CN115778978A - Preparation method and application of DNA and RNA hybrid nanoflower - Google Patents
Preparation method and application of DNA and RNA hybrid nanoflower Download PDFInfo
- Publication number
- CN115778978A CN115778978A CN202211583653.8A CN202211583653A CN115778978A CN 115778978 A CN115778978 A CN 115778978A CN 202211583653 A CN202211583653 A CN 202211583653A CN 115778978 A CN115778978 A CN 115778978A
- Authority
- CN
- China
- Prior art keywords
- sequence
- dna template
- buffer solution
- mir
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a preparation method and application of DNA and RNA hybridization nanoflowers, which effectively solve the problems of proper particle size, high biological safety and high drug loading capacity, can target cerebral hemorrhage parts, capture hemoglobin and regulate and control nano-drugs of a brain inflammatory microenvironment, and mix and cyclize a phosphorylated DNA template containing a hemoglobin aptamer sequence, primers and a buffer solution containing DNA ligase to obtain a circular DNA template containing the hemoglobin aptamer sequence; mixing a phosphorylation DNA template containing a miR-124 sequence and a primer in a buffer solution containing DNA ligase for cyclization reaction to obtain a circular DNA template containing the miR-124 sequence; performing rolling circle replication on a circular DNA template containing a hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution, adding the circular DNA template containing the miR-124 sequence to simultaneously perform rolling circle replication and rolling circle transcription, and centrifuging after terminating the reaction to obtain the hybridized nanoflower; the preparation method of the invention is easy to operate, safe to use and good in curative effect.
Description
Technical Field
The invention relates to the field of medicines, in particular to a preparation method and application of a DNA and RNA hybrid nano flower.
Background
The constituent bases of DNA are ATGC, and the units are deoxynucleotides. The constituent bases of RNA are AUGC, in ribonucleotides. DNA is a double helix structure and belongs to genetic material. RNA is generally single-stranded and is not used as genetic material. RNA is a single strand formed by transcription by taking a strand of DNA as a template and using a base complementary pairing principle, has the main function of realizing the expression of genetic information on protein, and is a bridge in the process of transforming the genetic information into phenotype. Unlike DNA, RNA is generally a single-stranded long molecule that does not form a double helix structure, but many RNAs also require base-pairing to form certain secondary or tertiary structures for biological function. RNA has basically the same base pairing rules as DNA, but G-U can be paired in addition to the A-U, G-C pair. In the aspect of virus, many viruses only use RNA as their sole genetic information carrier (unlike double-stranded DNA which is commonly used by cell organisms as a carrier). mRNA in RNA is a template for synthesizing protein, the content is transcribed according to DNA in cell nucleus, tRNA is a recognizer of base sequence (i.e., genetic codon) on mRNA and a transporter of amino acid, rRNA is a component constituting ribosome, is a work place for protein synthesis, and has great significance in treating disease drugs.
Cerebral hemorrhage is one of the most fatal subtypes of stroke, affecting the life and health of millions of people every year. Although the incidence of cerebral hemorrhage is only 10-15% of all stroke types, it has a high mortality and disability rate. Patients with cerebral hemorrhage often suffer from severe and long-term impairment of neurological function. Although some patients are relatively well treated in primary injuries with cerebral hemorrhage, secondary injuries caused by blood entering the brain parenchyma can cause more severe inflammation, leading to impaired neurological function, disability and even death of the patient, which is an important factor in determining the prognosis of the patient.
Studies have shown that secondary injury is primarily caused by hemoglobin in blood lysates and activated microglial cell-mediated neuroinflammation. After rupture of the cerebral vessels, blood enters the brain parenchyma and rapidly forms hematomas, and the activated complement system causes the red blood cells in the blood to lyse and release large amounts of hemoglobin, which excess free hemoglobin can cause neurotoxicity. In addition, excess hemoglobin polarizes microglia in brain tissue to M1 type (pro-inflammatory type), which releases various inflammatory factors, chemokines, etc., exacerbating the formation of brain inflammatory microenvironment. Therefore, efficient capture of hemoglobin while modulating the inflammatory microenvironment of the brain is expected to be highly effective in treating cerebral hemorrhage.
