CN115786277A - Novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof - Google Patents
Novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof Download PDFInfo
- Publication number
- CN115786277A CN115786277A CN202211557697.3A CN202211557697A CN115786277A CN 115786277 A CN115786277 A CN 115786277A CN 202211557697 A CN202211557697 A CN 202211557697A CN 115786277 A CN115786277 A CN 115786277A
- Authority
- CN
- China
- Prior art keywords
- vibrio
- phage
- bacteriophage
- diseases
- strains
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001515965 unidentified phage Species 0.000 title claims abstract description 52
- 241000607598 Vibrio Species 0.000 title claims abstract description 31
- 201000010099 disease Diseases 0.000 title claims abstract description 19
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title claims abstract description 19
- 241001465754 Metazoa Species 0.000 title claims abstract description 12
- 238000002360 preparation method Methods 0.000 claims abstract description 23
- 241000894007 species Species 0.000 claims abstract description 5
- 238000004321 preservation Methods 0.000 claims abstract description 3
- 108090000623 proteins and genes Proteins 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 239000000203 mixture Substances 0.000 claims description 2
- 238000009472 formulation Methods 0.000 claims 1
- 241000607272 Vibrio parahaemolyticus Species 0.000 abstract description 56
- 241000607594 Vibrio alginolyticus Species 0.000 abstract description 20
- 230000001580 bacterial effect Effects 0.000 abstract description 20
- 241000607618 Vibrio harveyi Species 0.000 abstract description 17
- 208000015181 infectious disease Diseases 0.000 abstract description 15
- 238000001228 spectrum Methods 0.000 abstract description 15
- 238000009360 aquaculture Methods 0.000 abstract description 13
- 244000144974 aquaculture Species 0.000 abstract description 13
- 208000035143 Bacterial infection Diseases 0.000 abstract description 8
- 241000607626 Vibrio cholerae Species 0.000 abstract description 8
- 229940118696 vibrio cholerae Drugs 0.000 abstract description 8
- 241000607265 Vibrio vulnificus Species 0.000 abstract description 6
- 206010047400 Vibrio infections Diseases 0.000 abstract description 4
- 241000589876 Campylobacter Species 0.000 abstract description 3
- 239000007788 liquid Substances 0.000 description 52
- 241000238557 Decapoda Species 0.000 description 22
- 241000241034 Palaemon pugio Species 0.000 description 19
- 239000000243 solution Substances 0.000 description 18
- 230000002949 hemolytic effect Effects 0.000 description 16
- 230000000694 effects Effects 0.000 description 14
- 238000000034 method Methods 0.000 description 14
- 241000894006 Bacteria Species 0.000 description 12
- 238000003556 assay Methods 0.000 description 12
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 12
- 239000006228 supernatant Substances 0.000 description 11
- 238000012258 culturing Methods 0.000 description 10
- 230000034994 death Effects 0.000 description 10
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 8
- 230000002101 lytic effect Effects 0.000 description 8
- 238000012216 screening Methods 0.000 description 8
- 230000002265 prevention Effects 0.000 description 7
- 239000003242 anti bacterial agent Substances 0.000 description 6
- 229940088710 antibiotic agent Drugs 0.000 description 6
- 238000002156 mixing Methods 0.000 description 6
- 238000011081 inoculation Methods 0.000 description 5
- 239000000047 product Substances 0.000 description 5
- 108020004414 DNA Proteins 0.000 description 4
- 241001223363 Fenneropenaeus orientalis Species 0.000 description 4
- 230000006750 UV protection Effects 0.000 description 4
- 239000002253 acid Substances 0.000 description 4
- 239000003513 alkali Substances 0.000 description 4
- 244000052616 bacterial pathogen Species 0.000 description 4
- 238000000576 coating method Methods 0.000 description 4
- 230000009089 cytolysis Effects 0.000 description 4
- 238000010790 dilution Methods 0.000 description 4
- 239000012895 dilution Substances 0.000 description 4
- 238000000855 fermentation Methods 0.000 description 4
- 230000004151 fermentation Effects 0.000 description 4
- 239000002609 medium Substances 0.000 description 4
- 239000012528 membrane Substances 0.000 description 4
- 239000011780 sodium chloride Substances 0.000 description 4
- PEDCQBHIVMGVHV-UHFFFAOYSA-N Glycerine Chemical compound OCC(O)CO PEDCQBHIVMGVHV-UHFFFAOYSA-N 0.000 description 3
- 239000012880 LB liquid culture medium Substances 0.000 description 3
- HEMHJVSKTPXQMS-UHFFFAOYSA-M Sodium hydroxide Chemical compound [OH-].[Na+] HEMHJVSKTPXQMS-UHFFFAOYSA-M 0.000 description 3
- 241000191967 Staphylococcus aureus Species 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 230000000844 anti-bacterial effect Effects 0.000 description 3
- 239000011248 coating agent Substances 0.000 description 3
- 238000001816 cooling Methods 0.000 description 3
- 230000007613 environmental effect Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000001914 filtration Methods 0.000 description 3
- 239000001963 growth medium Substances 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000000746 purification Methods 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 239000008223 sterile water Substances 0.000 description 3
- 206010059866 Drug resistance Diseases 0.000 description 2
- 241000282414 Homo sapiens Species 0.000 description 2
- 241000607142 Salmonella Species 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000003912 environmental pollution Methods 0.000 description 2
- 230000003203 everyday effect Effects 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 239000011521 glass Substances 0.000 description 2
- 238000002955 isolation Methods 0.000 description 2
- 230000002934 lysing effect Effects 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 230000001018 virulence Effects 0.000 description 2
- 208000004998 Abdominal Pain Diseases 0.000 description 1
- 244000025254 Cannabis sativa Species 0.000 description 1
- 241001137855 Caudovirales Species 0.000 description 1
- 206010010071 Coma Diseases 0.000 description 1
- RYGMFSIKBFXOCR-UHFFFAOYSA-N Copper Chemical compound [Cu] RYGMFSIKBFXOCR-UHFFFAOYSA-N 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 206010012735 Diarrhoea Diseases 0.000 description 1
