CN115792238A - Method for screening and determining TCR interacting with specific antigen and interaction strength of TCR interacting with specific antigen - Google Patents

Abstract

The invention relates to a method for screening and determining TCR interacted with a specific antigen and interaction strength thereof, which is implemented by utilizing a yeast display and yeast mating system to screen and determine TCR interacted with the specific antigen and interaction strength thereof. And calculating the value of the fold difference (fold change) of each TCR sequence screened and determined, thereby determining the TCR interacting with the specific antigen and the strength of the interaction with the specific antigen.

Description

Method for screening and determining TCR interacting with specific antigen and interaction strength of TCR interacting with specific antigen

Technical Field

The invention relates to a method for screening and determining TCR interacted with a specific antigen and interaction strength thereof, which is implemented by utilizing a yeast display and yeast mating system to screen and determine TCR interacted with the specific antigen and interaction strength thereof. And calculating the fold difference (fold change) value of each selected and determined TCR sequence to determine the TCR interacting with the specific antigen and the strength of interaction with the specific antigen.

Background

The TCR (T cell receptor) is a specific T cell receptor on the surface of a T cell, is a molecule capable of recognizing an internal/external antigen, can achieve killing and clearing of a specific damaged cell, can mediate an immune response, and plays an important role in immune response and immune regulation, and the receptor is also a molecular structure of a T cell specific recognition and binding antigen peptide-MHC molecule, and is generally present on the surface of a T cell in a complex form with a CD3 molecule. In the process of T cell recognition of antigen, the receptor TCR and pMHC (antigen molecule polypeptide or peptide-MHC) presented by Major Histocompatibility Complex (MHC) are closely bound, so that T cells are activated, i.e., after being stimulated by antigen, the T cells are differentiated, proliferated, converted into activated T cells, and an immune effect of direct killing of antigen and synergistic killing of cytokines released by the activated T cells is generated. The tumor cell immunotherapy (TCR-T) is a therapeutic method that uses T cells specifically bound to a target tumor antigen to kill and eliminate tumor cells.

The TCR recognizes pMHC to activate immune response, which is important for maintaining the health of human body, and the in vitro evolved high-affinity TCR can improve the anti-tumor capability of the modified T cells. Among them, the molecule that can represent the most characteristic of T cell response is the hypervariable region CDR3 (third CDRs) of TCR, which is the main antigen binding site of TCR, and the study of the CDR3 library of TCR will provide the basis for the comprehensive analysis of the physiological and pathological characteristics of T cells.

Currently, methods for screening high affinity TCRs are mainly developed by means of phage display and yeast display.

The nature of Phage Display Technology (Phage Display Technology) is a screening technique. Different exogenous genes are respectively inserted into a phage vector, and exogenous proteins can be shown on the surface of the phage along with the passage of the phage to form a phage library.

The yeast display technology is a eukaryotic protein expression system, which utilizes a yeast cell surface display system (with complete protein post-translational modification and secretion mechanisms) to fix and display heterologous eukaryotic proteins on the surface of yeast cells, and has been widely applied in the fields of protein library screening, protein directed evolution, high-affinity antibody sorting, antigen/antibody library construction, affinity maturation, vaccine production, immunobiocatalysis, biosensors and the like. The current yeast display technology mostly takes pMHC in the form of tetramer protein as a research object, and the sequence of TCR is screened.

For example, kranz et al, research group includes Holler et al, 2000; (Holler, P.D., holman, P.O., shusta, E.V., O' Herrin, S., wittrup, K.D., and Kranz, D.M. (2000). In view evaluation of a T cell receiver with high accuracy for peptide/MHC.Proc.Natl. Acad.Sci.97, 5387-5392;) Richman et al, 2006; (Richman, S.A., healan, S.J., weber, K.S., donermeyer, D.L., dossett, M.L., greenberg, P.D., allen, P.M., and Kranz, D.M. (2006) Development of a novel protocol for engineering high-accuracy proteins by year display system protein Eng.Des.Sel.19, 255-264;) Shusta et al, 2000; (Shusta, E.V., holler, P.D., kieke, M.C., kranz, D.M., and Wittrup, K.D. (2000). Directed evolution of a stable Yeast for T-Cell Receptor Engineering. Nat.Biotechnol.18, 754-759;) Smith et al 2015 (Smith, S.N., harris, D.T., and Kranz, D.M. (2015) T Cell Receptor Engineering and Analysis Using the Yeast Display platform in Yeast Surface Display, (Humana s, new York, N.Y.), 95-141 TCR (TCR) was successfully constructed by linking the V region of the TCR to the Surface of the Yeast through a single-chain mutation, and randomly constructing 10 in vitro mutant cells ⁵ The technology of (1) screening a high affinity TCR binding to a target antigen by flow-screeningThe cloning method of the mode expression TCR mutation library and the traditional enzyme digestion connection. Furthermore, chinese researchers such as professor of huangjun et al of The guangdong institute of medicine successfully achieved yeast display of scTCR (Shao et al, 2010) (Shao, h.w., guo, h.p., huangng, x.l., zhang, w.f., and Huang, s.l. (2010) The construction and year surface display of single chain T cell receiver (scTCR) j.guangdong pharm.

This artificial banking approach breaks through the limitations of natural T cell bank screening and increases the efficiency of screening while maintaining the antigenic specificity of the TCR, but all use sctcrs expressed episomally in plasmid form.

The existing technology for screening the TCR sequences has respective problems, for example, the screening of TCR by constructing a cell mutation library of the TCR sequences is limited by the transfection efficiency of cells, the obtained cell mutation library has limited storage capacity, and the cost for culturing the cells is high; displaying a TCR mutant library to be studied on the surface of M13 phage by phage display technology, screening with MHC proteins, but not all TCR sequences can be expressed well in phage since the protein synthesis and folding mechanisms of phage are different from those of eukaryotes, as described in Li et al, 2005 (Li, y., moysey, r., molloy, p.e., vuidepot, a. -l., mahon, T., baston, e., dunn, s., liky, n., jacob, j., jakob sen, b.k., et al (2005). Directed evolution of human T-cell receptors with microcomolar refines by phase display.nat. Biotechnol.23, 349-354); in addition, existing screening methods using yeast display technology also rely on purified MHC proteins (David m. Kranz group), which is time consuming and laborious; isolation of T cells bound to MHC tetramers by MHC tetramer further screening methods for sequencing of TCR sequences identify TCRs that are relatively low affinity TCRs and, in addition, the screening methods necessitate MHC tetramer protein purification, which requires protein purification techniques that are time consuming, labor intensive, expensive and commercially impractical.

The experiment of sezania in patent ZL 202011473454.2, 2020, describes the use of a modified yeast mating system to study and screen antigens that bind to specific TCRs, enabling the study of TCR-antigen interactions without protein purification, and screening antigens that bind to specific TCRs. The method screens for an antigen of interest that binds to a particular TCR by displaying one TCR on the surface of the yeast and an antigen mutation repertoire in another yeast. However, this patent application is only capable of screening for an antigen of interest that binds to a particular TCR, and does not disclose whether the system can be used to screen for TCRs that bind to a particular antigen, nor does it disclose or suggest how to determine the strength of the TCR interaction with pMHC.

In the process of constructing the pMHC mutation library, the transformed pMHC library receiving vector is utilized to carry out flux construction by a Golden Gate cloning method. Still have the technical problem that the construction process is loaded down with trivial details.

Therefore, how to screen for TCR binding to a specific antigen with low cost and high specificity and simultaneously determine the strength of interaction of the screened TCR sequence with a specific antigen has been an unsolved problem in the art.

