CN115786270A - Engineered macrophages and their use in the treatment of fibrotic diseases - Google Patents

Abstract

The invention relates to the fields of molecular biology, genetic engineering, immune cell therapy and biomedicine, in particular to an engineered macrophage for continuously secreting or over expressing an anti-inflammatory factor and/or an anti-fibrotic protein, a construction method thereof and application thereof in treating fibrotic diseases. The invention utilizes the method of genetic engineering to construct the TbetaR which can express the fibrosis inhibiting factor IL-10 and the TGF-beta antagonistic protein _2‑ Fc or CD147 recombinant plasmid, slow virus package, macrophage infection, and continuous secretion of IL-10 and T beta R ₂ -Fc and CD147 engineered macrophages. The method can effectively enhance the stability of the anti-inflammatory factor and/or anti-fibrosis protein biomacromolecule medicine in vivo, prolong the duration of the medicine effect, realize the effective delivery of the medicine, provide a new thought for the administration route of the protein biomacromolecule medicine, can be used for the immunotherapy of treating the fibrosis diseases, and has good safety, strong action effect, very high application value and clinical transformation prospect.

Description

Engineered macrophages and their use in the treatment of fibrotic diseases

Technical Field

The invention relates to the fields of molecular biology, genetic engineering, immune cell therapy and biomedicine, in particular to an engineered macrophage secreting anti-fibrotic protein, a construction method thereof and application thereof in treating fibrotic diseases.

Background

Fibrosis is a common scarring response associated with chronic injury caused by long-term parenchymal cell injury and/or inflammation, which may be caused by a variety of factors, such as drugs, toxins, radiation, any process that interferes with tissue or cellular homeostasis, toxic injury, altered blood flow, infections (viruses, bacteria, spirochetes, and parasites), sedimentary disorders, and disorders that lead to the accumulation of toxic metabolites. Fibrosis is most common in the liver, heart, lung, peritoneum and kidney.

Pulmonary Fibrosis (PF) is a life-threatening interstitial disease of the lung, with an overall incidence of around 1/10 000 from a global perspective. The incidence and prevalence of PF has generally increased over the past 10 years. Including pulmonary fibrosis caused by secondary factors such as bleomycin, silicon dioxide, paraquat and the like and pulmonary fibrosis of unknown reasons. The formation of PF is caused by lung tissue damage and repair imbalance, fibrotic scar tissue is formed, lung tissue structure is remodeled, lung ventilation-blood flow ratio is disordered, and finally respiratory failure is developed. The treatment of pulmonary fibrosis is mainly focused on the treatment of complications, and the use of glucocorticoids, immunosuppressive agents and anti-oxidant drugs has little effect on the improvement of fibrosis and serious side effects. Lung transplantation is a means for radically treating pulmonary fibrosis, but is very limited due to few donors. Therefore, there is an urgent need to develop a new generation of drugs and methods for treating pulmonary fibrosis.

Interleukin-10 (IL-10) is a potent anti-inflammatory, anti-fibrotic cytokine, making it an attractive therapeutic candidate for pulmonary fibrosis. Studies have shown that transforming growth factor-beta 1 (TGF-beta 1) is a mediator that plays a key role in the development and progression of pulmonary fibrosis, and it binds mainly to the extracellular domain of transforming growth factor-beta 1 type II receptor (Ex-T β RII), thereby activating downstream signaling leading to pulmonary fibrosis. It has been reported in the literature that blocking the binding of TGF- β 1 to Ex-T β RII by using TGF- β type II receptor (T β RII) or anti-TGF- β 1 antibodies is an option for improving pulmonary fibrosis. The synthesis and degradation of ECM is mainly regulated by Matrix Metalloproteinases (MMPs) and Tissue Inhibitors of Metalloproteinases (TIMPs). Macrophages are important sources of MMP, kupffer Cells (KCs) can express various matrix metalloproteinases, such as MMP-9, MMP-12, MMP-13 and the like to degrade the matrix, and are beneficial to repairing liver injury and fibrosis. Research shows that the mouse can obviously relieve hepatic fibrosis by infusing bone marrow-derived macrophages, improve liver function CD147, and the activation of CD147 in the macrophages by inducing membrane molecules vital to ECM reconstruction by MMP is a feasible method for activating MMPs and degrading ECM.

Macrophages are present in almost all tissues and serve as the first line of defense for the body, where they phagocytose invading pathogenic microorganisms and initiate an immune response. In lung tissue, there are two types of macrophages, alveolar macrophages (alveolars) and interstitial macrophages (interstitial), respectively, with alveolar macrophages accounting for the majority in number. These macrophages maintain the homeostatic balance of lung tissue by phagocytosing alveolar deposition proteins and foreign particles or antigens, secreting cytokines, and antigen presentation. Therefore, a range of pulmonary diseases are associated with abnormal function and number of these macrophages. During the development of pulmonary fibrosis, macrophages also play a key role. It is generally thought that pulmonary fibrosis is often caused by inflammation resulting from infection or injury. In the stage of lung infection or injury, macrophages are induced to promote the classical activation of inflammation or type M1, and secrete proinflammatory factors such as tumor necrosis factor (TNF- α), interleukin-1 (IL-1), IL-6, etc. to maintain the inflammatory state of lung tissue. After progressive elimination of proinflammatory factors and progressive regression of the inflammatory state, macrophages are instead polarized to the M2 type that inhibits inflammation and promotes tissue repair. In the tissue repair process, M2-type macrophages promote transformation (EMT) of epithelial cells into myofibroblasts (myofibroblasts) by secreting transforming growth factor (TGF- β), platelet-derived growth factor (PDGF) and the like, and the myofibroblasts excessively proliferate in the lung interstitium and ruptured alveolar spaces and secrete excessive extracellular matrix such as collagen, and finally cause fibrosis of lung tissues. In conclusion, macrophages exert a promoting effect both in the initial and in the progressive stages of pulmonary fibrosis.