- 241000445924 Epiphyllum <angiosperm> Species 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 241001553290 Euphorbia antisyphilitica Species 0.000 description 1
- 208000005577 Gastroenteritis Diseases 0.000 description 1
- 101000884714 Homo sapiens Beta-defensin 4A Proteins 0.000 description 1
- 101001048716 Homo sapiens ETS domain-containing protein Elk-4 Proteins 0.000 description 1
- 101001092930 Homo sapiens Prosaposin Proteins 0.000 description 1
- 206010028813 Nausea Diseases 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 101150110933 PHY gene Proteins 0.000 description 1
- 206010037660 Pyrexia Diseases 0.000 description 1
- 238000010802 RNA extraction kit Methods 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 102100022483 Sodium channel and clathrin linker 1 Human genes 0.000 description 1
- 238000003917 TEM image Methods 0.000 description 1
- 241000607493 Vibrionaceae Species 0.000 description 1
- 206010047700 Vomiting Diseases 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 230000004071 biological effect Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000006285 cell suspension Substances 0.000 description 1
- 239000000919 ceramic Substances 0.000 description 1
- 239000003653 coastal water Substances 0.000 description 1
- 229910052802 copper Inorganic materials 0.000 description 1
- 239000010949 copper Substances 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 230000018044 dehydration Effects 0.000 description 1
- 238000006297 dehydration reaction Methods 0.000 description 1
- 230000008021 deposition Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000037213 diet Effects 0.000 description 1
- 235000005911 diet Nutrition 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 239000003085 diluting agent Substances 0.000 description 1
- 230000006806 disease prevention Effects 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 230000000857 drug effect Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000013505 freshwater Substances 0.000 description 1
- 238000012224 gene deletion Methods 0.000 description 1
- 238000012268 genome sequencing Methods 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000009364 mariculture Methods 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 239000004570 mortar (masonry) Substances 0.000 description 1
- 230000008693 nausea Effects 0.000 description 1
- 150000007523 nucleic acids Chemical group 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- IYDGMDWEHDFVQI-UHFFFAOYSA-N phosphoric acid;trioxotungsten Chemical compound O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.OP(O)(O)=O IYDGMDWEHDFVQI-UHFFFAOYSA-N 0.000 description 1
- 238000013081 phylogenetic analysis Methods 0.000 description 1
- 230000003449 preventive effect Effects 0.000 description 1
- 239000006041 probiotic Substances 0.000 description 1
- 230000000529 probiotic effect Effects 0.000 description 1
- 235000018291 probiotics Nutrition 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000004224 protection Effects 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000010008 shearing Methods 0.000 description 1
- 230000035939 shock Effects 0.000 description 1
- 230000007480 spreading Effects 0.000 description 1
- 238000003892 spreading Methods 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- QAOWNCQODCNURD-UHFFFAOYSA-N sulfuric acid Substances OS(O)(=O)=O QAOWNCQODCNURD-UHFFFAOYSA-N 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 230000008673 vomiting Effects 0.000 description 1
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof, wherein the bacteriophage is preserved in China center for type culture Collection in 2020, 9, month and 4 with the preservation number of CCTCC M2020465. The bacteriophage is a novel bacteriophage species of the subfamily Queuovirinae of the class of tailed bacteriophage, and the whole genome of the bacteriophage is OP331229.1 in the NCBI official GeneBank accession number. The phage has a wide bacterial phage spectrum, can simultaneously crack 6 different species of vibrios, can simultaneously crack 45 vibrio parahaemolyticus, 22 vibrio harveyi, 17 vibrio alginolyticus, 13 vibrio vulnificus, 11 vibrio campylobacter and 9 vibrio cholerae, can more effectively solve the infection problem of various bacterial diseases in aquaculture, and can be used as a microecological preparation for preventing and treating vibrio diseases of aquatic animals such as vibrio parahaemolyticus, vibrio harveyi, vibrio alginolyticus and the like.
Description
Technical Field
The invention relates to the technical field of aquatic product prevention and control, in particular to a novel bacteriophage for preventing and controlling vibrio diseases of aquatic animals and application thereof.
Background
Vibrio parahaemolyticus (Vibrio parahaemolyticus) belongs to the family Vibrionaceae, genus Vibrio, and is a halophilic gram-negative bacterium. Vibrio parahaemolyticus is widely present in various water environments, such as ocean, coastal and freshwater environments, is one of normal flora in mariculture environments and aquatic animal bodies, is an important pathogenic bacterium causing diseases of cultured animals, is a food-borne pathogenic bacterium spreading all over the world, can cause vibriosis of marine animals, can cause various gastroenteritis symptoms (such as abdominal pain, diarrhea, nausea, vomiting, fever and the like) after people eat foods polluted by the vibrio parahaemolyticus, and can cause dehydration, shock coma and even death of severe patients. Not only seriously threatens the diet health of human beings, but also causes huge economic loss to the aquaculture industry. At present, the prevention and treatment of vibrio parahaemolyticus in China mainly depends on antibiotics and some medicines, the phenomenon of abuse of the antibiotics is very serious, the problems of environmental pollution and generation of 'super bacteria' are brought, and the people pay more and more attention to the finding of environmental protection, safety and effective biological prevention and treatment measures along with the improvement of the environmental awareness of people and the implementation of the strategy of sustainable agriculture development.