Disclosure of Invention

In view of the above-mentioned problems in the prior art, the present invention provides a method for randomly mutating the CDR3 region of a TCR and screening for high affinity TCR sequences. According to the method, TCR and pMHC proteins are respectively displayed on the surfaces of yeast with different mating types by utilizing a yeast display and yeast mating system, then yeast mating experiments are carried out on yeast with different mating types integrating TCR and pMHC, and then a high-affinity TCR sequence is screened through a diploid signal formed by interaction of TCR and pMHC in the yeast mating system. And meanwhile, determining the interaction strength of the screened TCR and the specific antigen by calculating the fold difference (fold change) value of each determined TCR sequence.

The method of the present invention, which utilizes a yeast display and yeast mating system, can specifically screen one or more TCRs with high affinity for a specific antigen (e.g., a tumor antigen), and can simultaneously determine the strength of interaction between one or more TCRs and the specific antigen. The TCR screened by the method can be applied to TCR-T and other cell treatments.

In one aspect, the invention provides a method of screening for and determining the strength of TCR interaction with a particular antigen and its interaction with a particular antigen, comprising:

(a) Displaying the specific antigen-MHC complex (pMHC) and the TCR library on the surfaces of different mating types of yeast respectively;

(b) Co-culturing the different mating types of yeast;

(c) Screening out a yeast cell diploid, and determining a TCR sequence in the yeast cell diploid;

(d) Calculating a fold difference (fold change) value for each of said determined TCR sequences;

the TCR that interacts with the particular antigen and its strength of interaction with the particular antigen are thus determined.

Preferably, in some embodiments, the yeast cells displaying the TCR express the TCR in an integrated form.

Preferably, in some embodiments, the yeast cells displaying pMHC express pMHC in an integrated form.

It will be appreciated by those skilled in the art that mating-deficient yeast cells can be obtained by any method of techniques conventional in the art. In some embodiments, the mating-deficient yeast cell is a yeast cell in which the Sag1 gene is deleted.

In some embodiments, the yeast cell is saccharomyces cerevisiae, preferably the saccharomyces cerevisiae is EBY100 strain or a genetically engineered strain of EBY100 strain (as described in young, D., berger, s., baker, D. & Klavins, e.high-throughput characterization of protein-protein interactions by reproducing the obtained product of the present invention. Ac. Ack. Sci.114,12166-12171 (2017)).

In some embodiments, both the MHC and the TCR are of human origin.

One skilled in the art will appreciate that the TCR sequence in a yeast cell diploid can be determined by any means conventional in the art, such as by first-generation sequencing (e.g., sanger sequencing), second-generation sequencing, third-generation sequencing, and the like. Preferably, in some embodiments, the TCR sequences in yeast cell diploids are determined using a method of next generation sequencing.

One skilled in the art will also appreciate that TCR libraries can be constructed using any means conventional in the art (e.g., construction using methods of gene synthesis, using random mutation primers, etc.). Preferably, in some embodiments, the TCR library can be constructed in a PCR amplification format using randomly mutated primers.

Preferably, in some embodiments, the difference between TCR sequences in a TCR library is a difference in CDR3 sequences.

In some embodiments, a TCR library is constructed using the cloning method of Gibson Assembly. In some embodiments, cloning methods using a Gibson Assembly are as shown in the examples herein.

In a further aspect, the invention also provides the use of a selected TCR in the treatment of TCR-T cells.

Drawings

FIG. 1: schematic strategy for construction of TCR libraries

FIG. 2: a graph showing fold difference (fold change) values for different TCRs from a particular pMHC in a TCR library;

FIG. 3: a graph demonstrating the flow assay results in the experiment is shown, representing the strength of the interaction between TCR and pMHC (expressed as Mean Fluorescence Intensity (MFI)).

FIG. 4 is a schematic view of: the positive correlation between the interaction intensity expressed as Mean Fluorescence Intensity (MFI) and the interaction intensity expressed as fold difference (fold change) value calculated using the spearman correlation coefficient.

Detailed Description

The terms referred to herein are explained below, but the present invention is not limited by the following explanation.

1. Definition of

The practice of the present invention will employ, unless otherwise specifically indicated, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, cell biology, stem cell protocols, cell culture and transgenic biology, which are within the skill of the art, many of which are described below for purposes of illustration. Such techniques are fully described in the literature. See, e.g., sambrook, et al, molecular Cloning: A Laboratory Manual (3rd edition, 2001); sambrook, et al, molecular Cloning: A Laboratory Manual (2nd edition, 1989); maniatis et al, molecular Cloning: A Laboratory Manual (1982); ausubel et al, current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); a Complex of Methods from Current Protocols in Molecular Biology, greene pub. Associates and Wiley-Interscience; glover, DNA Cloning: A Practical Approach, vol.I & II (IRL Press, oxford, 1985); anand, techniques for the Analysis of Complex Genomes, (Academic Press, new York, 1992); guthrie and Fink, guide to Yeast Genetics and Molecular Biology (Academic Press, new York, 1991); oligonucleotide Synthesis (n.gait, ed., 1984); nucleic Acid Hybridization (B.Hames & S.Higgins, eds., 1985); transcription and transformation (b.hames & s.higgins, eds., 1984); animal Cell Culture (r. Freshney, ed., 1986); perbal, A Practical Guide to Molecular Cloning (1984); fire et al, RNA Interference Technology From Basic Science to Drug Development (Cambridge University Press, cambridge, 2005); schepers, RNA Interference in Practice (Wiley-VCH, 2005); engelke, RNA Interference (RNAi) The Nuts & Bolts of siRNA Technology (DNA Press, 2003); gott, RNA Interference, editing, and Modification Methods and Protocols (Methods in Molecular Biology; human Press, totowa, NJ, 2004); sohail, gene Silencing by RNA Interference, technology and Application (CRC, 2004); clarke and Sanseau, microRNA: biology, function & Expression (Nuts & Bolts series; DNA Press, 2006); immobilized Cells And Enzymes (IRL Press, 1986); the threading, methods In Enzymology (Academic Press, inc., N.Y.); gene Transfer Vectors For Mammarian Cells (J.H.Miller and M.P.Calos eds.,1987, cold Spring Harbor Laboratory); harlow and Lane, antibodies, (Cold Spring Harbor Laboratory Press, cold Spring Harbor, N.Y., 1998); immunochemical Methods In Cell And Molecular Biology (Mayer And Walker, eds., academic Press, london, 1987); handbook Of Experimental Immunology, volumes I-IV (D.M.Weir and C.Blackwell, eds., 1986); riott, essential Immunology,6th Edition, (Blackwell Scientific Publications, oxford, 1988); embryonic Stem Cells, methods and Protocols (Methods in Molecular Biology) (Kurstad Turksen, ed., 2002); embryonic Stem Cell Protocols Volume I: isolation and Characterization (Methods in Molecular Biology) (Kurstad Turksen, ed., 2006); embryonic Stem Cell Protocols Volume II Differentiation Models (Methods in Molecular Biology) (Kurstad Turksen, ed., 2006); human Embryonic Stem Cell Protocols (Methods in Molecular Biology) (Kursad Turksen Ed., 2006); mesenchymal Stem Cells, methods and Protocols (Methods in Molecular Biology) (Darwin J.Prockop, donald G.Phonney, and Bruce A.Bunnell Eds., 2008); hematotopic Stem Cell Protocols (Methods in Molecular Medicine) (Christopher A. Klug, and Craig T. Jordan Eds., 2001); hematographic Stem Cell Protocols (Methods in Molecular Biology) (Kevin D. Bunting Ed., 2008) Neural Stem Cells: methods and Protocols (Methods in Molecular Biology) (Leslie P. Weiner Ed., 2008); hogan et ah, methods of Manipulating the Mouse Embyo (2nd edition, 1994); nagy et al, methods of Manipulating The Mouse Embryo (3rd edition, 2002), and The Zebraf book. A guide for The laboratory use of Zebraf book (Danio reio), 4th Ed., (Univ. Of Oregon Press, eugene, OR, 2000).

All publications, patents, and patent applications cited herein are incorporated by reference in their entirety.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are defined below.