Various cytokines or cytokine derivatives have been reported to inhibit the development of pulmonary fibrosis. For example, the well-known anti-inflammatory factor IL-10 inhibits both the inflammatory response during the initial stages of fibrosis and the secretion of collagen during the formation of fibrosis. However, the very short half-life of IL-10 (only 1-2 minutes in peripheral blood) limits its action. Therefore, the improvement of the concentration and the duration of therapeutic proteins such as IL-10 in lung tissues becomes a key problem which needs to be solved urgently for treating pulmonary fibrosis. Inflammation and immune disorder are considered as main factors for the occurrence and development of pulmonary fibrosis, and are inspired by the key role of macrophages in the inflammatory and immune disease processes, especially the ability to mediate and respond to inflammatory stimuli and immune factors related to fibrosis, so that the macrophages show potential application value as delivery carriers of anti-fibrosis drugs.

Disclosure of Invention

In view of the problems in the prior art, the invention provides an engineered macrophage secreting anti-fibrosis protein, a construction method thereof and application thereof in treating fibrotic diseases.

In order to achieve the purpose, the invention adopts the following technical scheme.

An engineered macrophage capable of sustained secretion or overexpression of an anti-fibrotic protein.

Further, the anti-fibrotic protein is IL-10, transforming growth factor-beta type II receptor (T beta R2-FC/TGFRcFC), or CD147.

The preparation method of the engineered macrophage is to construct a virus expression system containing the anti-fibrosis protein gene and integrate the anti-fibrosis protein gene into the macrophage by utilizing the virus expression system.

Further, the preparation method of the engineered macrophage comprises the following steps: the macrophage expresses IL-10, T beta R2-FC or CD147 protein to obtain the macrophage expressing IL-10, T beta R2-FC or CD147 protein.

Furthermore, the expression of IL-10, T beta R2-FC or CD147 protein by the macrophage refers to the fact that a recombinant vector containing genes for coding IL-10, T beta R2-FC or CD147 protein is introduced into the macrophage to obtain the macrophage for expressing IL-10, T beta R2-FC or CD147 protein.

Further, the recombinant vector is a recombinant lentiviral vector.

Further, the method comprises the steps of: step 1, transfecting a lentivirus packaging cell by using the recombinant lentivirus vector and the lentivirus packaging plasmid, and culturing to obtain lentivirus; step 2, infecting macrophages with the lentivirus obtained in step 1 to obtain macrophages expressing IL-10, tbeta R2-FC or CD147 protein.

Further, the preparation method of the engineered macrophage comprises the following steps: the recombinant plasmid for expressing IL-10 and T beta R2-FC is constructed by using a genetic engineering method, and virus is packaged to infect macrophage, so that the macrophage can continuously and stably express IL-10 or T beta R2-FC or CD147.

Further, the macrophage is RAW264.7 cell.

The application of the macrophage and the macrophage prepared by the method in preparing a product for treating fibrotic diseases.

Further, the fibrotic disease is pulmonary fibrosis, lung injury, cardiac fibrosis, or liver fibrosis.

A product for treating a fibrotic disease, said product comprising said macrophage and said macrophage produced by said method.

A cell population comprising said engineered macrophage.

A cell therapy product comprising the engineered macrophage.

Further, the cell therapy product may also comprise one or more than one cell mediator component and/or therapeutic compound.

Further, the cell therapy product further comprises an effective amount of one or more of alpha-tocopherol, interferon-gamma, quercetin, an ACE inhibitor, and PPAR-delta.

Further, the cell therapy product may also contain pharmaceutical agents and/or excipients suitable for therapeutic use.

A method of treating fibrosis in an individual comprising administering the cell therapy product.

Further, the fibrosis is liver fibrosis, cardiac fibrosis or pulmonary fibrosis.

Further, the cell therapy product is administered to the individual by injection.

Further wherein the cell therapy product is injected into a fibrotic lesion.

Further wherein the cell therapy product comprising the engineered macrophage is from the individual.

A method of reversing fibrosis in an individual in need thereof, comprising: administering to the individual a genetically engineered macrophage capable of expressing a recombinant IL-10, tbetaR 2-FC, or CD147 protein; targeting macrophages to the lung, heart or liver of an individual; and reversing fibrosis in the lung.

Compared with the prior art, the invention has the following beneficial effects.

The invention utilizes a genetic engineering method to construct recombinant plasmids capable of expressing fibrosis inhibiting factors IL-10, T beta R2-Fc or CD147, packages lentiviruses and infects RAW264.7 macrophages, thereby obtaining engineered macrophages RAW-IL10, RAW-T beta R2-Fc or RAW-CD147 capable of continuously secreting IL-10, T beta R2-FC or CD147. The engineering macrophage is injected into the lung to treat the pulmonary fibrosis in a nasal dropping mode, and the method has remarkable advantages. On one hand, the nasal drip mode is simple and convenient to operate, only 1-2 times of administration is needed, repeated administration is avoided, and compared with the administration modes such as intratracheal injection, intraperitoneal injection and the like, the nasal drip mode has small damage and is not easy to cause new infection. Administration of empty plasmid-transfected macrophages (RAW-Con cells, which act substantially similarly to normal macrophages) may, in contrast, exacerbate the degree of pulmonary fibrosis as compared to administration of genetically engineered macrophages, presumably because macrophages are more induced to differentiate into M2 type during the fibrotic phase, and the presence of a large number of M2 type macrophages leads to an imbalance in lung tissue damage repair leading to tissue remodeling and collagen formation. Therefore, it is necessary to modify macrophages.

The engineered macrophage is used for treating the pulmonary fibrosis of the mouse, the expression of pulmonary fibrosis markers COL1A1, alpha-SMA, vimentin and the like can be obviously reduced, and the engineered macrophage can effectively improve the pulmonary fibrosis.

The macrophage is used as a delivery carrier, so that the drug can be effectively delivered to the lung, and the macrophage has little systemic toxicity and is safer. It is expected that this approach may provide a better choice for targeted delivery of anti-fibrotic drugs while minimizing the occurrence of side effects. From clinical application, according to the pathophysiological characteristics of different stages in the pulmonary fibrosis formation process, the influence on the pulmonary fibrosis of the mice is researched by adopting a cell administration mode, a satisfactory result is obtained, and an effective reference is provided for clinical treatment of the pulmonary fibrosis.