The aquatic bacteriophage microecological preparation has the advantages of environmental friendliness, safety to non-target organisms, specific bactericidal effect on aquatic diseases and the like, is a green and environment-friendly product completely derived from nature unlike antibiotics and chemical preparations, is widely applied to the field of aquaculture and food safety, replaces antibiotics in the aquaculture industry for disease prevention and resistance, overcomes the problem of pathogenic bacteria drug resistance caused by excessive use of antibiotics, and becomes a hotspot of current biotechnology research. At present, chemical preparations such as antibiotics and the like have poor control effect on aquatic diseases, short drug effect and poor effect, and easily cause the enhancement of pathogenic drug resistance. The bacteriophage has high specificity to a host, and generally only can crack one host, so the narrow-spectrum bacteriophage generally cannot solve the problem of infection of various bacterial diseases in the aquaculture process. The phage 033B of the invention has a wide bacterial phage spectrum, can simultaneously crack 6 different hosts, can crack 45 strains of vibrio parahaemolyticus, 22 strains of vibrio harveyi, 17 strains of vibrio alginolyticus, 13 strains of vibrio vulnificus, 11 strains of vibrio campylobacter and 9 strains of vibrio cholerae, and can more effectively solve the problem of infection of various bacterial diseases in aquaculture. Meanwhile, the bacteriophage can not independently grow and propagate after leaving the host microorganism, and can not infect other organisms and human beings, thereby not generating biological hazard and environmental pollution. Therefore, the method for separating and screening the novel bacteriophage with high lytic capacity for bacteriostasis and sterilization is effective, has high safety and has great significance in aquatic organism control.
Disclosure of Invention
The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. The invention provides a novel bacteriophage for preventing and treating vibrio diseases of aquatic animals, the bacteriophage has wide bacteriophagosis spectrum, can simultaneously crack 6 different hosts, and can crack 45 strains of vibrio parahaemolyticus, 22 strains of vibrio harveyi and 17 strains of vibrio alginolyticus. Can more effectively solve the problem of infection of various bacterial diseases in aquaculture and has good application prospect.
Therefore, in the first aspect of the invention, the invention provides a novel bacteriophage for preventing and controlling vibrio diseases of aquatic animals, wherein the bacteriophage is preserved in China center for type culture Collection in 9-4.2020, with the preservation number of CCTCC M2020465, and is classified and named as: vibrioparahaemolyticus Phage 033B, deposited at: wuhan, wuhan university. The phage 033B obtained by separation and screening according to the invention has a wider bacteriophague spectrum, can simultaneously crack 6 different hosts, can crack 45 strains of vibrio parahaemolyticus, 22 strains of vibrio harveyi and 17 strains of vibrio alginolyticus, can effectively solve the problem of infection of various bacterial diseases in aquaculture, and has a good application prospect.
Alternatively, the bacteriophage is a new species of bacteriophage of the subclass Queuovirinae, leptophages, the whole genome of which is under NCBI's official GeneBank accession number OP331229.1.
Alternatively, the phage has 2 specific gene fragments whose nucleic acid sequences are shown in example 4. Therefore, the 2 specific gene segments can be used as typical characteristics for recognizing the bacteriophage.
Alternatively, the phage has 2 specific PCR amplification primers as shown in example 4. Thus, the 2 specific PCR amplification primers can be used as a typical feature for recognizing the phage.
In a second aspect of the invention, the invention provides a microecological preparation, which comprises the novel bacteriophage for preventing and treating vibrio diseases such as aquatic products vibrio parahaemolyticus, vibrio harveyi, vibrio alginolyticus and the like. According to the embodiment of the invention, the microecological preparation can be used for preventing and treating vibrio diseases such as aquatic vibrio parahaemolyticus, vibrio harveyi, vibrio alginolyticus and the like.
Optionally, the phage has a titer of 6.7X 10 11 pfu/mL。
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
FIG. 1 is a plaque map of bacteriophage 033B according to an embodiment of the present invention;
FIG. 2 is a transmission electron micrograph of bacteriophage 033B according to an embodiment of the present invention;
FIG. 3 is a phylogenetic tree diagram of bacteriophage 033B according to an embodiment of the invention;
FIG. 4 is a BLAST alignment at NCBI of bacteriophage 033B according to an embodiment of the invention;
FIG. 5 is an electrophoresis diagram showing PCR amplification products of 2 specific genes according to an embodiment of the present invention.
Detailed Description
The technical solution of the present invention is illustrated below by specific examples. It is to be understood that one or more method steps mentioned in the present invention do not exclude the presence of other method steps before or after the combination step or that other method steps may be inserted between the explicitly mentioned steps; it should also be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Moreover, unless otherwise indicated, the numbering of the various method steps is merely a convenient tool for identifying the various method steps, and is not intended to limit the order in which the method steps are arranged or the scope of the invention in which the invention may be practiced, and changes or modifications in the relative relationship may be made without substantially changing the technical content.
In order to better understand the above technical solutions, exemplary embodiments of the present invention are described in more detail below. While exemplary embodiments of the invention have been shown, it should be understood that the invention may be embodied in various forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
The invention will now be described with reference to specific examples, which are intended to be illustrative only and not to be limiting in any way.
Example 1 screening and purification of phage 033B
1. Isolation of pathogenic bacteria of grass shrimp and vibrio parahaemolyticus
Taking diseased grass shrimps in Fujian Zhangpu area, shearing the diseased grass shrimps, putting the diseased grass shrimps into a sterile culture dish, taking 50mL of 75% alcohol to wash the surfaces of the diseased grass shrimps, grinding the diseased grass shrimps by using a mortar, adding 4mL of sterile water to fully dissolve and uniformly mix the diseased grass shrimps, standing for 30min, taking 100 mu L of supernatant liquid, putting the supernatant liquid into a culture medium TCBS special for vibrio parahaemolyticus, and uniformly coating the supernatant liquid. Culturing at 32 deg.C for 12h, picking green colony, streaking and purifying on the same selective culture medium, repeatedly purifying for 3 times, picking single colony of strain with consistent morphology with inoculating loop, inoculating into LB liquid culture medium with 3% NaCl concentration, culturing at 32 deg.C for 12h, mixing 500 μ L of bacterial liquid with 500 μ L of 40% glycerol, and storing in-80 deg.C refrigerator.