As used herein, the term "about" or "approximately" refers to a quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length that varies by up to 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% as compared to a reference quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length. In one embodiment, the term "about" or "approximately" refers to a quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length that surrounds a reference quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length by 15%, ± 10%, ± 9%, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2%, or ± 1%.

As used herein, the term "substantially" refers to an amount, level, value, amount, frequency, percentage, dimension, size, amount, weight, or length that is about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more as compared to a reference amount, level, value, amount, frequency, percentage, dimension, size, amount, weight, or length. In one embodiment, the term "substantially the same" refers to a range of numbers, levels, values, amounts, frequencies, percentages, dimensions, sizes, amounts, weights, or lengths that are about the same as a reference number, level, value, amount, weight, or length.

As used herein, the term "substantially free," when used to describe a composition, e.g., a population of cells or a culture medium, refers to a composition that is free of a specified substance, e.g., 95% free, 96% free, 97% free, 98% free, 99% free of the specified substance, or is undetectable as measured by conventional means. Similar meanings may apply to the term "absent" when referring to the absence of a particular substance or component of a composition.

Throughout this specification, unless the context requires otherwise, the terms "comprise", "comprising" and "have" should be interpreted as implying the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. In particular embodiments, the terms "comprising," "including," "containing," and "having" are used synonymously.

"consisting of 8230; \8230; composition" means any including but not limited to after the phrase "consisting of 8230; \8230, composition". Thus, the phrase "consisting of 8230' \8230%, … composition" is intended to indicate that the listed elements are required or mandatory, and that no other elements may be present.

"consisting essentially of 8230% \8230%," consists of "is intended to include any elements listed after the phrase" consisting essentially of 8230\8230%, \8230, consist of "and is limited to other elements that do not interfere with or contribute to the activities or actions specified in the disclosure of the listed elements. Thus, the phrase "consisting essentially of 8230, 8230composition means that the listed elements are required or mandatory, but no other elements are optional and may or may not be present depending on whether they affect the activity or action of the listed elements.

Reference throughout this specification to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "an embodiment," "another embodiment," or "further embodiment" or combinations thereof means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

By "adherent" is meant that the cells are attached to a container, e.g., the cells are attached to a sterile plastic (or plastic-coated) cell culture dish or flask, in the presence of an appropriate culture medium. Certain classes of cells cannot be maintained or do not grow in culture unless they adhere to the cell culture vessel. Certain classes of cells ("non-adherent cells") are maintained and/or proliferate in culture without the need for adherence.

"culture" or "cell culture" refers to the maintenance, growth, and/or differentiation of cells in an in vitro environment. "cell culture medium", "supplement", and "medium supplement" refer to the nutritional composition of a cultured cell culture.

"culture" or "cell culture" refers to a substance to be cultured, such as a cell, and/or a medium in which a substance to be cultured, such as a cell, is present.

"culture" refers to the maintenance, propagation (growth) and/or differentiation of cells outside of the tissue or body, e.g., in a sterile plastic (or coated plastic) cell culture dish or flask. "culturing" can utilize the culture medium as a source of nutrients, hormones, and/or other factors that help propagate and/or maintain the cells.

"ingredient" refers to any compound or other material, whether chemical or biological in origin, that can be used in a cell culture medium to maintain and/or promote cell growth and/or differentiation. The terms "component," "nutrient," and "ingredient" are used interchangeably. Conventional ingredients for cell culture media may include, but are not limited to, amino acids, salts, metals, sugars, lipids, nucleic acids, hormones, vitamins, fatty acids, proteins, and the like. Other components to facilitate and/or maintain ex vivo or in vitro cell culture can be selected by one of ordinary skill in the art as needed for the desired effect.

By "isolated" is meant that the composition or material is separated from its natural environment and collected, e.g., the separation of individual cells or cell cultures from tissues or organisms. In one aspect, the cell population or composition is substantially free of cells and materials with which it can be associated in nature. By "isolated" or "purified" or "substantially pure" with respect to a target cell population is meant a cell population that is at least about 50%, at least about 75%, at least about 85%, at least about 90%, and in particular embodiments, at least about 95% pure with respect to the target cells that make up the total cell population. The purity of the cell population or composition can be assessed by appropriate methods well known in the art. For example, a substantially pure totipotent cell population refers to a cell population that is at least about 50%, at least about 75%, at least about 85%, at least about 90%, and in particular embodiments, at least about 95%, and in certain embodiments, about 98% pure with respect to totipotent cells that make up the total cell population.

"passaging" refers to the act of subdividing and plating cells onto multiple cell culture surfaces or containers when the cells have proliferated to a desired extent. In some embodiments, "passaging" refers to subdividing, diluting, and plating cells. When cells are passaged from a primary culture surface or vessel to a subsequent set of surfaces or vessels, the subsequent culture may be referred to herein as "subculture" or "first passage" or the like. Each subdivision and plating into a new culture vessel is considered a passage.

"plating" refers to placing one or more cells within a culture vessel such that the cells adhere to and spread over the cell culture vessel.

"proliferation" refers to the property of a cell dividing into two substantially equivalent cells or an increased number of cell populations (e.g., to replicate).

By "propagating" or "expanding" is meant growing (e.g., replicating via cell proliferation) cells outside of a tissue or organism, e.g., in a sterile container such as a plastic (or coated plastic) cell culture dish or flask.

The term "vector" or "expression vector" as used herein refers to a vector comprising a nucleic acid sequence encoding at least a portion of a gene product capable of transcription. In some cases, the RNA molecule is then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences required for transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences which control transcription and translation, vectors and expression vectors may contain nucleic acid sequences which also serve other functions and are described below.

The term "gene" as used herein is defined as a coding unit for a functional protein, polypeptide or peptide. It is understood that the functional terms include genomic sequences, cDNA sequences, and small engineered gene segments that express or are suitable for expressing proteins, polypeptides, domains, peptides, fusion proteins, and mutants.

The term "polynucleotide" or "nucleic acid" as used herein is defined as a chain of nucleotides. In addition, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein may be used interchangeably. Nucleic acids are polynucleotides, which can be hydrolyzed to monomeric "nucleotides". Monomeric nucleotides and hydrolysis to nucleosides.

The term "polypeptide" as used herein is defined as a chain of amino acid residues, which typically has a defined sequence. The term polypeptide as used herein is used interchangeably with the term protein. The polypeptides and peptides of the present invention may be modified by various amino acid deletions, insertions and/or substitutions. In particular embodiments, the modified polypeptides and/or peptides are capable of modulating an immune response in a subject. In some embodiments, a wild-type protein or peptide is used. In some embodiments, a modified protein or polypeptide is used to generate pMHC.

The term "purified" as used herein refers to a polypeptide that is not substantially bound to other proteins or polypeptides, for example, as a purified product of a recombinant host cell culture or from a non-recombinant source.

In the context of antibody or TCR binding, the term "specific binding" refers to high avidity and/or high affinity binding of an antibody or TCR to a particular polypeptide (e.g., a particular antigen) (or more precisely, to a particular epitope of a particular polypeptide). The binding of an antibody or TCR to these epitopes is generally stronger than the binding of the same antibody or TCR to any other epitope or any other polypeptide not comprising the epitope.

The antigen or antigen-derived peptide or polypeptide useful in the present invention may be any antigen or antigen-derived peptide or polypeptide of interest to a researcher.

The term "promoter" as used herein is defined as a DNA sequence recognized by the cellular synthesizer or an introduced synthesizer, which is required to initiate specific transcription of a gene.

The terms "transfection", "transduction" or "transformation" are used interchangeably herein and refer to the process of introducing foreign DNA into a host cell. Transfection (or transduction) may be accomplished by any of a number of methods, including electroporation, microinjection, gene gun delivery, retroviral infection, lipofection, superinfection, and the like. Transfection (or transduction or transformation) is divided into two modes, stable transfection (or transduction or transformation) and transient transfection (or transduction or transformation). Stable transfection (or transduction or transformation) refers to the integration of foreign DNA into the genome of a host cell. Transient transfection (or transduction or transformation) means that the foreign DNA introduced into the host cell does not have to be integrated into the genome of the host cell.