Drawings

FIG. 1 is a schematic diagram of the experimental design of the treatment of BLM-induced lung Injury (IPF) by Con-M.

Figure 2 is a record of body weight and lung wet weight of mice.

FIG. 3 is a micro-computed tomography (micro-CT) image and a CT fibrosis score plot.

FIG. 4 is a histological evaluation, hematoxylin and eosin (H & E) staining and representative photomicrograph of Con-M treatment of IPF; ashcroft scores of mouse lung sections were induced with sham controls and BLM for indicated treatment, showing 10 x lung lobe images; evaluation of collagen deposition by Masson's trichrome staining of lung tissue sections, 10 x lung lobe images are shown.

Fig. 5 is HYP content expressed in lung tissue (n = 5-10).

FIG. 6 is RT-PCR analysis of COL1A1 and FSP-1 mRNA levels in lung tissue (n = 5-10). All experiments were performed in triplicate, and each replicate was repeated at least three times. Bars represent the ± standard error of the mean.

FIG. 7 shows the measurement of IL-10 content in the supernatants of IL-10-M and Con-M by ELISA.

FIG. 8 is a schematic diagram of the experimental design of IL10-M on BLM-induced lung Injury (IPF).

Figure 9 is a record of body weight of each group of mice.

Figure 10 is a record of the wet weight of the right lung for each group of mice.

FIG. 11 is a micro-computed tomography (micro-CT) image and a CT fibrosis score plot.

Figure 12 is a histological evaluation of IL10-M treatment versus IPF, representative photomicrograph of hematoxylin and eosin staining (H & E) and Ashcroft scores for Sham control and BLM-induced mouse lung sections, showing 10 x lung lobe images; evaluation of collagen deposition by Masson's trichrome staining of lung tissue sections.

Fig. 13 is an analysis of IL-10 mRNA levels in lung tissue using RT-PCR (n = 5-7).

FIG. 14 shows the measurement of IL-10 and TGF- β concentrations in lung homogenates by ELISA at day 7.

Fig. 15 shows the amount of HYP expression in lung tissue (n = 5-10).

FIG. 16 is an analysis of the mRNA levels of COL1A1 and FSP-1 in lung using RT-PCR (qPCR) (n = 5-10). All experiments were performed in triplicate, and each replicate was repeated at least three times. Bars represent the ± standard error of the mean.

FIG. 17 is a Western blot analysis of TGFRcFC proteins in TGFRcFC and control 293T or RAW264.7 cells.

FIG. 18 is TGFRcFC-M supernatant inhibiting TGF-. Beta./Smad signaling pathway. MLE and RAW264.7 cells were treated as required, cells were collected, and p-Smad2/3 and Smad2/3 were detected by Western blot.

FIG. 19 is a schematic diagram of experimental design of TGFRcFC-M on blm-induced lung Injury (IPF).

Figure 20 is a record of body weight of each group of mice.

FIG. 21 is a record of the wet weight of the right lung for each group of mice.

FIG. 22 is a micro-computed tomography (micro-CT) image and CT fibrosis score.

Figure 23 is a histological evaluation of TGFRcFC-M treatment versus IPF, representative photomicrographs of hematoxylin and eosin (H & E) staining and Ashcroft scores of Sham control and BLM-induced mouse lung sections, showing 10 x lung lobe images.

FIG. 24 is a lung tissue section Masson's trichrome stain to assess collagen deposition.

FIG. 25 is an ELISA assay for TGF-. Beta.concentration in lung homogenates.

Fig. 26 shows the HYP expression level in lung tissue (n = 5-10).

FIG. 27 is an analysis of COL1A1 and FSP-1 mRNA levels in lung using RT-PCR (qPCR) (n = 5-10). All experiments were performed in triplicate, and each replicate was repeated at least three times. Bars represent the ± standard error of the mean.

FIG. 28 is RT-PCR analysis of mRNA levels of CD147 or MMPs in CD147-M and Con-M cells. Where A is the mRNA level of CD147 and B is the mRNA level of MMPs.

FIG. 29 is a graphical representation of the experimental design of CD147-M vs. BLM-induced lung Injury (IPF).

Figure 30 is a record of body weight of mice in each group.

FIG. 31 is a comparison of the right lung weights of groups of CD147-M and PBS-BLM mice.

FIG. 32 is CD147-M mouse group Micro-CT images and CT fibrosis scores.

FIG. 33 is a histological evaluation of CD147-M treatment of IPF, representative photomicrograph of hematoxylin and eosin staining (H & E); ashcroft scores of mouse lung sections were induced with sham controls and BLM for indicated treatment, 10 x lung lobe images are shown.

FIG. 34 is a lung tissue section Masson's trichrome stain to assess collagen deposition.

Fig. 35 is mRNA levels (n = 5-7) of mRNA levels of CD147 in lungs and MMPs in lungs analyzed by RT-PCR.

Fig. 36 shows the HYP expression level in lung tissue (n = 8-10).

FIG. 37 is an analysis of COL1A1 and FSP-1 mRNA levels in lungs by qPCR (n = 5-10).

Detailed Description

The invention will be further explained with reference to the following embodiments. The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The experimental procedures in the following examples are all conventional ones unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. In the quantitative tests in the following examples, three replicates were set up and the results averaged.

Example 1 preparation of engineered macrophages.

The experiment utilizes a genetic engineering method to construct recombinant plasmids for expressing IL-10, T beta R2-FC or CD147, packages lentivirus, infects RAW264.7 macrophage to ensure that the macrophage can continuously and stably express IL-10, T beta R2-FC or CD147, transplants the engineered macrophage for expressing IL-10, T beta R2-FC or CD147 into the lung, and further observes the curative effect of the anti-fibrosis.