miR-124 is considered to be a microRNA specific to the brain and is highly expressed in the brain, and researches show that the miR-124 can effectively regulate the phenotype of microglia to be an anti-inflammatory phenotype. The aptamer is a short-chain DNA or RNA with high affinity with a target, and the DNA aptamer specific to Hb has been screened in the prior research, so that co-delivery of the aptamer Hb and miR-124 is expected to treat cerebral hemorrhage efficiently. Nucleic acid nanoflowers are petal-shaped nucleic acid nanospheres that form a large number of nucleic acid copies by rolling circle amplification of nucleic acid fragments. The overlapping of the nucleic acid chains with high surface density ensures that the nucleic acid chains have higher stability to nuclease, thereby obviously improving the application range of nucleic acid medicaments. However, the current nucleic acid nanoflowers can only deliver a single DNA drug or RNA drug, and cannot deliver two different types of nucleic acids at the same time, so that a new rolling circle amplification mode capable of realizing co-delivery of Hb aptamer and miR-124 is urgently needed. The invention synthesizes the DNA and RNA hybrid nanometer flower simultaneously comprising DNA and miRNA by optimizing the rolling circle amplification mode, and the nanometer flower is used for treating cerebral hemorrhage, but the invention has no public report until now.
Disclosure of Invention
Aiming at the situation and overcoming the defects of the prior art, the invention aims to provide a preparation method and application of a DNA and RNA hybrid nano flower, which can effectively solve the problems of nano drugs with proper particle size, high biological safety and high drug loading capacity, which can target cerebral hemorrhage parts, capture hemoglobin and simultaneously regulate and control brain inflammatory microenvironment.
The technical scheme includes that the preparation method of the DNA and RNA hybrid nanoflower comprises a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), and comprises the following steps:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 18-25 deg.C for 3-4h to obtain annular DNA template containing hemoglobin aptamer sequence;
the phosphorylated DNA template containing a hemoglobin aptamer sequence is prepared by mixing a DNA template containing a hemoglobin aptamer sequence at a concentration of 10 μ M, APT at a concentration of 1mM, and a buffer solution of T4 polynucleotide kinase and T4 polynucleotide kinase at a concentration of 0.25U/μ M/ml, at a volume ratio of 1: 0.25:10, carrying out phosphorylation reaction at 37 ℃ for 1 h to obtain a phosphorylated DNA template containing a hemoglobin aptamer sequence;
the buffer solution of the T4 polynucleotide kinase contains 50 mM Tris-HCl and 10mM MgCl 2 5mM dithiothreitol, 0.1mM spermidine, 0.1 mM adenosine diphosphate in water;
the DNA template and the primer containing the sequence of the hemoglobin aptamer are from Shenzhen Hua Dagen Gen Ltd, and the sequence information of the hemoglobin aptamer is 5'-ACAGCACCACAGACCAACAGCTACCATCTAACACTCGCGTCGTCTCCCTCACCT-3';
the buffer solution containing the DNA ligase is a buffer solution containing 40 mM Tris-HCl and 10mM MgCl 2 10mM dithiothreitol, 0.5 mM adenosine triphosphate, 0.5U/. Mu. L T4DNA ligase;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a volume ratio of 10: 1.5: 10, and performing cyclization reaction at a temperature of 18-25 ℃ for 3-4h to obtain a circular DNA template with the miR-124 sequence;
the phosphorylated DNA template containing the miR-124 sequence is prepared by mixing a DNA template containing the miR-124 sequence at a concentration of 10 mu M, ATP at a concentration of 1mM and T4 polynucleotide kinase at a concentration of 0.5U/mu L in a buffer solution containing the T4 polynucleotide kinase, and mixing the two in a volume ratio of 1: 0.5:10, carrying out phosphorylation reaction at 37 ℃ for 1 h to obtain a phosphorylation DNA template containing a miR-124 sequence;
the DNA template and the primer containing the miR-124 sequence are from Shenzhen Hua Dagen corporation;
the sequence information of the DNA template containing the miR-124 sequence is 5'-TCGTATTAACGTACCAACAATAAGGCACGCGGTGAATGCCACTTGGGCATTCACCGCGTGCCTTATTTAGAGGCATATCCCTATAGTGAG-3';
| name (R) | Sequence (5 '-3') |