2. Extended culture of Vibrio
Performing amplification culture of host bacteria, adding 3% NaCl into LB liquid culture medium, autoclaving at 121 deg.C for 20min, cooling to room temperature, adopting two inoculation methods, the first one is single colony inoculation, selecting single colony on the seed-preserving plate under aseptic condition for inoculation, fermenting at 32 deg.C, rotating at 150rpm, and fermenting for a period of time12h; the second inoculation method is liquid inoculation, and 10% of culture medium is added at a concentration of 10 8 cfu/mL of Vibrio parahaemolyticus solution to 3% NaCl concentration in LB liquid medium, fermenting at 32 deg.C, at 150rpm, for 12h.
3. Screening of phage 033B
Collecting water samples from 25 grass shrimp aquaculture ponds such as Zhangzhou, quanzhou, guangdong Zhanjiang and Hainan Haiko in Fujian province, respectively taking 1L of the cultured parahaemolytic vibrio liquid and the water samples to mix together by adopting a liquid-water sample mixing enrichment method, and then adding 1L of a fresh LB liquid culture medium with 3% NaCl concentration to perform enrichment culture overnight. Extracting the enriched liquid, centrifuging at 12000rpm for 10min, filtering twice with 0.22 μm filter membrane, and screening by coating spotting method to obtain bacteriophage. The phage is obtained by screening from water samples of grass shrimp ponds in fo broad-leaved epiphyllum county in Zhangzhou city in Fujian province.
4. Purification of phage 033B
Selecting individual plaques, incubating overnight in 1mL of SM buffer (Scientific Phygene), centrifuging at 12000rpm for 10min, filtering twice with 0.22 μm filter membrane, diluting to 10% by gradient dilution -6 First, a 100 μ L solution with a concentration of 4.5 × 10 is added 8 And (3) performing control on double-layer plates of cfu/mL host bacteria, taking 100 mu L of each of the host bacteria and the phage for each dilution gradient, mixing the double-layer plates, culturing at the constant temperature of 32 ℃ overnight, observing the growth condition of the plaques, and selecting single plaques to be purified for 3 times.
5. High temperature resistance assay for bacteriophage 033B
Taking 6 containers with 200mL of 7.8X 10 11 The triangular bottles of pfu/mL phage liquid were placed in water baths at 30 deg.C, 40 deg.C, 50 deg.C, 60 deg.C, 70 deg.C, and 80 deg.C, respectively, and after 12h of placement, the phage content after processing was calculated by double-layer plate mixing to determine the high temperature resistance of phage 033B. The results show that: phage 033B can survive for 12h at 70 ℃ and still have high content, and phage usually die in large amount or even all at 60 ℃, so that phage 033B has high temperature resistance.
Table 1: high temperature resistance assay for bacteriophage 033B
6. Acid and alkali resistance assay of phage 033B
Taking 7 containers 200mL of which the content is 6.6X 10 11 The pH values of the phages are respectively adjusted to 4, 5, 6, 7, 8, 9 and 10 by dripping concentrated sulfuric acid solution and sodium hydroxide solution into a triangular flask of pfu/mL phage liquid, the triangular flask is placed for 12 hours, and then the acid and alkali resistance of the phage 033B is determined by calculating the content of the treated phages through double-layer plate mixing. The results show that: phage 033B was still viable and high in concentration at pH 5 and 10, whereas phage generally died in large numbers or even all at pH 5 and 8, indicating that phage 033B has some acid and alkali resistance.
Table 2: acid and alkali resistance assay of phage 033B
7. Ultraviolet tolerance assay for bacteriophage 033B
In a clean bench, 12 containers with 10mL of 7.5X 10 11 A90 mm sterile culture dish of pfu/mL phage liquid is placed under an ultraviolet lamp (20w, 20cm) to be irradiated for 0, 1h, 2h, 3h, 4h, 5h, 6h, 7h and 8h, and the ultraviolet tolerance of phage 033B is determined by calculating the content of phage after ultraviolet irradiation through double-layer plate mixing. The results are shown in Table 3: phage 033B still survives under the ultraviolet irradiation for 8h, and the content is still high, while general phage die in large amount or even all under the ultraviolet irradiation for 2h, which indicates that phage 033B has strong ultraviolet tolerance.
Table 3: ultraviolet tolerance assay for bacteriophage 033B
8. Morphological characteristics of bacteriophage 033B
20 mu L of phage 033B enrichment solution is taken to be placed on a copper net, standing and adsorbing are carried out for 10min, redundant bacteria solution is sucked by filter paper, a proper amount of 3% phosphotungstic acid is taken to be dyed for 5min, and the obtained product is observed under a transmission electron microscope after being dried. As shown in FIG. 2, the screened phages were tailed phages, with a head shape of a regular icosahedron, a head length of 66.8. + -. 1.5nm, a head width of 66.5. + -. 1.2nm, and a tail length of 65.2. + -. 1.5nm.