1. Test materials.

1. The main apparatus and equipment.

The device comprises an electronic balance, a refrigerated centrifuge, a PCR (polymerase chain reaction) electrophoresis apparatus, a dry thermostat, a gel imaging analyzer, a biological safety cabinet, an ice maker, a constant-temperature culture oscillation box, an electrothermal blowing drying box, an ultraviolet spectrophotometer, a carbon dioxide incubator, a fluorescence inversion microscope, a fluorescence excitation module, a cell counter, a refrigerator, a plate washing machine, an enzyme labeling instrument and a chemiluminescence imaging analyzer.

2. The main reagent.

Cell line: 293FT (human renal epithelial cell line) and RAW264.7 cells (mouse monocyte macrophage leukemia cells), MLE cells (mouse lung epithelial cells) were stored in this laboratory.

Packaging plasmid: psPAK2, pmd2G.

The main reagents are as follows: ecoR I and BamH I restriction endonucleases, DNA polymerase, PCR reaction reagents and 3.1NEB buffer (NEB Corp., USA). Competent bacteria DH5 alpha, plasmid extraction kit and DNA electrophoresis gel recovery kit [ Tiangen science and technology biochemistry (Beijing) Co., ltd ]. Liposome Lipofectamine 2000 (Invitrogen, USA). Fetal bovine serum, DMEM high-sugar medium, 1640 medium (Gibco, USA). Murine GAPDH monoclonal antibody (Santa Cruz Biotechnology, USA). Murine Myc-tag monoclonal antibody (MBL, japan). Rabbit Smad2/3 polyclonal antibody, rabbit p-Smad2/3 polyclonal antibody (CST company, USA). A horseradish peroxidase-labeled secondary goat anti-mouse IgG, and a horseradish peroxidase-labeled secondary goat anti-rabbit IgG (Jackson, usa). RIPA lysate and PMSF protease inhibitor (beijing solibao technologies ltd.). ECL luminescence kit (Thermo Fisher Scientific, USA). Mouse IL-10, TGF-. Beta.ELISA kit (RD company, USA). LB medium, 1M Tris-HCL (pH = 6.8), 1.5M Tris-HCL (pH = 8.8), 10 × Tris-Glycine (SDS-PAGE running buffer), 10 × electrotransfer buffer, 10 × TBST.

The gene sequences of T beta R2-Fc, IL-10 and CD147 are obtained from NCBI websites, and are connected with a vector expressing Green Fluorescent Protein (GFP) or red fluorescent protein (mCherry) by using a DNA recombination technology to obtain recombinant plasmids, escherichia coli E.Coli DH5 alpha competent cells are transformed, a single clone is selected, and the size of the constructed recombinant plasmids accords with the expectation through enzyme digestion identification and sequencing analysis. The plasmid is extracted by using the plasmid extraction kit, the concentration and the purity of the obtained plasmid are high, and the experiment successfully constructs recombinant plasmids pCDH-RP-Tbeta R2-Fc, pCDH-mIL10-Myc and pCDH-mIL10-Myc for expressing Tbeta R2-Fc, IL-10 and CD147.

1. And (3) identifying the recombinant plasmid pCDH-RP-T beta R2-Fc.

The constructed recombinant plasmid pCDH-RP-T beta R2-Fc is separated in agarose gel electrophoresis after being cut by XbaI and BamHI, and bands with the size of about 1272bp and 9000bp can be observed by the pCDH-RP-T beta R2-Fc recombinant plasmid by a gel imaging analyzer and are consistent with the sizes of the vector pCDH-RP-T beta R2-Fc and the vector pCDH-mCherryP. And (4) selecting the positive monoclonal bacteria with correct enzyme digestion identification, and sending the positive monoclonal bacteria to a company for sequencing analysis, wherein the sequencing result shows that the positive monoclonal bacteria are consistent with the target sequence.

2. And (5) detecting the concentration and purity of the recombinant plasmid.

The recombinant plasmids of pCDH-RP-T beta R2-Fc, pCDH-mIL10-Myc and pCDH-CD147-Myc extracted according to the small-extraction medium-amount kit of endotoxin-free plasmids provided by Tiangen Biochemical technology Limited company are detected on an ultraviolet spectrophotometer, OD260/OD280 are respectively 1.88, 1.89 and 1.87, the result is ideal, and the requirements of subsequent experiments are met.

3. The recombinant lentivirus infected RAW264.7 cells.

RAW264.7 cells were infected with concentrated pCDH-RP-T.beta.R 2-Fc, pCDH-mIL10-Myc, pCDH-CD147-Myc and pCDH-X-GFP-Puro virus solutions, and after about 72 hours, the RAW264.7 cells successfully infected with pCDH-mIL10-Myc, pCDH-CD147-Myc and pCDH-X-GFP-Puro expressed Green Fluorescent Protein (GFP) under 488 nm excitation light irradiation, and the RAW264.7 cells successfully infected with pCDH-RP-T.beta.R 2-Fc expressed red fluorescent protein (HchmerCy) under inverted fluorescence microscope. Cells that were successfully infected were designated RAW-T β R2-Fc, RAW-IL10, RAW-CD147 and RAW-Con cells, respectively.

4. And detecting the expression of the Tbeta R2-Fc by Western blot.

The supernatant and cells of 293FT cells subjected to transient T beta R2-Fc transfer and the culture supernatants and cells of RAW-T beta R2-Fc and RAW-Con are collected to prepare a supernatant, and Western blot detection is carried out on the supernatant, wherein the result shows that: specific bands with Myc labels can be detected in 293FT cells and RAW264.7 cell culture supernatants and cell lysates of over-expressed T beta R2-Fc, and the sizes of the bands are consistent with that of target proteins; however, expression of specific proteins could not be detected in 293FT and RAW264.7 cell culture supernatants and cell lysates of the empty vector pCDH-X-GFP-Puro.