The term "integrated form" as used herein refers to the integration of foreign DNA into the genome of a host cell after introduction into the host cell, the foreign DNA being capable of replication upon host cell proliferation and thereby being maintained in the host cell during host cell proliferation or passage, such that the foreign DNA is capable of sustained expression of the corresponding mRNA or protein in the host cell.

The term "mating type" or "zygosity" as used herein refers to the two mating types of a group of fungi that are capable of engaging with each other to produce sexual spores. Two mating types exist in yeast, called alpha-type and a-type, respectively. It is generally understood by those skilled in the art that yeasts of different mating types cannot join.

The term "mating-deficient" as used herein means that yeasts of different mating types cannot mate when co-cultured conventionally due to some alteration of the yeast cells. Those skilled in the art can prepare or obtain mating-deficient yeasts using methods conventional in the art (e.g., gene mutation, gene editing techniques, treatment with corresponding compounds, etc.). In some embodiments, a mating-deficient yeast can be obtained by deleting the Sag1 gene in a yeast cell using techniques conventional in the art.

The term "overexpression" as used herein refers to an increase in the expression level of a corresponding gene of interest in a host cell. Overexpression of the gene of interest can be achieved using any means conventional in the art, including, but not limited to, introducing a foreign gene of interest into a host cell, increasing the expression of the gene of interest in the host cell using compounds (inhibitors or agonists) or gene editing techniques (e.g., CRISPRi), thereby resulting in a host cell that overexpresses the gene of interest.

The term "plasmid form" as used herein means that the foreign DNA, when introduced into a host cell, is not integrated into the genome of the host cell, but rather relies on self-replicating elements on the plasmid for independent replication and amplification. However, during host cell proliferation or passage, it is desirable to maintain selection pressure on the plasmid. In the absence of selection pressure, the foreign DNA may be lost, so that the amount of the foreign DNA is continuously reduced during the proliferation or passage of the host cell, and thus the amount of the corresponding mRNA or protein expressed by the foreign DNA in the host cell is continuously reduced.

The term "strength of interaction" as used herein refers to the strength of binding of a molecule to its ligand, which can be characterized by the term "equilibrium dissociation constant (KD)" as used herein, in units of molar concentration by volume (M or mol/L). The equilibrium dissociation constant can be measured by techniques known in the art, such as Surface Plasmon Resonance (SPR) techniques. In some embodiments, measurements can be made using the methods as described in Moritz, a.et al.high-throughput peptide-MHC complex generation and kinetic diagnostics of TCRs with peptide-reactive HLA-base:Sub>A 02.

The term "negative control group" as used herein refers to any negative control used in conventional experimental methods known to the skilled person, which is a group that has not received any type of treatment in the experiment or that the skilled person would expect no corresponding effect to occur, and therefore the group should not show any change during the experiment, which is used to control unknown variables during the course of the experiment. Specifically, in some embodiments, such as when studying the interaction of an antigen (referred to as "antigen a") with a TCR (referred to as "TCR-a"), the negative control group can be a co-culture of yeast expressing antigen a with yeast cells expressing TCRs known in the art that do not bind to antigen a, or the negative control group can be a co-culture of yeast cells expressing TCR-a with yeast cells expressing antigens known in the art that do not bind to TCR-a.

A "modified protein" or "modified polypeptide" or "modified peptide" refers to a protein or polypeptide that has been altered in chemical structure (particularly its amino acid sequence) relative to the wild-type protein or polypeptide. In some embodiments, the modified protein or polypeptide or peptide has at least one altered activity or function (it is to be appreciated that the protein or polypeptide or peptide may have multiple activities or functions). It is specifically contemplated that one activity or function of the modified protein or polypeptide or peptide may be altered, but on the other hand one wild-type activity or function may be retained, such as immunogenicity or the ability to interact with other cells of the immune system in the case of formation of pmhcs.

"second generation sequencing" as used herein refers to the determination of "DNA sequences or DNA fragment sequences" in a conventional second generation sequencing platform using second generation sequencing methods as conventionally understood by those skilled in the art. In some embodiments, the second-generation sequencing comprises the steps of PCR amplifying the fragments to be sequenced and introducing sequencing adaptor sequences and barcode sequences, and sequencing by the second-generation sequencing platform.

The term "random mutation primer" as used herein refers to a base form having NNK (N represents any one nucleotide, and K represents G or T) as a mutation at a desired mutation-introducing position, a non-mutation position having complementary positions to both strands of a template DNA, and a 3' end of a primer complementary to the template DNA by more than 20bp.

The term "determining a sequence" as used herein refers to the process of obtaining the nucleotide sequence of the nucleic acid or deoxyribonucleic acid of a corresponding sample in accordance with techniques conventional in the art. For example, the corresponding sequence can be detected by sequencing by a first generation sequencing method (e.g., sanger sequencing) or a second generation sequencing method. In some embodiments, sequencing can be performed using next generation sequencing methods to detect the corresponding sequences.

The term "reads number" as used herein refers to the number of fragments read for a sequence of a DNA fragment to be sequenced in one sequencing of a second generation sequencing method.

The term "pathogen" as used herein refers to a specific causative agent of a disease and may include, for example, any bacteria, virus or parasite.

The term "disease" as used herein refers to an interruption, cessation or disorder of a body function, system or organ. Preferred diseases include infectious diseases.

2. Production of nucleic acidPrepare for

Nucleic acids as used herein include, but are not limited to, all nucleic acid sequences obtained by any available method in the art, including, but not limited to, recombinant methods, i.e., cloning nucleic acids from a recombinant library or the genome of a cell using conventional cloning techniques and PCR and the like. In addition, nucleic acid includes can include mutations, including but not limited to the field of known methods for nucleotide or nucleoside mutations. The nucleic acid may comprise one or more polynucleotides. In some embodiments, the nucleic acid is contained within a viral vector. In some embodiments, the viral vector is a retroviral or lentiviral vector.

In some embodiments, the nucleic acids used in the invention can be prepared by any technique known in the art, such as chemical synthesis, enzymatic production, or biological production. Nucleic acids can be recovered or isolated from a biological sample. May be recombinant or it may be native or endogenous to the cell (produced by the genome of the cell). In some embodiments, the nucleic acid fragment of interest can be amplified by gene amplification techniques such as PCR (polymerase chain reaction) using chemically synthesized, or intracellular, nucleic acids as templates and thereby obtaining a sufficient amount of the nucleic acid sequence or nucleic acid sequence of interest.

Nucleic acid synthesis can also be performed according to standard methods. Non-limiting examples of synthetic nucleic acids (e.g., synthetic oligonucleotides) include nucleic acids synthesized chemically in vitro using phosphotriester, phosphite, or phosphoramidite chemistry and solid phase techniques or via deoxynucleoside triphosphate H-phosphate intermediates. Various different nucleotide synthesis mechanisms have been disclosed.

Nucleic acids can be isolated using known techniques. In particular embodiments, methods of isolating small nucleic acid molecules and/or isolating RNA molecules may be used. Chromatography is a method used to separate or isolate nucleic acids from proteins or from other nucleic acids. The method may involve gel matrix electrophoresis, filtration columns, alcohol precipitation, and/or other chromatography. If nucleic acid from cells is to be used or evaluated, the method generally involves lysing the cells with a chaotropic agent (e.g., guanidinium isothiocyanate) and/or a detergent (e.g., N-lauroylsarcosine), and then performing the method to isolate a specific RNA population.