Example 2
1. Optimal multiplicity of infection (MOI) assay for Vibrio parahaemolyticus by bacteriophage 033B
8 100mL portions of fresh LB liquid medium were taken and treated. Treatment 1 while adding 1mL of 10 6 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 9 pfu/mL phage solution, treatment 2 while adding 1mL 10 7 cfu/mL secondary hemolytic arc bacteria liquid and 1mL content of 10 9 pfu/mL phage solution, treatment 3 while adding 1mL phage solution with 10 content 8 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 9 pfu/mL phage solution, treatment 4 while adding 1mL 10 8 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 8 pfu/mL phage solution, treatment 5 while adding 1mL 10 8 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 7 pfu/mL phage solution, treatment 6 while adding 1mL 10 8 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 6 pfu/mL phage solution, treatment 7 while adding 1mL 10 8 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 5 pfu/mL phage solution, treated 8 while adding 1mL 10 8 cfu/mL secondary hemolytic arc bacteria liquid and 1mL content of 10 4 The phage titer was measured after culturing pfu/mL phage solution at 32 ℃ for 12 hours at 150 rpm. The results are shown in Table 4: the phage titer was highest when the optimal multiplicity of infection was 1.
Table 4: determination of the optimal multiplicity of infection (MOI) of Vibrio parahaemolyticus by phage 033B
2. Amplification culture of phage 033B
Carrying out amplification culture on the separated phage: preparation 3% of LB liquid medium 1L, autoclaving at 121 ℃ for 20min, cooling to room temperature, and adding 1mL of 10 9 cfu/mL secondary hemolytic arc bacterial liquid and 1mL of secondary hemolytic arc bacterial liquid with content of 10 7 putting pfu/mL phage liquid in a shaker at 32 ℃ and 150rpm for culturing for 12h, centrifuging at 8000rpm for 10min to settle host bacteria at the bottom, taking the upper clear part, and obtaining liquid which is phage 033B for enlarged culture.
3. Preparation of phage 033B microecological preparation
Preparation 3% of LB liquid medium 1L, autoclaving at 121 ℃ for 20min, cooling to room temperature, and adding 1mL of 10 9 cfu/mL vibrio parahaemolyticus liquid and 1mL vibrio parahaemolyticus liquid with content of 10 7 pfu/mL phage liquid is placed in a shaking table with the temperature of 32 ℃ and the rotating speed of 150rpm for 12 hours to serve as seed liquid, the seed liquid is firstly inoculated into a 50L fermentation tank, the seed liquid is inoculated into a 500L fermentation tank after the seed liquid is cultured for 12 hours under the fermentation condition with the temperature of 32 ℃ and the rotating speed of 150rpm, the obtained fermentation liquid is centrifuged for 10 minutes at 8000rpm to ensure that host bacteria are settled at the bottom, the upper clear part is taken, and then the supernatant is subjected to graded filtration by using 500nm and 200nm ceramic membranes to obtain the phage microecological preparation.
4. Assay for phage 033B
The phage was diluted to 10 -10 First, only 100. Mu.L of 9.1X 10-concentration solution is added 8 cfu/mL double-layer plates of Vibrio parahaemolyticus were compared from 10 -10 Starting the concentration, preparing a double-layer plate mixed plate by taking 100 mu L of phage diluent and 100 mu L of vibrio parahaemolyticus liquid at each concentration, culturing at constant temperature of 32 ℃ overnight, and calculating the phage content by observing the number of plaques. The results showed that the phage content was 6.7X 10 11 pfu/mL, high content and strong infection ability to vibrio parahaemolyticus.
Table 5: assay for phage 033B
5. Virulence gene or undesirable gene deletion detection assay for bacteriophage 033B
Bioinformatics analysis of phage 033B resulted in phage 033B not containing virulence genes or undesirable genes, as shown in table 6.
TABLE 6 phage 033B open reading frame
6. Phylogenetic analysis of phage 033B
As can be seen from the phylogenetic tree constructed by the whole genome of phage 033B (as shown in FIG. 3), phage 033B belongs to the same branch as the Vibrio phage genome with GeneBank accession NC-026610, but is not located on the same branch as other phage genomes.
Example 3 lytic ability and control Effect of bacteriophage 033B
1. Determination of the lytic Activity of phage 033B against Vibrio parahaemolyticus
Phage 033B was counted and diluted to 1X 10 cells respectively 8 、1×10 7 、1×10 6 、1×10 5 、1×10 4 pfu/mL 5 concentrations, with sterile water as a blank, three replicates for each concentration. Taking 6 tubes of cultured parahaemolytic vibrio parahaemolyticus, calculating the content of vibrio parahaemolyticus by dilution plate coating method before treatment, respectively adding 1mL of 5-concentration phage liquid and sterile water, culturing at 32 deg.C and 150r/min for 12h, and measuring by dilution plate coating methodThe content of treated Vibrio parahaemolyticus was calculated to determine the lytic ability of phage 033B to Vibrio parahaemolyticus. The result shows that the bacteriophage 033B has a better bactericidal effect on Vibrio parahaemolyticus, and the higher the concentration is, the better the effect is.
Table 7: determination of the lytic Activity of phage 033B on Vibrio parahaemolyticus
2. Host Spectrum assay for phage 033B
The phage host bacterium 033B and other vibrios are cultured, and the total number of strains is 167, wherein the strains comprise a vibrio parahaemolyticus strain 61, a vibrio harveyi strain 33, a vibrio alginolyticus strain 27, a vibrio vulnificus strain 19, a vibrio candelilii strain 15 and a vibrio cholerae strain 12. Culturing at 32 deg.C and 150r/min for 12h, and directly spotting to obtain 100 μ L of 3.8 × 10 8 The cfu/mL host cell suspension was uniformly applied to a 3% LB plate, and 20. Mu.L of the suspension was applied at a concentration of 5.3X 10 10 Dripping 4 spots of pfu/mL phage liquid on a plate, culturing overnight at 32 ℃, observing whether the plate has transparent plaques, and determining whether phage 033B has the capability of cracking 167 strains of vibrios.