5. Western blot detects the inhibition effect of Tbeta R2-Fc on TGF-beta/Smad signal transduction pathways.

Taking appropriate amount of MLE fine powderThe cells are laid in a 24-pore plate, western blot is carried out according to experimental groups and steps in construction and identification of the engineered macrophages expressing Tbeta R2-FC, and the results show that: after the MLE cells are stimulated by adding TGF-beta, a specific band of p-Smad2/3 can be detected; when MLE cells were associated with RAW-T.beta.R ₂ After co-culturing of the Fc cell culture supernatant and stimulation by adding TGF-beta, the expression of p-Smad2/3 can not be detected; expression of p-Smad2/3 was detectable when co-cultured with cell culture supernatant from RAW-Con; the addition of RAW-con or RAW-T.beta.R 2-Fc alone did not detect the expression of p-Smad2/3, and the expression of Smad2/3 was detected in all cells.

ELISA method for detecting IL-10 secretion level in RAW-IL-10.

Supernatants of RAW-IL-10 at 6, 12, 18 and 24 h of culture were collected, respectively, and IL-10 secretion levels in the supernatants were measured using RD Mouse IL-10 ELISA kit. The results show that the expression of IL-10 can be detected in the cell culture supernatant at different time points such as 6 h, 12 h, 18 h and 24 h, and the secretion level of IL-10 is gradually increased along with the time, but the secretion of IL-10 can not be detected in the RAW-Con cells.

7. The induced MMPs in the RAW-CD147 were detected by RT-PCR.

The RT-PCR results showed that CD147-M (RAW-CD 147) expressed more highly MMP such as CD147, MMP-3, MMP-7 and MMP-11.

The recombinant plasmid obtains lentivirus in 293FT cells by using a three-plasmid cotransfection system, infects RAW264.7 cells, and observes the expression of specific fluorescent protein by using an inverted fluorescence microscope. And collecting cell culture supernatant and cell lysate of RAW-T beta R2-Fc, RAW-IL10 and RAW-CD147 cells for WB detection, and observing specific protein bands, wherein the sizes of the specific protein bands are consistent with those of target proteins, which indicates that the engineered macrophages stably expressing the T beta R2-Fc, the IL-10 and the CD147 cells are successfully constructed. The in vitro function proves that the TGF-beta antagonistic protein T beta R2-Fc can inhibit a TGF-beta/Smad signal transduction pathway and play a role in inhibiting fibrosis. Through detection, the engineered cell RAW-IL10 can secrete the fibrosis suppressor IL-10 at a high level compared with a control cell. CD147-M (RAW-CD 147) expresses more MMP such as CD147, MMP-3, MMP-7 and MMP-11.

Example 2 establishment of mouse pulmonary fibrosis model.

The invention adopts a nasal drip mode to induce and prepare the mouse pulmonary fibrosis model, and adopts a mode of repeated administration every other day to carry out administration twice, compared with a one-time administration method, the mode of repeated administration is closer to the morbidity process of human fibrosis, the operation error is reduced, and the fibrosis model is more stable.

1. Test materials.

1. And (4) experimental animals.

Healthy 6-8 week-old male Balb/C mice, weighing 18-20g, purchased from Beijing Huafukang Biotech GmbH [ animal Certification: SCXK (Jing) 2019-0008], all raised in SPF level animal experiment in the center of laboratory animals.

2. Laboratory apparatus and equipment.

An electronic balance, an electric heating constant-temperature water bath, a liquid transfer device, an animal anesthesia machine, a paraffin embedding machine and a paraffin baking machine.

3. The main reagent.

Bleomycin sulfate, isoflurane, PBS buffer solution, dimethyl sulfoxide (DMSO), xylene, absolute ethyl alcohol, 10% neutral formalin, hematoxylin and eosin.

The kit comprises: a hydroxyproline detection kit (alkali hydrolysis) A00-2 Nanjing is built into a bioengineering research institute.

Preparing main reagents: preparing bleomycin sulfate mother liquor: 10 mg of BLM was dissolved in 500 uL of DMSO (heated to 50 ℃ in a water bath before use) to prepare 20 g.L-1 of BLM stock solution, which was diluted to the desired concentration when used.

2. Experimental methods.

1. Experimental groups and administration modes.

25 healthy male Balb/C mice were divided into 5 groups of 5 mice, each group consisting of a normal control group, a PBS control group, a BLM 1mg/kg administration group, a 2mg/kg administration group and a 5mg/kg administration group. All groups of mice are raised in SPF animal laboratories of companies, and are raised adaptively one week before the experiment, and the raising conditions are the same. The specific experimental operation process is as follows: the BLM mother liquor is prepared into the dosage concentration required by the experiment before the experiment, and is prepared as it is used. The mouse is anesthetized by adopting an inhalation anesthesia mode, firstly, an oxygen steel cylinder is opened, the oxygen flow is regulated, a knob of an anesthesia machine is opened, isoflurane is poured into the cylinder, the concentration is regulated, the concentration of the isoflurane is generally about 1.5% -2% for inducing anesthesia, the mouse is placed into an anesthesia box filled with the isoflurane, when the mouse is supine, the mouse has the advantages of uniform breathing and heartbeat, muscle relaxation, no movement of limbs and no contact reaction of beard, the mouse is regarded as anesthesia effect, and 50 uL of BLM or PBS solution with target dose is respectively and uniformly dripped into a left nasal cavity and a right nasal cavity. After the experiment is finished, the anesthesia machine is closed, the mouse is kept awake, and is continuously raised in an SPF-level clean animal room, the operation is repeated on the third day, and the nasal drop administration mode adopted by the experiment is an alternate-day administration method, namely, equivalent BLM solution is respectively administered on the 1 st day and the 3 rd day of the experiment, and the doses of two administrations are added to be the target dose of each group. The BLM injury model with different doses is applied, and researches show that the degree of pulmonary fibrosis of mice gradually worsens and the score of the fibrotic pathological injury is increased along with the increase of the dose, and the model is uniform and stable, and has no death case. Comprehensively evaluating the results of general behavior state and body weight measurement, hydroxyproline detection and pathology scoring of the mouse in the experimental research, the invention adopts the administration concentration of BLM 5mg/kg to establish a mouse pulmonary fibrosis model to prepare for subsequent experiments.

Example 3 therapeutic effect of engineered macrophages on pulmonary fibrosis in mice.