3. Protein expression

In some embodiments, either promoter can be used to express a protein of interest (e.g., pMHC or TCR) on the surface of a yeast cell or T cell. In some embodiments, the promoter used to express the protein (e.g., pMHC or TCR) is constitutive. There are a variety of constitutive promoters known in the art, including but not limited to TEFl and glyceraldehyde-3-phosphate dehydrogenase promoters. In some embodiments, the promoter used in the present invention for expressing pMHC on the surface of yeast cells is a constitutive promoter commonly used in yeast such as pGPD, pTEF1, pTEF2, pADH1, GAP, and in some embodiments, pMHC is expressed in yeast using pGPD promoter. In some embodiments, the promoter used to express the polypeptide (e.g., pMHC or TCR) is inducible. Inducible promoters are useful when one of skill in the art desires to control when a polypeptide of interest is expressed. Many inducible promoters are known in the art, including but not limited to GAL1, P0X3, and LIP2 promoters. Those skilled in the art will be able to know suitable constitutive and inducible promoters that function in the cell of interest (e.g., yeast cell or T cell).

In some embodiments, yeast cell transformation can be performed by various methods known in the art, such as lithium acetate transformation, electroporation, and the like. In some embodiments, the yeast cell transformation is performed using an electroporation method. In some embodiments, a plasmid containing a sequence of interest introduced at both ends into homology arms required for integration with the yeast genome can be constructed, the sequence of interest is recovered by cleaving the plasmid, and the linearized fragment is transformed into a yeast cell to obtain a yeast cell expressing the gene in an integrated form, so that the yeast cell can continuously and stably express the protein or polypeptide of interest.

In some embodiments, T cells can be transfected by various methods known in the art, such as virus-mediated transfection, electroporation, and the like.

4. Yeast cells

Yeast cells useful in the present invention are known in the art and include Saccharomyces cerevisiae (Saccharomyces cerevisiae), hansenula polymorpha (Hansenula poymorpha), schizosaccharomyces pombe (Schizosaccharomyces pombe), kluyveromyces lactis (Kluyveromyces lactis), kluyveromyces fragilis (Kluyveromyces fragilis), ustilago zeae (Ustilago maydis), pichia pastoris (Pichia pastoris), pichia methanolica (Pichia anolytica), pichia quarternary (Pichia guiiIlmoni) and Candida maltosa (Candida albicans). In some embodiments, preferably, the yeast used in the methods, systems, uses or cultures described herein is Saccharomyces cerevisiae (Saccharomyces cerevisiae). More preferably, in some embodiments, the yeast is the EBY100 strain or a genetically engineered strain of the EBY100 strain. As used herein, "genetically engineered strain" refers to a strain in which the mating type, etc., of the original strain is changed, or one, two, three, four or more genes of the original strain are deleted, substituted or mutated, or one, two, three, four or more genes are exogenously expressed in the original strain, or chromosomes of the original strain are fused, rearranged, etc., using genetic manipulation means that are conventional in the art, on the basis of the original strain. Preferably, in some embodiments, the yeast is a MATalpha yeast strain derived from EBY100a strain, as described in Young, D., berger, S., baker, D. & Klavins, E.high-throughput characterization of protein-protein interactions by reprogramming yeasting, proc.Natl.Acad.Sci.114, 12166-12171 (2017).

5. Yeast culture system

In some embodiments, the yeast may be cultured using a medium comprising any yeast commonly used in the art. In some embodiments, the yeast medium is a complete medium YPD medium.

In some embodiments, yeast cells displaying a TCR library and yeast cells displaying pMHC are co-cultured for 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, or more, or any value (preferably 22 hours) within a range of endpoints or any value(s) therein, then yeast cell diploids are screened and TCR sequences of the yeast cell diploids are detected.

In some preferred embodiments, the displaying TCR and the displaying pMHC yeast cells are co-cultured using yeast cells in a logarithmic growth phase.

6. Determination of the interaction Strength

One skilled in the art will appreciate that the strength of interaction between a pMHC and a TCR can be determined using any method known in the art, such as by measuring the KD value (equilibrium dissociation constant) between a particular TCR and a particular pMHC to characterize the strength of interaction, or by flow cytometry. For example, purified specific pMHC-coupled fluorophores can be used to co-incubate yeast displaying a specific TCR, and then the fluorescence intensity of the fluorophore can be detected by flow cytometry to characterize the intensity of the pMHC-TCR interaction. One skilled in the art will appreciate that the fluorescence intensity can be determined or calculated according to methods in the art, for example using the mean fluorescence intensity, geometric mean fluorescence intensity or median fluorescence intensity in a flow cytometry assay (more preferably using the mean fluorescence intensity), to characterize the intensity of the pMHC-TCR interaction. As will be appreciated by those skilled in the art, the interaction intensity can be determined or calculated, for example, using a control conventional in the art (e.g., a negative control), such as the average fluorescence intensity of the negative control as a background level, and the average expression level can be calculated by subtracting the average fluorescence intensity of the negative control from the average fluorescence intensity of the experimental group.

The inventors have surprisingly found that fold change values determined using the method of the invention have a positive correlation with the strength of interaction measured using the above-described methods conventional in the art. Thus, the strength of interaction of a selected TCR with a particular pMHC can be calculated or determined by fold change values according to the methods of the invention. One skilled in the art will appreciate that the strength of interaction of the corresponding TCR and pMHC can be characterized by the magnitude of the fold difference (fold change) value.

In some embodiments, the positive correlation can be analyzed using spearman (sperman) correlation coefficients. In statistics, spearman (sperman) correlation coefficients are often represented by the greek letter ρ. It is a non-parametric indicator that measures the dependence of two variables. It evaluates the correlation of two statistical variables using a monotonic equation. If there are no repeated values in the data, and when the two variables are perfectly monotonically correlated, the spearman correlation coefficient is either +1 or-1. In the spearman correlation coefficient, the absolute value of the coefficient represents the magnitude of the correlation. 0.7 and above represents a high correlation, with a P value representing significance, and a P value less than 0.05 representing significance in a statistical sense.

7. Calculation and determination of fold difference (fold change)

The calculation and determination of the fold difference (fold change) used in the invention comprises the following steps: (1) Dividing the number of each TCR sequence selected in a yeast diploid cell (i.e.the number of reads for a particular TCR sequence) by the number of all TCR sequences determined (i.e.the number of reads for all TCR sequences) to give a ratio value (i.e.the "ratio _{Measured in fact} "); (2) Mixing ratio _{Measured in fact} Divided by the ratio to the negative control _{Measured in fact} Value (i.e. "ratio) _{Control measurements} ") to obtain fold difference (fold change) values for each TCR sequence in the library.

In some embodiments, the ratio may be normalized prior to calculating the fold difference value (fold change) value _{Measured actually} And ratio _{Contrast measurement} A correction is made. In some embodiments, the TCR sequences comprising TCR regions having more than one stop codon are determined from all TCR sequences, and the correction is made by dividing the number of TCR sequences comprising TCR regions having more than one stop codon (or the average of the number of TCR sequences comprising TCR regions having more than one stop codon) by the number of TCR sequences comprising TCR regions having more than one stop codon, to obtain a ratio value (i.e., "ratio") _{Internal reference} ") in using ratio _{Measured actually} Divided by ratio _{Control measurements} Before, ratio was used separately _{Measured actually} And ratio _{Contrast measurement} Divided by ratio _{Internal reference} Respectively obtaining the ratio _{Actual measurement correction} And ratio _{Correction against actual measurements} Then using ratio _{Actual measurement correction} Divided by ratio _{Correction against actual measurements} A fold difference (fold change) is obtained.

Examples

This example generally describes a method for screening high affinity TCRs that does not require time-consuming and laborious protein purification procedures and allows for rapid screening of high affinity TCRs.

Example 1 display of pMHC onto the surface of Yeast cells

The specific experimental steps are as follows:

the synthesis of antigen-MHC complexes (pMHC) to be investigated was carried out using methods customary in the art, and this example exemplifies SL 9-HLA-A0201 (SEQ ID NO: 1) and TAX-HLA-A0201 (SEQ ID NO: 2). Wherein the amino acid sequence of TAX is: LLFGYPVYV; the amino acid sequence of SL9 is SLYNTVATL.