The results are shown in Table 8: phage 033B can lyse 117 strains of 167 strains of Vibrio parahaemolyticus, 22 strains of Vibrio harveyi, 17 strains of Vibrio alginolyticus, 13 strains of Vibrio vulnificus, 11 strains of Vibrio campylobacter and 9 strains of Vibrio cholerae, the lysis rate is 70.06%, and the lysis capacity to Vibrio is strong. 5363 infection experiment of 26 strains of Vibrio (Vibrio parahaemolyticus, vibrio cholerae and Vibrio alginolyticus) in the Vibrio cholerae SWBC-a target bacteria screening wide lytic vibrio phage of Yang Jixia shows that the phage SWBC-a-3 can only lyse 3 strains of Vibrio. Wang Jingfeng phage VB _ VpP BT-1011, screening method and application in the phage VB _ VpP _ BT-1011 lysis experiment on 8 strains of Vibrio parahaemolyticus and 16 other strains, only 1 strain of Vibrio parahaemolyticus can be lysed. Chen Yibao research on the isolation and identification of Salmonella virulent phages and their biological properties 15 Salmonella strains were tested for infection and only 2 of them were lysed. "separation and identification of wide spectrum lytic vibrio alginolyticus bacteriophage phi V170 and biological characteristics" in Fuhanqing, phi V170 can only lyse 7 strains of vibrio alginolyticus. Zhang Zhihong, in the research on the specificity of a lysis profile and molecular classification of a staphylococcus aureus bacteriophage, infection experiments are carried out on 37 strains of staphylococcus aureus and 74 strains of other species, and the bacteriophage vB _ SauH _ SAP1 is found to be only capable of lysing 10 strains of staphylococcus aureus. Therefore, the bacteriophage has strong specificity, generally only can crack 1 host, and in practical application, the narrow-spectrum bacteriophage is difficult to play a role in solving the problem of infection of various bacterial diseases in the aquaculture process, while the 033B bacteriophage of the invention can simultaneously crack 6 different hosts, and can simultaneously crack 45 strains of vibrio parahaemolyticus, 22 strains of vibrio harveyi, 17 strains of vibrio alginolyticus, 13 strains of vibrio vulnificus, 11 strains of vibrio candelilla and 9 strains of vibrio cholerae. Therefore, compared with other phages, the phage 033B of the invention has stronger lytic capacity and wider host spectrum, and can effectively solve the problem of infection of various bacterial diseases in aquaculture in practical application.
TABLE 8 host spectra of phage 033B
3. Measurement of Vibrio control effects of broad-spectrum phage 033B and narrow-spectrum phage
Culturing Vibrio parahaemolyticus VP033 bacterial liquid, vibrio harveyi VH502 bacterial liquid and Vibrio alginolyticus VA504, and respectively taking 500mL of the bacterial liquid with the concentration of 3.8 multiplied by 10 8 cfu/mL of supernatant. Phage 033C and 033E capable of lysing only Vibrio parahaemolyticus VP033 were cultured by taking 500mL of 3.9X 10 phage 033 cells, respectively 10 pfu/mL of phage liquid.
150 prawns (24.0 + -2.2 g) were taken and divided into 5 treatment groups of three replicates each of which was 10 prawns, placed in a glass aquarium (60L capacity) and 40L of water was added. The group A is treated as a blank control without treatment, the group B is treated and added with 100mL of prepared supernatants of vibrio parahaemolyticus, vibrio alginolyticus and vibrio harveyi respectively, the group C is treated and added with 100mL of prepared supernatants of vibrio parahaemolyticus, vibrio alginolyticus and vibrio harveyi respectively and 100mL 033C phage liquid simultaneously, the group D is treated and added with 100mL of prepared phage liquid of vibrio parahaemolyticus, vibrio alginolyticus and vibrio harveyi respectively and 100mL033E phage liquid simultaneously, the group E is treated and added with 100mL of prepared phage 033B preparation in the embodiment 2 respectively, the growth condition of the prawns is observed every day and the number of dead prawns in each group is recorded.
The control effect of broad-spectrum phage 033B and narrow-spectrum phage 033C and 033E on vibrio parahaemolyticus is shown in Table 9, and no penaeus orientalis died when group A is treated; when the group B is treated for 3d, 14 prawns die, the death rate is 46.67 percent, 29 prawns die after 7d, and the death rate is up to 96.67 percent; 9 grass shrimps die at 3d in the group C, the death rate is 30 percent, 17 grass shrimps die after 7d, and the death rate is 56.67 percent; when the group D is treated for 3D, 11 prawns die, the death rate is 36.67 percent, and 19 prawns die after 7D, the death rate is 63.33 percent; the 3d grass shrimps in the group E died 2, the mortality rate was 6.67%, and the 7d grass shrimps died 3, the mortality rate was 10%. By comparison, it was found that 7D post-treatment E had 86.67% less mortality than treatment B, 46.67% less mortality than treatment C, and 53.33% less mortality than treatment D. The results show that: in actual application, the broad-spectrum phage 033B microecological preparation has obvious advantages compared with narrow-spectrum phage 033C and 033E, can obviously reduce the death rate of the prawns, reduces the harm brought by vibrio parahaemolyticus, vibrio harveyi and vibrio alginolyticus in aquaculture, and has obvious treatment effect.
TABLE 9 measurement of Vibrio control Effect of broad-spectrum phage 033B and narrow-spectrum phage
(4) Determination of preventive and therapeutic effects of phage 033B probiotic on Vibrio parahaemolyticus
150 prawns (24.0 + -2.2 g) were taken and divided into 4 treatment groups of three replicates each of which was 10 prawns, placed in a glass aquarium (60L capacity) and 40L of water was added. The group A was treated as a blank control without treatment, the group B was treated by adding 100mL of prepared Vibrio parahaemolyticus supernatant, the group C was treated by adding 100mL of prepared Vibrio parahaemolyticus supernatant and 100mL of phage 033B preparation of example 2, the group D was treated by adding 100mL of phage 033B preparation of example 2 for 3D and then 100mL of prepared Vibrio parahaemolyticus supernatant, the group E was treated by adding 100mL of phage 033B preparation, the growth of the prawns was observed every day and the number of dead prawns in each group was recorded.