The dynamics research of the bleomycin-induced mouse pulmonary fibrosis model shows that the bleomycin-induced mouse pulmonary fibrosis process can be roughly divided into an early inflammation stage and a later fibrosis stage, wherein the inflammation stage is mainly 0-7 days after the bleomycin is administered, a large amount of inflammatory factors are secreted to cause lung epithelial injury during the inflammation stage, and if drug treatment is administered during the inflammation stage, the anti-inflammatory effect is mainly exerted, and the effect of preventing the development of fibrosis is achieved. Taking the 9 th day as a turn, the inflammatory phase begins to transit to the fibrosis phase, and the 9-14 th day is the fibroplasia phase, during which the TGF-beta mediated fibrosis is mainly used, the fibrosis formed in the 14-28 th day is resolved to different degrees, and during which the anti-fibrosis effect is mainly achieved by the administration of drugs. Therefore, the experimental selection is that the engineered macrophages are respectively given for treatment on the 1 st day, the 7 th day and the 14 th day after the bleomycin is injured, the three-cell combined administration mode is adopted to achieve the synergistic effect treatment effect, the experimental detection takes 21 days as the treatment end point, and the treatment effect of the engineered macrophages on the pulmonary fibrosis is respectively detected from different levels of animals, tissues, molecules and the like.

And (3) mice: male, healthy, BALB/c mice (6-8 weeks old, no specific pathogen) were purchased from Beijing Huafukang Biotech limited (Beijing, china). All experiments involving animal subjects were performed according to guidelines approved by the animal care and use committee (beijing, china). Mice were anesthetized with a controlled isoflurane flow. A mouse model was established by intranasal infusion of BLM sulfate (NSC 125066, selleck Chemicals, houston, TX, USA) (5 mg/kg in PBS, 50. Mu.L). One day after BLM treatment, mice were nasally inhaled PBS or engineered macrophages (2 × 10) as indicated ⁵ Cell/cell).

Cell culture: RAW264.7, MLE-12 and HEK293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) Fetal Bovine Serum (FBS), 100. Mu.g/mL penicillin and 100. Mu.g/mL streptomycin.

Vector construction and lentivirus transfection: lentiviral constructs expressing mouse IL-10, CD147 and TGFRcFC were cloned into pCDH vector (SBI). Lentiviral vectors were transfected into 293T cells with the filler plasmid, and viral particles were collected and used to infect RAW264.7 cells. Screening was performed by culturing in a medium containing 5. Mu.g/mL puromycin for 2 days.

Immunoblotting: cells were collected and extracted using RIPA buffer. Mouse lung tissue was homogenized with appropriate amounts of RIPA buffer. Quantification of total protein BCA protein assay kit (Tiangen, china) was used. Equal amounts of protein were separated on 10% SDS-PAGE gels and then transferred to PVDF membrane (PALL, USA). anti-Smad 2/3, anti-pSmad 2/3 (Cell Signaling Technology, USA), anti-myc (Medical & Biological Laboratories Co, japan), anti-beta-actin, anti-GAPDH (Santa Cruz Biotechnology, USA) membranes were incubated at 4 ℃. After three washes in 1 × TBST buffer, incubated with horseradish peroxidase-labeled goat anti-rabbit antibody or horseradish peroxidase-labeled goat anti-mouse antibody, respectively (1.

Quantitative PCR analysis: total RNA was isolated using TIANGEN (RNAprep pure Cell/Bacteria Kit) and reverse transcribed using ReverTra Ace (Toyobo) as described. RT-PCR Master Mix (Toyobo) synthesized cDNA fragments and fluorescence of each gene was detected on an Agilent Mx3005P qPCR system (Agilent, USA). The expression level of the gene of interest was normalized to housekeeping gene β -actin, and the fold change was calculated using the 2- Δ Δ CT method. The primers used for RT-PCR were as follows.

COL1A1: forward 5′- GGAGGGAACGGTCCACGAT -3′

reverse 5′- GAGTCCGCGTATCCACAA -3′;

FSP-1: forward 5′- AGGCAACGAGGGTGACAAGTTC -3′

reverse 5′- CATCATGGCAATGCAGGACAG -3′;

CD147: forward 5′- GGAATGCTCCAAACGACAG -3′

reverse 5′- CCCATCAACAGAGAGCGA -3′;

MMP-2: forward 5′-AGATTGATGCCGTGTACGAGG-3′

reverse 5′-TCCAGGAGTCTGCGATGAGC -3′;

MMP-3: forward 5′-CAGGCATTGGCACAAAGGTG-3′

reverse 5′-GTGGGTCACTTTCCCTGCAT-3′;

MMP-7: forward 5′-TGGTACCATAATGTCCTGAATG-3′

reverse 5′-TCGTTATTGGCAGGAAGCACACAATGAATT-3′;

MMP-9: forward 5′-GCTGACTACGATAAGGACGGC-3′

reverse 5′-AGGAAGACGAAGGGGAAGACG-3′;

MMP-11: forward 5′-CCGGAGAGTCACCGTCATC-3′

reverse 5′-GCAGGACTAGGGACCCAATG-3′;

TIMP-1: forward 5′-GACCTGGTCATAAGGGCTAAA-3′

reverse 5′-GCCCGTGATGAGAAACTCTTGACT-3′;

TIMP-2: forward 5′-TCAGAGCCAAAGCAGTGAGC-3′

reverse 5′-GCCGTGTAGATAAACTCGATGTC-3′。

HYP measurement: HYP measurements were performed using the HYP measurement kit (Nanjing, ministry of bioengineering, nanjing, china) according to the manufacturer's instructions.

ELISA: cytokine levels in the whole lung homogenate supernatant were measured using a commercially available mouse IL-10, TGF- β 1 ELISA kit (R & D Systems inc., minneapolis, MN, USA). The experiment was repeated 3 times and cytokine concentrations were calculated from the standard curve.