When SL 9-HLA-A0201 (SEQ ID NO: 1) and TAX-HLA-A0201 (SEQ ID NO: 2) were synthesized by methods routine in the art, nheI and XhoI restriction enzyme cleavage sites were introduced at both ends, respectively.

SL 9-HLA-A0201 (SEQ ID NO: 1), TAX-HLA-A0201 (SEQ ID NO: 2), ysynalpha _ DEST plasmid vectors (SEQ ID NO: 3) were cleaved with NheI (NEB, R3131L) and XhoI (NEB, R0146L) restriction endonucleases, respectively. The enzyme was digested in a 37 ℃ water bath for 3 hours under the conditions shown in Table 1.

TABLE 1 conditions of the enzyme digestion reaction

1.5% DNA agarose gel (Biowest, 111860) (agarose in 1XTAE buffer (50 XTAE (solarbio, T1060) configuration, ddH ₂ O dilution) was prepared at a mass (g) to volume (ml) ratio of 1.5), electrophoresis was performed at 120V for 40 minutes, and then the objective fragments were cut out under an ultraviolet lamp, and the corresponding fragments were recovered using a gel recovery reagent (shanghai macbeth, K132) cassette. Then, the cleaved SL 9-HLA-A0201 (SEQ ID NO: 1) and the cleaved TAX-HLA-A0201 (SEQ ID NO: 1) were ligated under the ligation conditions shown in Table 2NO: 2) are respectively connected with the digested ysynalpha _ DEST plasmid vector (SEQ ID NO: 3). The ligation reaction was carried out at room temperature for 20 minutes.

TABLE 2 conditions of ligation reaction

The ligation product was transformed into E.coli DH5 alpha (Cw 0808H, kangchi) usingbase:Sub>A conventional method (e.g., heat transfer or electric transfer) to finally obtain vectors for integrated form expression of ysynalpha-pMHC (i.e., the ysynalpha-SL 9-HLA-A0201 vector and the ysynalpha-TAX-HLA-A0201 vector). The SL9 region in the ysynalpha-SL 9-HLA-base:Sub>A 0201 was then mutated using methods routine in the art to mutate the 3 bases corresponding to the third amino acid of the SL9 sequence tobase:Sub>A stop codon, thereby yielding the ysynalpha-SL9 3-HLA-base:Sub>A 0201 vector. The ysynalpha-pMHC vector also comprises a gene sequence for coding blue fluorescent protein.

The vector sequence was verified to be correct by using sanger sequencing.

The resulting ysynalpha-pMHC vector was cleaved with PmeI enzyme (NEB, R0560L) and then recovered by gel cutting to obtainbase:Sub>A linearized fragment containing the target fragment of pMHC (i.e., TAX-HLA-A0201, SL 9-HLA-A0201, or SL 9-HLA-A0201). The linearized fragment likewise contains the gene sequence described above which codes for the blue fluorescent protein.

The above linearized fragments of the ysynalpha-pMHC vector were transformed into EBY100 yeast strains using conventional lithium acetate transformation or electroporation to obtain pMHC-displaying yeast cells, i.e., SL 9-HLA-A0201-expressing yeast cells, TAX-HLA-A0201-expressing yeast cells, and SL9 3-HLA-A0201-expressing yeast cells. The yeast cell is integrated with and expresses a blue fluorescent protein, and can be used for screening.

Example 2 construction of TCR libraries

The 868TCR sequence (SEQ ID NO: 4) was synthesized using methods conventional in the art, with Nhei and XhoI restriction enzyme sites introduced at both ends.

The TCR and ysyna _ DEST plasmids (SEQ ID NO: 5) were digested with NheI (NEB, R3131L) and XhoI (NEB, R0146L) restriction enzymes, respectively, in a water bath (model) at 37 ℃ for 3 hours under the conditions shown in Table 1 above.

DNA agarose gel (source and model: biowest, 111860) was used at 1.5% (prepared as agarose 1XTAE buffer (prepared with 50XTAE (SOLABio, T1060) diluted with water) at a mass (g) to volume (ml) ratio of 1.5), electrophoresed at 120V for 40min, then the fragments were cut out under UV light, and the corresponding fragments were recovered with a kit of Shanghai Bocai gel recovery reagent (K132). Then, the ligation was carried out at room temperature for 20 minutes under the ligation conditions shown in Table 2.

The ligation product is transformed into Escherichia coli DH5 alpha (origin and model: kangji century, CW 0808H) by a conventional method (such as heat transfer method or electric transfer method), the transformed Escherichia coli is cultured and amplified according to a conventional method in the field, and plasmid extraction is carried out on the Escherichia coli, so that a carrier of the ysyna-TCR for expression in an integrated form, namely a ysyna-868TCR carrier, is finally obtained. The vector sequence was verified to be correct by using sanger sequencing. This plasmid vector serves as a template for subsequent use in the preparation of TCR libraries.

Using the ysyna-868TCR as the template, designing 2 pairs of primers according to the conventional primer design method in the field to amplify the TCR sequence, obtaining 2 PCR products (respectively segment 1 and segment 2), wherein the segment 1 and the segment 2 have 15bp homologous arms with the ysyna _ DEST plasmid vector, and the segment 1 and the segment 2 have 20bp homologous sequences with each other. Wherein, one pair of primers is NNK random mutation reverse primers covering the CDR3 region of the TCR, and the positions of the primers are consistent with the position of the template except the position to be mutated.

Primers were synthesized using methods conventional in the art and purified using PAGE. Amplification was carried out using 2X Phanta Max Master (Vazyme, P515-03) according to the PCR system shown in Table 3 and the PCR amplification conditions shown in Table 4.

TABLE 3 PCR System conditions

2x PCR buffer	25
		Plasmid	10ng
Primer F	1μl
		Primer R	1μl
ddH2O	Adding 50 μ l

TABLE 4 PCR reaction conditions

DNA agarose gel (Biowest, 111860) was used at 1.5% concentration (prepared as a mass (g) to volume (ml) ratio of agarose to 1XTAE buffer (prepared using 50XTAE (Sollabio, T1060) diluted with water) of 1.5, electrophoresis was performed at 120V for 40 minutes, and then the fragments of interest were excised under UV light and the corresponding fragments (i.e., fragment 1 and fragment 2) were recovered using the Shanghai Bocai gel recovery reagent (K132) cassette. The concentration was measured using a Nanodrop (Thermo, nanodrop 2000).

Meanwhile, the ysyna _ DEST plasmid vector was digested with NHEI and XHOI under the digestion conditions described in Table 1, and then recovered using the Shanghai Bomby gel recovery reagent (K132) cassette. The concentration was measured using a Nanodrop (Thermo, nanodrop 2000).

Gibson cloning was performed using the seamless cloning kit Gibson kit (Bilun day, D7010M) and the reaction system is shown in Table 5.

TABLE 5 Gibson cloning System

2x seamless Buffer	10μl
		Fragment 1	60ng
Fragment 2	60ng
		Carrier	20ng
ddH 2 O	Adding to 20 μ l

The reaction of Table 5 was carried out at a constant temperature of 50 ℃ for 30 minutes. Carrying out alcohol precipitation on the reaction product, and carrying out the following steps;

1. the mixture after the PCR reaction was taken out, and 1/10 volume of 3M sodium acetate (3 mol/L, pH =5.2, solarbio, A1070) was added thereto and mixed well so that the final concentration of sodium acetate was 0.3mol/L;

2. adding 2 times of the volume of ethanol (Michelin, E809056) of the mixture obtained in the step 1 (precooling with ice before adding), mixing well, standing at-20 deg.C for 15-30 min;

3.12,000g for 10 minutes, carefully remove the supernatant and aspirate all droplets on the tube walls using a pipette or vacuum pump;

4. adding 700. Mu.l of 70% ethanol (prepared with water and absolute ethanol), centrifuging at 12000g for 2 minutes, and aspirating all droplets from the tube wall using a pipette or a vacuum pump;

5. opening the cover of the centrifuge tube at room temperature, and placing the centrifuge tube on an experiment table to evaporate the residual liquid to be dry;

6. adding 30. Mu.l of ddH ₂ The DNA pellet in the centrifuge tube was dissolved and the DNA concentration was determined using a Nanodrop (Thermo, nanodrop 2000).