The control effect of phage 033B preparation on vibrio parahaemolyticus disease of penaeus orientalis is shown in Table 10, and no penaeus orientalis died when group A and group E are treated; 13 shrimps die after 3d of the group B treatment, the death rate is 43.33 percent, 28 shrimps die after 7d, and the death rate is up to 93.33 percent; the 3D grass shrimps in the group C died 1, the mortality rate was only 3.33%, the 7D grass shrimps died 2, the mortality rate was only 6.66%, the 3D grass shrimps in the group D died 0, the mortality rate was 0%, the 7D grass shrimps died 1, and the mortality rate was only 3.33%. Through comparison, the mortality rate of C group prawns is reduced by 86.67% compared with B group after 7D, the fact that the phage 033B microecological preparation has a good treatment effect on the vibrio parahaemolyticus diseases of the prawns is proved, the mortality rate of D group prawns is reduced by 90% compared with B group after 7D, the advance prevention effect is obvious, the fact that the phage 033B microecological preparation has a good prevention effect on the vibrio parahaemolyticus diseases of the prawns is proved, and the fact that no prawns are killed in E group proves that the phage 033B microecological preparation has no influence on the growth of the prawns. Thus, the results show that: the phage 033B microecological preparation has no influence on the growth of the grass shrimps, and has obvious prevention and treatment effects on the vibrio parahaemolyticus diseases of the grass shrimps.
Table 10: prevention and treatment effect of phage 033B microecological preparation on vibrio parahaemolyticus diseases of penaeus orientalis
Example 4 phage 033B Whole genome assay and analysis
1. Purification of phage 033B
2mL of 033B phage liquid is taken, the 033B phage liquid is centrifuged at 8000rpm for 10min, and the supernatant is taken, filtered twice by a 0.22-micron filter membrane and then placed in a refrigerator for storage at 4 ℃.
2. Extraction of phage 033B genomic DNA
The phage extracted from the separated and purified phage was extracted from phage genome DNA/RNA using phage genome DNA/RNA extraction kit from Tiangen Biotechnology (Beijing) Ltd, and sent to Meiji organism (Shanghai) Ltd for sequencing.
3. Phage 033B whole genome sequence analysis
Through third-generation genome sequencing of a Pacbio platform, the whole length of the whole genome sequence of the screened phage 033B is 55858bp, and the whole genome sequence is linear double-stranded DNA. BLAST was performed on the genome sequence at the NCBI official website, and the alignment results showed that the coverage rate of the alignment with the genome sequence of the closest Vibrio parahaemolyticus phage (GeneBank accession No.: KM 378617.2) was 81%, and the homology was 92.71%; next, the alignment coverage with the genomic sequence of Vibrio parahaemolyticus phage (GeneBank accession number: MG 592667.1) was 2% and the homology was 72.97%. Phage 033B was identified by genome alignment as a new species of phage of the class caudal phage, subfamily Queuovirinae, and the entire genome was uploaded to the NCBI's official website and acquired GeneBank accession number OP331229.1. Phage 033B has been deposited at the China center for type culture Collection in Wuhan at 9/4/2020 with the deposition number CCTCC M2020465.
The difference between the phage 033B genome and the two phage genome sequences with the highest homology was found by DNAMAN 7 software to obtain specific gene fragments D1 and D2 (Primer Premier6 software was used to design specific PCR amplification primers and sent to Bodhisan Biotechnology (Shanghai) Co., ltd. For Primer synthesis, the results are shown in FIG. 5.
Wherein, the specific PCR amplification primer is as follows:
D1F:5’-CTTGCTCGGCTTCTCTAAT-3’；
D1R:5’-CGCTGGATTGTGGTGTAA-3’；
D2F:5’-GATAGTGAAGAAGATGGAATGG-3’；
D2R:5’-GTTGAAGACGACGCTGTA-3’；
wherein, the specific gene segments are as follows:
D1:CTTGCTCGGCTTCTCTAATGAGATGCCATACCAAGTATCAGTCTTCCGTGGGGAGGTCGGCGGTACTAGTT GGGTACTGAACTGGCAAGGGCGCGTCATCTCATCAAAAGCCAATGGCGATATCATCGACGTTGAATGTGAATCGCTTT ACACCACAATCCAGCG
D2:GATAGTGAAGAAGATGGAATGGACATCGAGGACTTCAGAAAAGATAAGAGACTGCGGCTCTTTAGGCTGAT GGTTTTTAATCACGGGTTACCTCCGTATCGATCAGATTGTAAGAAAAGTGGCGAAGGCATGGAACGCAAACAAAACCCGATTATGTAGTGCACCTTCGCCTAAAAAGGGGAGTCGAAACTCCCCTAAAACCTAGCGACTGTTGTTGTTATACAGCGTCGTCTTCAAC
in conclusion, according to the embodiment of the invention, the phage 033B is separated and screened from the water sample of the grass and shrimp pond in Zhangzhou yellow-eyeing county area in Fujian province, has high bactericidal activity on vibrio parahaemolyticus, vibrio harveyi, vibrio alginolyticus and the like, has a wide bacteriophagic spectrum, can simultaneously lyse 6 different types of vibrio, can lyse 45 strains of vibrio parahaemolyticus, 22 strains of vibrio harveyi, 17 strains of vibrio alginolyticus, 13 strains of vibrio vulnificus, 11 strains of vibrio campylonii and 9 strains of vibrio cholerae, and can more effectively solve the problem of infection of various bacterial diseases in aquaculture.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example" or "some examples" or the like are intended to mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above should not be understood to necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples described in this specification can be combined and combined by those skilled in the art.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.