Histopathological observation and lung injury scoring: the mouse lungs were morphologically analyzed by micro-CT scanning (Quantum FX Demo, perkinElmer-Caliper LS, MA, USA) and H & E staining. The left lower leaves of the whole lung are fixed in a 4% formaldehyde neutral buffer solution for 48 hours, and are dehydrated in a graded ethanol series and embedded in paraffin, and the section is a 5 mu m section. These sections were histopathologically analyzed by H & E or Masson's trichrome staining. The severity of lung injury was assessed using histological features of edema, congestion and hyperemia, neutrophil marginalization and tissue infiltration, intra-alveolar bleeding and debris, and cellular proliferation. Grading the degree of the lung injury by using a scoring system. Each feature is classified as absent, mild, moderate, or severe and is assigned a score from 0 to 8. The total score for each mouse was calculated 33.

Computed tomography: the breast was evaluated radiologically using micro-CT (Quantum FX Demo, perkinElmer-Caliper LS, MA, USA). Mice were anesthetized with isoflurane inhalation and data acquisition was performed in the prone position. The chest CT examination results were scored by 3 respiratory disease experts in the treatment group according to the criteria of 1 point, normal lung examination results, 2, middle findings, 3, mild pulmonary fibrosis, 4, middle findings, 5, moderate pulmonary fibrosis, 6, middle findings and 7, late pulmonary fibrosis.

Statistical analysis: all analyses were performed using GraphPad (GraphPad Prism 9.0, san Diego, CA, US). Results are expressed as mean ± standard deviation. The multiple group mean comparisons were performed using a one-way variance test and post Tukey's test. All tests were statistically significant with P < 0.05.

1. Effect of unmodified macrophages on BLM induced PF.

The effect of unmodified macrophage infusion on BLM-induced PF was studied. The RAW264.7 mouse macrophage cell line was chosen because it is widely used as a vector in mouse macrophage therapy. A parallel GFP + RAW264.7 cell line (Con-M) was established by lentiviral introduction, which did not express therapeutic factors as a control for subsequent genetic modification of RAW264.7 cells. To improve the stability of the nasal inhalation model, 2 administrations were performed for 2 consecutive days, with the last 1 day being marked as day 0. To study the effect of BLM-induced fibrosis on cell infusion at different stages, 5 groups of mouse models were established. Mice in the BLM group were gavaged with PBS on days 1,7, and 14 after BLM administration. Mice in the BLM-Con-M1 d group were injected intranasally with Con-M on day 1 and PBS on days 7 and 14. The BLM-Con-M7 d group was perfused with Con-M on day 7, PBS on day 1 and 14, the BLM-Con-M14 d group was perfused with Con-M on day 14, and PBS on day 1 and 7. The control group was administered on days-1,0, 1,7,14 without administration of BLM, as shown in FIG. 1. The body weight was measured every 7 days for each group of mice. On day 20, all mice were scanned using a micro-Computed Tomography (CT) apparatus. Unlike the PBS group, micro-CT images of BLM group mice had typical PF imaging characteristics, suggesting that BLM induced the establishment of PF in mice. Groups of mice were sacrificed on day 21, lungs were isolated and subsequently examined.

It was first found that the weight loss and lung weight were significantly higher in the Con-M1 d and 7d groups than in the BLM group, as shown in FIG. 2. Pulmonary micro-CT images and corresponding scores from Con-M injected mice at day 1 and day 7 were more severe with PF than in the PBS-BLM group, as shown in FIG. 3. Hematoxylin and eosin (H & E) staining and corresponding Ashcroft scores as well as Masson's trichrome staining of lung sections of Con-M1 d and 7d groups of mice also indicated increased fibrotic lesions as shown in figure 4. Notably, the BLM-Con-M1 d and 7d groups of mice exhibited excessive collagen deposition as evidenced by elevated Hydroxyproline (HYP) levels, as shown in fig. 5. To further quantitatively determine whether infusion of Con-M can promote expression of a fibrosis marker, the level of expression of fibrotic gene mRNA in the lungs of BLM-treated mice was assessed by real-time polymerase chain reaction (RT-PCR). As shown, expression of the fibrosis markers COL1A1 and FSP1 mRNA was higher in BLM-Con-M1 d and 7d group mice, but not in 14d group mice, as shown in FIG. 6. These results indicate that infusion of unmodified RAW264.7 cells accelerated BLM-induced PF, particularly in the early stages. The observation that early perfusion of unmodified RAW264.7 macrophages can accelerate BLM-induced PF may be partly attributed to the role of the promoters and amplifiers of unmodified macrophages in the early inflammatory stage of BLM-induced fibrosis. Therefore, anti-inflammatory engineered macrophages should be used at this time.

2. Effect of IL-10 overexpressing macrophages on BLM-induced PF.

Engineered macrophages are established that constitutively secrete anti-fibrotic proteins by lentiviral infection. Firstly, a mouse IL-10 secretion RAW264.7 cell line, which is called IL10-M for short, is constructed. IL-10 levels in the IL10-M supernatant increased gradually with the passage of incubation time, reaching 2000 pg/mL after 12 hours. Meanwhile, IL-10 levels in Con-M supernatant were barely detectable at the three time points, as shown in FIG. 7. IL10-M cells were injected by intranasal route and the effect of treatment was evaluated as shown in FIG. 8. It was first found that the body weight loss of BLM-administered mice was improved by IL10-M infusion, particularly on day 1, as shown in fig. 9, and the right lung weight of the IL10-M mouse group was significantly lower than that of the PBS-BLM mouse group, as shown in fig. 10. micro-CT images of the lungs and corresponding scores (FIG. 11), H & E and Masson's trichrome staining (FIG. 12) showed that IL10-M significantly reduced lung injury and fibrosis after IL10-M infusion on days 1 and 7 compared to PBS-BLM group mice. The lungs of the mice were then isolated and tested for biomolecule levels. As expected, IL-10 mRNA levels in the lungs of IL10-M group mice were significantly higher than those of the Sham and BLM-PBS groups, as shown in FIG. 13. Enzyme-linked immunosorbent assay (ELISA) was also shown to increase IL-10 protein levels in the lungs of mice in the IL 10-M1 d group compared to the Sham and BLM-PBS groups. In contrast, IL10-M administration reduced pulmonary TGF β levels in mice in group 1d, as shown in FIG. 14. In addition, PF severity was significantly lower in 1d and 7d groups than Sham and BLM-PBS groups, indicating lower HYP levels, as shown in figure 15. Meanwhile, RT-PCR analysis of lung homogenates showed a significant reduction in the expression of Col1A1 and FSP1 in IL-10-M1 d group mice, as shown in FIG. 16. However, unlike the 1d and 7d groups, there was no significant effect of IL10-M infusion on day 14. These results indicate that injection of IL-10 secreting macrophages at an early rather than late stage can improve BLM-induced PF.