Transferring the product after alcohol precipitation to the electroporation competence (Shanghai Weidi, DE 1010) of TOP10 by using a conventional method in the field, and performing electroporation according to the steps of the specification, wherein the specific steps are as follows:

taking out the 1.0.1cm electric shock cup and the cup cover from the storage liquid, inversely placing the electric shock cup and the cup cover on clean absorbent paper for 5 minutes, rightly placing the electric shock cup and the cup cover on the clean absorbent paper for 5 minutes after the water is drained, fully volatilizing the ethanol, immediately inserting the electric shock cup and the cup cover into ice after the ethanol is completely volatilized, compacting the ice surface, enabling the top of the electrode cup to be 0.5cm away from the ice surface so as to conveniently cover the cup cover, and standing the electric shock cup and the cup cover in the ice for 5 minutes to fully cool.

2. TOP10 electroporation competent (Shanghai Weidi, DE 1010) cells stored at-80 ℃ were inserted into ice for 5 minutes, after they melted, the target DNA (plasmid or ligation product) was added and gently mixed by poking the bottom of the EP tube with hands to avoid the formation of air bubbles, and immediately inserted into ice.

The DNA concentration does not exceed 100 ng/. Mu.l, and the volume does not exceed 5. Mu.l/50. Mu.l.

3. The competent-DNA mixture was quickly transferred to the cuvette using a 200. Mu.l pipette tip (0.5 cm of the tip was cut off with a knife) to avoid the formation of air bubbles, and the cuvette lid was closed.

4. Starting the electrotransfer instrument, and setting parameters: c =25 μ F, PC =200 Ω, V =1.8kV (BioRad electric rotating machine), the electric cup is quickly placed in the electric rotating bath, and the electric shock completes the quick insertion into ice.

After 5.2 minutes, the cuvette was removed from the ice, left at room temperature, 1ml of sterile s.o.c. medium (room temperature) containing no antibiotics was added, the bottom of the cuvette was sucked up several times with a 1ml gun and mixed, and then transferred to a 50ml centrifuge tube (BD Falcon 50ml conical centrifuge tube, etc.), and the s.o.c. medium was added to the centrifuge tube to 10ml. Put into a shaker with an inclination of 45 ℃ and revive for 60 minutes at 37 ℃ and 225 rpm.

The bacteria were harvested by centrifugation at 6.5000rpm for one minute and resuspended in the total amount of plates on 2-5 15cm S.O.C plates containing the corresponding antibiotic. The plates were placed upside down in a 37 ℃ incubator overnight for 13-17 hours.

After obtaining the plate, all E.coli were scraped off with a spatula (origin and type: baisaird, BL 6013039) and collected in a 50ml centrifuge tube for subsequent plasmid macroextraction.

The bacteria were centrifuged at 3000rpm for 15 minutes to collect the cells, and plasmid macroextraction was carried out using a plasmid macroextraction kit (origin and type: tiangen, DP 117). After extraction, the plasmid vectors containing the TCR mutant repertoire were tested using Nanodrop.

Cutting the extracted plasmid vector containing the TCR mutation library by using PmeI (neb, R0560L), and cutting fragments including ARS314, TCR, TRP and fluorescent protein; recovering the gel to obtain fragments;

and (3) transforming the recovered TCR library into EBY100 (MATa) yeast by using a conventional lithium acetate transformation method or an electric transformation method, wherein the EBY100 (MATa) yeast simultaneously integrates and expresses a red fluorescent protein, and red fluorescence can be detected in a subsequent flow-type experiment. Screening single clones through SC-TRP plates; scraping all yeast colonies by using a scraper, centrifuging, and suspending in an SC-TRP culture medium; cryopreserved as yeast cells expressing or displaying a TCR library.

TABLE 6 formulation of SC-TRP Medium

YNB (without amino acid) (BD, 291940)	6.7g
		Sc-trp DO(Clontech，630413)	0.74g
Glucose (Sigma, G8270)	20g
		ddH 2 O	Adding water to 1L
Adjusting the pH value	The pH is adjusted to 5.8 with aqueous NaOH

Example 3 TCR screening

Yeast cells expressing the TCR library were cultured overnight in YPD medium with shaking (220 rpm) at 30 ℃ with yeast cells expressing the pMHC sequence.

TABLE 7 formulation of YPD medium

Peptone (BD, 211677)	10g
		Glucose (Sigma, G8270)	10g
Yeast extract (BD, 212750)	5g
		Tryptophan (sigma, T0254)	0.16g

The next day, yeast growth reached exponential phase (OD = 0.4) by transfer from OD =0.1 using a spectrophotometer (youco, 723N visible spectrophotometer), yeast expressing TCR library and yeast expressing pMHC were co-cultured in 96-well V-type deep well plates with a total culture volume of 1ml per well, wherein the OD value of the yeast expressing TCR library per well was 0.0125 and the OD value of the yeast expressing antigen library per air was 0.0375.

The yeast mating experiment was carried out in a shaker set at 30 ℃ and 220RPM, mixed cultured for 22h, and yeast cells of the expression library were added in an amount of 100 times the library capacity determined above to achieve coverage, e.g., 1OD equal to 10, according to the size of the constructed TCR mutant library ( ⁷ Yeast cells per ml, e.g. 1X10 in stock ⁴ In total, 0.1OD yeast was added and 10 replicates were made) to determine how many replicates were performed simultaneously.

Obtaining diploid yeast cells formed by mediation of TCR-pMHC. Wherein, irrelevant peptide fragment TAX-HLA-A0201 (wherein TAX position 8 introducesbase:Sub>A stop codon) is used asbase:Sub>A negative control, after the subsequent generation sequencing, the difference between the experimental group and the control group is used asbase:Sub>A threshold value, and the sequencing data is selected to be corrected.

After mating, since only diploids can grow in SC-Lys-Leu medium, diploids can be selected using SC-Lys-Leu medium. Washing 600 μ l strain with SC-Lys-Leu culture medium for 2 times; the cells were cultured for 24 hours in SC-Lys-Leu medium, and diploids were selected, or a bifluorescent (mcherry and mTurquoise) target population was selected by flow-sorting.

TABLE 8 SC-Lys-Leu Medium

Example 4 determination of TCR sequences in the diploid yeast cells

Culturing for 24 hours, centrifuging the diploid yeast cells at 3000rpm for 5 minutes, and extracting the genome of the diploid yeast cells by using a bead milling method which is a conventional method in the field;

the CDR3 regions of the TCR in the genome of the diploid yeast cells were specifically amplified by designing the forward and reverse primers according to methods conventional in the art, the PCR amplification system and conditions are shown in tables 9 and 10, and the PCR amplification system of Table 9

TABLE 10 PCR amplification conditions

Recovering the PCR product by using a zymoclean kit (Zymo, D4008) glue, and then resuspending the PCR product to be used as a template for the second round of PCR; second round of PCR amplification was performed according to the conditions of Table 11 and Table 12 (i 5 primer is AATGATACGGCGGACCACCGAATACXXXXXXXXTCGTCGGC AGCGTC, i7 primer is CAAGCAGAAGACGGCATACGAGATXXXXXXXXTGGGCTCTC GG); a sequenced barcode sequence was introduced. Where XXXXXXXXX is the barcode sequence used to label and distinguish individual samples.

TABLE 11 PCR amplification System

TABLE 12 PCR amplification conditions

Detecting the concentration of double-stranded DNA by utilizing the Qubit, and performing mixed sequencing on the fragments in equal quantity;

after obtaining the second generation sequencing data, the number of specific TCR sequences (i.e., the number of reads for the specific TCR sequences) was divided by the number of all TCR sequences (i.e., the number of reads for all TCR sequences) to obtain a ratio value (i.e., "ratio _{Measured in fact} "). Mixing ratio _{Measured in fact} Divided by the ratio to the negative control _{Measured in fact} Value (i.e. "ratio) _{Contrast measurement} "), the fold difference (fold change) value for each TCR sequence in the library was obtained. The negative control group can be any peptide known in the art that does not interact with any of the TCRs in the TCR library. As shown in the examplesThe negative control groups used in 5 were SL 9-HLA-base:Sub>A 0201 and TAX-HLA-base:Sub>A 0201.

The first 10%, 15%, 20%, 25%, 30% of the TCR sequences with the highest fold difference (fold change) values relative to the TCR library capacity can be considered as TCR sequences capable of interacting with a particular pMHC.

The experiment was repeated 3-4 times per technique and independently for 2 times, the results were analyzed separately for each independent experiment, and the screening threshold was given as fold difference (> 1) and P value <0.05 in at least one independent experiment relative to the control.

Example 5 validation of screening results

In this example, several mutants of 868TCR that mutated at the alpha CDR3 position were constructed, GADDYALN, GAHDYSLN, GSHDYALN, GAHDYALV, GAHDYYLN, SAHDYALN, GAYDYALN, GAHDYILN, TNSGYALN, GAHDYAYYN, GAHDYAQN, GLHDYALN, GACDYALN, LAHDYALN, GAHDY LN, respectively. Yeast cells expressing the library of 868TCR α CDR3 mutants were obtained in the same manner as described in example 1. Yeast cells displaying the library were incubated with SL 9-HLA-base:Sub>A 0201, TAX-HLA-base:Sub>A 0201 (NC) and SL 9-HLA-base:Sub>A 0201 (NC), respectively, and TCR sequences capable of binding to SL 9-HLA-base:Sub>A 0201 were screened by secondary sequencing according to the method of the above example.

The results of the screening are shown in FIG. 2, and the α CDR3 sequence of the TCR capable of binding to SL 9-HLA-A0201 is shown in FIG. 2, where blue represents the ratio of the α CDR3 sequence of the TCR capable of binding to SL 9-HLA-A0201 _{Measured actually} Values, orange, represent the ratio of the α CDR3 sequence of the TCRs bound by TAX-HLA-A0201 (NC) and SL9 3-HLA-A0201 (NC) _{Measured in fact} Average value of (a).

To further illustrate the sensitivity and specificity of the present invention, the inventors tested the TCR sequences selected in the examples. One skilled in the art will appreciate that other methods routine in the art can be used by those skilled in the art to verify the ability of a selected TCR sequence to bind to a particular p-MHC.

After obtaining the selected TCR sequences, tables were constructed according to the cloning and transformation methods described in the above examplesYeast cells that reach the specified TCR, and then the yeast cells were cultured overnight (shaker speed 220rpm, temperature 30 ℃) in YPD medium, starting from OD =0.1 the next day, and 1X10 cells were collected 4 hours after culture ⁶ Yeast cells were centrifuged at 3000rpm for 5min in a 1.5ml EP tube, the supernatant was removed, 1ml of PBS (Hyclone/sea clone, SH 30256.01) +1% BSA (Amresco, A0332-100 g) medium was added to resuspend the cells, the residual medium was removed (3000 rpm centrifugation for 5min, supernatant was discarded), and the process was repeated once.

After this time, 50. Mu.l of PBS +1 vol% FBS were resuspended and stained with tetrameric antibody SL 9-HLA-A0201-PE (1. After staining for 30min at room temperature in the dark, 1ml of PBS (Hyclone/sea clone, SH 30256.01) +1% BSA (Amresco, A0332-100 g) was added to the cell suspension, centrifuged at 3000rpm for 5min, the supernatant was discarded, and after repeating once, the cells were resuspended in a medium supplemented with 1ml of PBS (Hyclone/sea clone, SH 30256.01) +1% BSA (Amresco, A0332-100 g).

And detecting whether the yeast cells expressing the corresponding screened TCR sequences can be combined with the tetramer antibody of SL 9-HLA-A0201-PE or not by usingbase:Sub>A BD LSR Fortessa flow analyzer, and calculating the average fluorescence intensity of the fluorescent group PE according tobase:Sub>A flow result, wherein the higher the average fluorescence intensity is, the stronger the binding force between the antigen and the TCR mutant is.

FIG. 3 shows the results of flow assays, where the selected TCRs (i.e., P < 0.05) were found to bind well to the particular pMHC. It can also be seen that the fold difference (fold change) in the screening results is positively correlated with the mean fluorescence intensity in the validation experiment.

The results of example 2 show that the screening results of the method of the invention have high sensitivity and good specificity.

FIG. 4 is a positive correlation between the interaction intensity expressed as Mean Fluorescence Intensity (MFI) and the interaction intensity expressed as fold difference (fold change) value calculated using the Spireman correlation coefficient.

In statistics, spearman (sperman) correlation coefficients are often represented by the greek letter ρ. It is a nonparametric indicator that measures the dependence of two variables. It evaluates the correlation of two statistical variables using a monotonic equation. If there are no repeated values in the data, and when the two variables are perfectly monotonically correlated, the spearman correlation coefficient is either +1 or-1. In the spearman correlation coefficient, the absolute value of the coefficient represents the magnitude of the correlation. 0.7 and above represents very high correlation, with P values representing significance, and P values less than 0.05 representing significance in a statistical sense.

In the results of fig. 4, ρ =0.809, p =1.48 × 10 ^-4 Illustrating that fold difference (fold change) values determined using the method of the invention are positively correlated with, and statistically significant in relation to, the Mean Fluorescence Intensity (MFI) measured by flow cytometry using purified pMHC and TCR-displaying yeast cells of the prior art, which is indicative of the intensity of the interaction. Thus, the strength of interaction of a selected TCR with a particular antigen can be determined by the method of the invention.

The present invention has been illustrated by the above embodiments, but it should be understood that the above embodiments are for illustrative and descriptive purposes only and are not intended to limit the invention to the scope of the described embodiments. It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention, including combinations and subcombinations of features. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (7)

1. A method of screening for and determining TCRs that interact with a specific antigen and their strength of interaction with a specific antigen, comprising:

(a) Displaying the specific antigen-MHC complex (pMHC) and the TCR library on the surfaces of different mating types of yeast respectively;

(b) Co-culturing the different mating types of yeast;

(c) Screening out a yeast cell diploid, and determining a TCR sequence in the yeast cell diploid;

(d) Calculating a fold difference (fold change) value for each of said determined TCR sequences;

thereby determining the TCR and its strength of interaction with the specific antigen;

preferably, the yeast cells displaying the TCR express the TCR in an integrated form;

preferably, the pMHC-displaying yeast cell expresses pMHC in an integrated form.

2. The method of claim 1, wherein the mating-deficient yeast cell is a yeast cell with a deletion of the Sag1 gene.

3. The method according to claims 1-2, wherein the yeast cell is saccharomyces cerevisiae, preferably the saccharomyces cerevisiae is EBY100 strain or a genetically engineered strain of EBY100 strain.

4. The method of claims 1-3, wherein determining the sequence of the TCR and pMHC of the diploid yeast cells is performed using a next generation sequencing method.

5. A TCR sequence selected according to the method of claims 1-4.

6. A co-culture comprising yeast cells displaying one specific antigen-MHC complex (pMHC) and yeast cells displaying multiple TCRs, wherein the yeast cells displaying TCRs and the yeast cells displaying pMHC are of different mating types;

wherein the yeast cell is mating-deficient;

preferably, the yeast cell displaying the TCR is one that expresses the TCR in an integrated form;

preferably, the pMHC-displaying yeast cell expresses pMHC in an integrated form.

7. The co-culture of claim 6 for use in screening for TCR sequences capable of binding to a particular antigen.

Images