Claims (6)
1. The novel bacteriophage for preventing and treating vibrio diseases of aquatic animals is characterized in that the bacteriophage is preserved in China center for type culture Collection in 2020, 9, 4 and with the preservation number of CCTCC M2020465.
2. The bacteriophage of claim 1, wherein said bacteriophage is a new species of bacteriophage of the subclass Queuovirinae, leptophagae, having a whole genome at NCBI's official GeneBank accession No. OP331229.1.
3. The bacteriophage of claim 1, wherein said bacteriophage has 2 specific gene segments as set forth in example 4.
4. The bacteriophage of claim 1, wherein said bacteriophage has 2 specific PCR amplification primers as set forth in example 4.
5. A microecological preparation comprising the novel bacteriophage for controlling Vibrio diseases in aquatic animals according to claim 1.
6. The microecological formulation according to claim 5, wherein the phage has a titer of 6.7 x 10 11 pfu/mL。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211557697.3A CN115786277A (en) | 2022-12-06 | 2022-12-06 | Novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211557697.3A CN115786277A (en) | 2022-12-06 | 2022-12-06 | Novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115786277A true CN115786277A (en) | 2023-03-14 |
Family
ID=85418769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211557697.3A Pending CN115786277A (en) | 2022-12-06 | 2022-12-06 | Novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115786277A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117778333A (en) * | 2023-12-27 | 2024-03-29 | 厦门昶科生物工程有限公司 | Vibrio vulnificus phage 13VV501A, microecological preparation and application thereof |
| CN118028248A (en) * | 2024-02-01 | 2024-05-14 | 瑞科盟(青岛)生物工程有限公司 | High-schizolysis vibrio harveyi phage and application thereof |
| CN118028249A (en) * | 2024-02-01 | 2024-05-14 | 瑞科盟(青岛)生物工程有限公司 | High-temperature-resistant vibrio cholerae phage and application thereof |
-
2022
- 2022-12-06 CN CN202211557697.3A patent/CN115786277A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117778333A (en) * | 2023-12-27 | 2024-03-29 | 厦门昶科生物工程有限公司 | Vibrio vulnificus phage 13VV501A, microecological preparation and application thereof |
| CN118028248A (en) * | 2024-02-01 | 2024-05-14 | 瑞科盟(青岛)生物工程有限公司 | High-schizolysis vibrio harveyi phage and application thereof |
| CN118028249A (en) * | 2024-02-01 | 2024-05-14 | 瑞科盟(青岛)生物工程有限公司 | High-temperature-resistant vibrio cholerae phage and application thereof |
| CN118028248B (en) * | 2024-02-01 | 2024-10-18 | 瑞科盟(青岛)生物工程有限公司 | High-schizolysis vibrio harveyi phage and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107686832B (en) | Novel vibrio parahaemolyticus bacteriophage, and composition, preparation method and application thereof | |
| CN115786277A (en) | Novel bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof | |
| CN113583972B (en) | Escherichia coli bacteriophage capable of reducing antibiotic resistance and application thereof | |
| CN109825479A (en) | A kind of wide range salmonella bacteriophage LPSTLL and application | |
| CN115717128A (en) | Vibrio cholerae bacteriophage for preventing and treating vibrio diseases of aquatic animals and application thereof | |
| CN113430173B (en) | Wide-cracking-spectrum high-temperature-resistant salmonella bacteriophage and application thereof | |
| CN114717199B (en) | Salmonella phage CKT1 without drug resistance gene transduction capability and application thereof | |
| CN114561363B (en) | Vibrio phage PC-Liy1 with cross-species lysis capability, preparation method and application | |
| CN115505577A (en) | Novel bacteriophage for preventing and treating escherichia coli and salmonella diseases of poultry animals and application thereof | |
| CN112375712A (en) | Lactococcus lactis and application thereof | |
| CN112574959B (en) | Bacteriophage for preventing and treating aeromonas disease of aquatic animals and microecological preparation | |
| CN115927206A (en) | Cross-species lytic Cronobacter bacteriophage and application thereof | |
| CN113293143B (en) | Salmonella bacteriophage capable of reducing vertical transmission of salmonella pullorum and application thereof | |
| CN113583966B (en) | Salmonella furciosus bacteriophage and application thereof | |
| CN117070471A (en) | Multivalent salmonella phage capable of entering blood orally and application thereof | |
| CN117070472A (en) | Vibrio parahaemolyticus phage aiming at highly pathogenic vibrio and drug-resistant vibrio and application thereof | |
| CN109666652B (en) | Wide-host-spectrum mermaid photobacterium bacteriophage and application thereof | |
| CN115161290B (en) | Vibrio alginolyticus phage with wide cleavage spectrum and application thereof | |
| CN113444695B (en) | Escherichia coli bacteriophage with high fermentation efficiency and good clinical effect and application thereof | |
| CN116286520A (en) | Lactobacillus plantarum E2 and application thereof in preventing and treating visceral ichthyophthiriasis of large yellow croaker | |
| CN116042541A (en) | Vibrio alginolyticus phage GRNRZ-P25 and application thereof | |
| CN112538463B (en) | Novel aeromonas hydrophila phage, and composition, kit and application thereof | |
| CN114196637A (en) | Salmonella phage (salmonella sp. phase) JNwz02 and application thereof | |
| CN117778333B (en) | Vibrio vulnificus phage 13VV501A, microecological preparation and application thereof | |
| CN118240772A (en) | Vibrio parapsilosis phage 13KS502A and application, composition and microecological preparation thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |