capacity is 1x10 ⁴ , add 0.1OD of yeast in total, and make 10 replicate wells) to determine how many replicate wells to do the mating experiment simultaneously.

Diploid yeast cells formed mediated by TCR-pMHC were obtained. Among them, the irrelevant peptide TAX-HLA-A*0201 (in which the 8th position of TAX introduces a stop codon) was used as a negative control, and after the subsequent next-generation sequencing, the difference between the experimental group and the control group was used as the threshold, and Calibrate the sequencing data.

After mating, SC-Lys-Leu medium can be used to screen for diploids since only diploids can grow in SC-Lys-Leu medium. Take 600 μl of the strain and wash it twice with SC-Lys-Leu medium; transfer to SC-Lys-Leu medium and culture for 24 hours, screen for diploids, or use flow cytometry to sort out double fluorescence (mcherry and mTurquoise) target group.

Table 8 SC-Lys-Leu medium

Embodiment 4 Determines the TCR sequence in the yeast cell diploid

After culturing for 24 hours, the diploid yeast cells were centrifuged at 3000 rpm for 5 minutes, and the genome of the diploid yeast cells was extracted by bead milling method, which is a conventional method in the art;

According to the conventional methods in the art, design forward primer and reverse primer to specifically amplify the CDR3 region of TCR in the genome of diploid yeast cells, PCR amplification system and conditions are as shown in Table 9 and Table 10, Table 9 PCR amplification system

Table 10 PCR amplification conditions

Utilize the zymoclean kit (Zymo, D4008) to recover the above PCR product, resuspend it, and use it as the template for the second round of PCR; carry out the second round of PCR amplification according to the conditions in Table 11 and Table 12 (primers at the i5 end are AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGC AGCGTC, The primer at the i7 end is CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGGCTC GG); the sequenced barcode sequence was introduced. Where XXXXXXXX is the barcode sequence used to mark and distinguish each sample.

Table 11 PCR amplification system

Table 12 PCR amplification conditions

Use Qubit to detect the concentration of double-stranded DNA, and mix and sequence the fragments in equal amounts;

After obtaining the next-generation sequencing data, divide the measured number of specific TCR sequences (ie, the number of reads of specific TCR sequences) by the measured number of all TCR sequences (ie, the number of reads of all TCR sequences) to obtain a ratio value (ie, "ratio _measured "). The _measured ratio was divided by the _measured ratio for the negative control group (ie, "ratio _{control measured} ") to obtain the fold change value for each TCR sequence in the library. The negative control group can be any peptide known in the art that has no interaction with the TCR in the TCR library. Negative control groups as used in Example 5 were SL9 3*-HLA-A*0201 and TAX-HLA-A*0201.

The top 10%, 15%, 20%, 25%, and 30% of the TCR sequences with the highest fold change values relative to the TCR library storage capacity can be used as TCR sequences that can interact with specific pMHC.

The experiment was done with 3-4 technical duplicate holes each time, and repeated twice independently, and the results were analyzed separately in each independent experiment. Compared with the control group, the fold change (fold change)>1 and the P value in at least one independent experiment< 0.05 is the screening threshold.

Verification of embodiment 5 screening results

In this example, several mutants of 868TCR with a mutation at the αCDR3 position were constructed, namely GADDYALN, GAHDYSLN, GSHDYALN, GAHDYALV, GAHDYYLN, SAHDYALN, GAYDYALN, GAHDYILN, TNSGYALN, GAHDYAYN, GAHDYAQN, GLHDYALN, GACDYALN, LAHDYALN, GAHDY* LN. Yeast cells expressing the above-mentioned library consisting of 868TCRα CDR3 mutants were obtained by the method described in Example 1. The yeast cells displaying the library were co-incubated with SL9-HLA-A*0201, TAX-HLA-A*0201(NC) and SL9 3*-HLA-A*0201(NC) respectively, according to the method of the above examples, TCR sequences that can bind to SL9-HLA-A*0201 were screened by next-generation sequencing.

The screening results are shown in Figure 2, and the αCDR3 sequence of the TCR that can bind to SL9-HLA-A*0201 is shown in Figure 2, where blue represents the _measured ratio of the αCDR3 sequence of the TCR that binds to SL9-HLA-A*0201 The orange represents the _measured average value of the ratio of the αCDR3 sequence of the TCR bound by TAX-HLA-A*0201(NC) and SL9 3*-HLA-A*0201(NC).

In order to further illustrate the sensitivity and specificity of the present invention, the inventors verified the TCR sequences screened in the examples. Those skilled in the art can understand that those skilled in the art can use other conventional methods in the art to verify the binding ability of the screened TCR sequence to specific p-MHC.

After obtaining the TCR sequence obtained by the above screening, according to the cloning and transformation methods in the above examples, construct a yeast cell expressing a specific TCR, and then culture the yeast cell monoclonal in YPD medium overnight (shaking table speed 220rpm, temperature: 30°C), start culturing from the concentration of OD=0.1 on the next day, collect ^1X106 yeast cells in 1.5ml EP tube after culturing for 4 hours, centrifuge at 3000rpm for 5min, remove the supernatant, add 1ml PBS (Hyclone/Hyclone , SH30256.01) + 1% BSA (Amresco, A0332-100g) medium to resuspend the cells, remove the residual medium (centrifuge at 3000rpm for 5min, discard the supernatant), and repeat once.

Afterwards, it was resuspended with 50 μl of PBS+1 vol% FBS, and stained with the tetrameric antibody of SL9-HLA-A*0201-PE (1:200, titer used, MBL, TS-M027-1). After staining at room temperature for 30 minutes in the dark, add 1ml of PBS (Hyclone/ sea clone, SH30256.01) + 1% BSA (Amresco, A0332-100g) medium to resuspend the cells, centrifuge at 3000rpm for 5 minutes, discard the supernatant, repeat once , and resuspend the cells in the medium adding 1 ml of PBS (Hyclone/Hyclone, SH30256.01) + 1% BSA (Amresco, A0332-100g).

Use the BD LSR Fortessa flow analyzer to detect whether the yeast cells expressing the corresponding screened TCR sequence can bind to the tetrameric antibody of SL9-HLA-A*0201-PE, and calculate the average of the fluorophore PE according to the flow cytometry results The higher the fluorescence intensity, the stronger the binding force between the antigen and the TCR mutant.

Figure 3 shows the results of flow cytometry, and it was found that the screened TCRs (ie, P<0.05) could all have a good combination with specific pMHC. It can also be seen that the fold change in the screening results is positively correlated with the average fluorescence intensity in the verification experiment.

The result of Example 2 shows that the screening result of the method of the present invention has high sensitivity and good specificity.

Figure 4 is the positive correlation between the interaction strength expressed as mean fluorescence intensity (MFI) and the interaction strength expressed as fold change value calculated using Spearman's correlation coefficient.

In statistics, Spearman's correlation coefficient is often denoted by the Greek letter ρ. It is a nonparametric measure of the dependence of two variables. It evaluates the correlation of two statistical variables using a monotonic equation. If there are no repeated values in the data, and when two variables are perfectly monotonically correlated, the Spearman correlation coefficient is +1 or -1. In the Spearman correlation coefficient, the absolute value of the coefficient represents the magnitude of the correlation. 0.7 and above represent high correlation, P value represents significance, and P value less than 0.05 represents statistical significance.

In the results of Figure 4, ρ=0.809, P=1.48×10 ^-4 , indicating that the fold change value determined using the method of the present invention is different from that in the prior art using purified pMHC and yeast cells displaying TCR. The mean fluorescence intensity (MFI) measured by flow cytometry, which can represent the interaction strength, is positively correlated, and the positive correlation is statistically significant. Thus, the method of the present invention can be used to determine the interaction strength of the screened TCR with a specific antigen.

The present invention has been described through the above-mentioned embodiments, but it should be understood that the above-mentioned embodiments are only for the purpose of illustration and description, and are not intended to limit the present invention to the scope of the described embodiments. For those skilled in the art, the present invention may have various modifications and changes, including combination and recombination of technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims (7)

1. A method for screening and determining the TCR interacting with a specific antigen and its interaction strength with a specific antigen, comprising: (a) displaying the specific antigen-MHC complex (pMHC) and the TCR library on the surface of yeast of different mating types; (b) cocultivating the yeasts of different mating types; (c) screening out yeast cell diploids, and determining the TCR sequence in the yeast cell diploids; (d) calculating the fold change value of each TCR sequence determined; From this, the TCR interacting with the specific antigen and its interaction strength with the specific antigen are determined; Preferably, the yeast cell displaying the TCR expresses the TCR in an integrated form; Preferably, the pMHC-displaying yeast cell expresses pMHC in an integrated form. 2. The method of claim 1, wherein the mating-deficient yeast cell is a yeast cell in which the Sag1 gene has been deleted. 3. The method according to claims 1-2, wherein the yeast cell is Saccharomyces cerevisiae, preferably the Saccharomyces cerevisiae is EBY100 strain or a genetically modified strain of EBY100 strain. 4. The method according to claims 1-3, wherein determining the sequences of the TCR and pMHC of the diploid yeast cells is performed using a next-generation sequencing method. 5. The TCR sequence screened according to the method of claims 1-4. 6. A co-culture comprising yeast cells displaying a specific antigen-MHC complex (pMHC) and yeast cells displaying multiple TCRs, wherein the yeast cells displaying the TCRs and the yeast cells displaying the pMHC belong to different matings type; wherein the yeast cell is mating-deficient; Preferably, the yeast cell displaying TCR expresses TCR in an integrated form; Preferably, the yeast cell displaying pMHC expresses pMHC in an integrated form. 7. The co-culture according to claim 6 for use in screening TCR sequences capable of binding to a specific antigen.

Images