3. TGFR ₂ Effect of Fc (TGFRcFc) overexpressed macrophages on BLM-induced PF at the time of dosing.

To directly target TGF β to inhibit BLM-induced PF, a myc-tagged fusion protein was constructed, fused from the extracellular truncated domain of TGF β -receptor 2 to the IgG Fc domain, and stably expressed in RAW264.7 cells, designated TGFRcFc-M. Western Blotting results showed that Myc-TGFRcFc was expressed and secreted into the cell supernatant as shown in FIG. 17, which was effective in inhibiting TGF-beta induced Smad2/3 phosphorylation in vitro as shown in FIG. 18. Since expression of TGF β started in the intermediate stages of BLM-induced PF, infusion of TGFRcFc-M was abolished on day 1 and the therapeutic effect was evaluated, as shown in fig. 19. Although the body weight loss of the mice given with TGFRcFc-M did not improve as shown in FIG. 20, the right lung weight of the TGFRcFc-M group mice was significantly lower than that of the PBS-BLM group mice as shown in FIG. 21. As expected, micro-CT images (figure 22), H & E (figure 23) and Masson's trichrome staining (figure 24) of the TGFRcFc-M mouse group showed a reduction in lung injury and pulmonary fibrosis. TGF β protein levels were significantly reduced in lung tissue of TGFRcFc-M group 7d mice compared to PBS-BLM group, as shown in figure 25. In particular, PF severity was greatly reduced, and figure 26 shows lower HYP levels. In addition, analysis of lung homogenates from TGFRcFc-M injected mice showed a significant reduction in Col1A1 and FSP1 mRNA expression, as shown in fig. 27. Taken together, the data indicate that infusion of TGFRcFc-M at the intermediate stage can alleviate BLM-induced lung injury and fibrosis.

4. Effect of CD 147-overexpressed macrophages on BLM-induced PF

Considering that CD147 plays a role in collagen deposition process of PF, macrophages overexpressing CD147 were designed and induced MMPs were detected. The RT-PCR results showed that CD147-M expressed more CD147, and MMPs (MMP-3, MMP-7, and MMP-11, etc.), as shown in FIG. 28. Since collagen deposition occurred in the late stages, CD147-M alone was administered to the lungs of BLM-induced fibrotic mice on day 14 and the therapeutic effect was evaluated, as shown in fig. 29.

Although infusion of CD147-M did not improve the weight loss of mice given BLM, as shown in FIG. 30, the right lung weight of the CD147-M mouse group was lower than that of the PBS-BLM mouse group, as shown in FIG. 31. micro-CT images H & E (FIG. 32) and Masson's trichrome stain (FIG. 33) showed lung injury and PF attenuation in the CD147-M mouse group. mRNA levels for CD147, MMP-3, MMP-7, MMP-9, and MMP-11 were elevated in lung tissue of mice in the CD147-m group relative to lung tissue in the PBS-BLM group, as shown in FIG. 34. In contrast, the MMPs inhibitors TIMP-1 and TIMP-2 were expressed less, as shown in FIG. 35. In particular, PF severity was greatly reduced, and a lower HYP level was seen in FIG. 36. The RT-PCR results showed that CD147 group had a slight difference in Col1A1 mRNA level from PBS group, and FSP1 had no difference, as shown in FIG. 37. Taken together, these results indicate that administration of CD147-M reduces BLM-induced PF by accelerating collagen degradation.

In a model of BLM induced pulmonary fibrosis of mice, engineered macrophages RAW-IL10, RAW-T beta R2-Fc or RAW-CD147 are given for treatment, so that the pulmonary fibrosis damage of the mice can be effectively relieved, and the model has no systemic toxicity and is safer.

Claims (9)

1. An engineered macrophage, wherein said macrophage is capable of sustained secretion or overexpression of an anti-fibrotic protein.

2. The engineered macrophage of claim 1, wherein said anti-fibrotic protein is IL-10, transforming growth factor- β type II receptor T β R2-FC/TGFRcFC or CD147.

3. The method of producing the engineered macrophage according to claim 1 or 2, wherein the production method comprises constructing a viral expression system containing the antifibrosis protein gene, and integrating the antifibrosis protein gene into the macrophage using the viral expression system.

4. The method of claim 2, wherein the virus is a lentivirus.

5. A method according to claim 3, characterized in that the method comprises the steps of:

step 1, transfecting a lentivirus packaging cell by using a recombinant lentivirus vector and a lentivirus packaging plasmid, and culturing to obtain lentivirus;

and 2, infecting macrophages by the lentivirus obtained in the step 1 so as to obtain macrophages over-expressing IL-10, T beta R2-Fc or CD147 protein.

6. A method according to claim 3, characterized in that the method comprises the steps of: the recombinant plasmid for expressing IL-10, T beta R2 or CD147 is constructed by using a genetic engineering method, viruses are packaged, and macrophages are infected, so that the recombinant plasmid can continuously and stably express IL-10, T beta R2-Fc or CD147 protein.

7. Use of a macrophage according to claim 1 or 2 and a macrophage prepared by a method according to any one of claims 3-6 in the manufacture of a product for use in the treatment of a fibrotic disease.

8. The use of claim 6, wherein the fibrotic disease is pulmonary fibrosis, lung injury, cardiac fibrosis or liver fibrosis.

9. A product for use in the treatment of fibrotic disease, said product comprising the macrophage of claim 1 and the macrophage prepared by the method of any one of claims 1-5.

Images