| SEQ IDNo.1 | ACAGCACCACAGACCAACAGCTACCATCTAACACTCGCGTCGTCTCCCTCACCTGGTGTTTGTCTTCCTGCC |
| SEQ IDNo.2 | TCTGTGGTGCTGTGGCAGGAAGACAAAC |
| SEQ IDNo.3 | TCGTATTAACGTACCAACAATAAGGCACGCGGTGAATGCCACTTGGGCATTCACCGCGTGCCTTATTTAGAGGCATA TCCCTATAGTGAG |
| SEQ IDNo.4 | TTGTTGGTACGTTAATACGACTCACTATAGGGAT |
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution;
the DNA polymerase is phi29DNA polymerase, the concentration is 1U/mu L, and the concentration of dNTP is 1mM;
the concentration of the RNA polymerase buffer solution is 40 mM Tris-HCl and 6 mM MgCl 2 1mM dithiothreitol, 2 mM spermidine in water;
4) After rolling circle replication reaction is carried out for 18-22min at 36-38 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 36-38 deg.C for 28-32h, maintaining the reaction mixture at 92-98 deg.C for 4-6min, stopping reaction, centrifuging at 10000-12000g for 20-22min to obtain precipitate, and adding double distilled water (ddH) 2 O) washing and precipitating for 20-22min to obtain the hybridized nanometer flower;
the final concentration of the rNTP is 2.5mM;
the RNA polymerase is T7 RNA polymerase, and the concentration is 0.5U/mu L;
the final concentration of the RNA polymerase buffer solution is 40 mM Tris-HCl and 6 mM MgCl 2 1mM dithiothreitol, 2 mM spermidine in water;
the hybrid nanometer flower particle is a spherical particle with the particle size of 400-600nm, and the surface of the hybrid nanometer flower particle contains laminated petal-shaped folds.
The application of the hybrid nano-flower prepared by the method in preparing the medicament for treating cerebral hemorrhage is provided.
The invention has the advantages of abundant and easily obtained raw materials, easy operation of the preparation method, safe use and good curative effect, is effectively used for treating cerebral hemorrhage, is an innovation in rolling circle amplification technology, and has great economic and social benefits.
Drawings
FIG. 1 is a scanning electron micrograph of a hybrid nanoflower according to the present invention;
FIG. 2 is a graph of particle size analysis of the hybrid nanoflower of the present invention;
FIG. 3 is a graph of the binding characteristics of the hybrid nanoflower of the present invention to Hb;
FIG. 4 is a graph of the results of controlling miR-124 content in microglia by the hybrid nanoflower of the invention;
FIG. 5 is a graph of the protective effect of the hybrid nanoflower of the present invention on Hb-induced neural cells;
FIG. 6 is a graph showing the results of modulating the phenotype of microglia by hybrid nanoflowers according to the present invention;
FIG. 7 is a graph showing the results of the determination of the apoptosis effect of the hybrid nanoflower on neural cells;
FIG. 8 is a diagram of the areas of cerebral hematomas in mice with cerebral hemorrhage in different treatment groups of the hybrid nanoflower of the invention;
FIG. 9 is a NeuN staining image result chart of brain tissue of different treatment groups of the hybrid nanoflower of the present invention;
FIG. 10 is a graph showing the results of TUNEL staining images of brain tissue of different treatment groups of the hybrid nanoflower of the present invention.
Detailed Description
The following examples and specific examples will explain the present invention in detail.
The invention is illustrated in the following examples.
Example 1
The invention relates to a preparation method of a DNA and RNA hybridization nanoflower, which contains a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), and comprises the following steps:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 22 ℃ for 3.5h to obtain annular DNA template containing hemoglobin aptamer sequence;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a volume ratio of 10: 1.5: 10, and performing cyclization reaction at a temperature of 22 ℃ for 3.5 hours to obtain a circular DNA template with a miR-124 sequence;
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution;
4) After rolling circle replication reaction is carried out for 20min at 37 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 37 deg.C for 30h, maintaining the reaction mixture at 95 deg.C for 5min, terminating the reaction, centrifuging at 12000g for 20min to obtain precipitate, and adding double distilled water (ddH) 2 O) washing and precipitating for 21min to obtain the hybridized nanoflower.
Example 2
The invention relates to a preparation method of a DNA and RNA hybrid nano flower, which comprises the following steps:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 19 ℃ for 4h to obtain annular DNA template containing hemoglobin aptamer sequence;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a volume ratio of 10: 1.5: 10, and performing cyclization reaction at the temperature of 19 ℃ for 4 hours to obtain a circular DNA template with the miR-124 sequence;
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution;
4) After rolling circle replication reaction is carried out for 19min at 37.5 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 36 deg.C for 32h, maintaining the reaction mixture at 92 deg.C for 6min, terminating the reaction, centrifuging at 10000g for 22min to obtain precipitate, and adding double distilled water (ddH) 2 O) washing and precipitating for 20min to obtain the hybridized nanometer flower.
Example 3
The invention relates to a preparation method of a DNA and RNA hybrid nanoflower, wherein the hybrid nanoflower contains a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), and the preparation method comprises the following steps:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 25 ℃ for 3h to obtain annular DNA template containing hemoglobin aptamer sequence;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a volume ratio of 10: 1.5: 10, and performing cyclization reaction at 25 ℃ for 3 hours to obtain a circular DNA template with a miR-124 sequence;
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, the dNTP and DNA polymerase in an RNA polymerase buffer solution;
4) After 18min of rolling circle replication reaction at 38 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 38 deg.C for 28h, maintaining the reaction mixture at 98 deg.C for 4min, terminating the reaction, centrifuging at 11000g for 22min to obtain precipitate, and distilling with double distilled water (ddH) 2 O) washing and precipitating for 22min to obtain the hybridized nanometer flower.
It should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions, and all of them should be covered in the protection scope of the present invention.
The method for preparing the hybrid nano flower is easy to operate, the raw materials are rich and easy to obtain, the product quality is good, the hybrid nano flower can be effectively used for treating cerebral hemorrhage, and very good beneficial technical effects are obtained through experiments, and relevant experimental data are as follows (taking example 1 as an example):
detection and analysis
1) DNA and RNA hybridized nanoflower (h-DRNS) were analyzed by scanning electron microscopy at a scale bar of 100 nm, with the results shown in FIG. 1.
From the observation and analysis in fig. 1, it can be seen that the hybrid nanoflower (h-DRNS) is spherical and has a surface with a stack of petal-like folds.
2) DNA and RNA hybridized nanoflower (h-DRNS) were subjected to hydrodynamic analysis for particle size distribution (n = 3) and the results are shown in fig. 2.
From the analysis in FIG. 2, it can be seen that the hydrodynamic size of the DNA and RNA hybridized nanoflower (h-DRNS) is about 488 nm and its Zeta potential is about-30 mV.
3) Detection of Hb Capture Capacity of DNA and RNA hybridized nanoflower (h-DRNS)
The specific operation is as follows: mixing Hb solution (0.4 mg/ml) and nanoflower, incubating at 37 deg.C for 2h, and incubating at 4 deg.C and 12000gAnd centrifuged for 20min, and the Hb concentration (. Mu.g/mL) in the supernatant was measured by UV-VIS spectroscopy (Japanese UV 2550).
From the analysis in fig. 3, it can be seen that both DNS and h-DRNS can significantly reduce the Hb concentration in the supernatant compared to RNS, indicating that the nanoflower containing Hb aptamers can effectively capture Hb, which provides a theoretical basis for protecting nerve cells.
4) Regulating and determining miR-124 content in microglia by using DNA and RNA hybrid nanoflower (h-DRNS)
The method specifically comprises the following steps: after adherent growth of BV2 cells, culture was continued for 24 hours with FBS-free medium, blank group: medium without any preparation, experimental groups: DNS (2 nM), RNS (2 nM), h-DRNS (2 nM). Then, the cells were collected, total RNA was extracted using Trizol reagent, and then reverse transcription was performed to obtain cDNA, and miR-124 was detected using qRT-PCR. The miR-124 primers are 5'-GAGTAAGGCACGCGGTGAA-3' (Forward) and 5'-TATGGTTCTTGACGACTGGTTGAC-3' (reverse).
As can be seen from the analysis in FIG. 4, both RNS and h-DRNS can significantly up-regulate the miR-124 content in BV2 cells.
5) DNA and RNA hybridized nanoflower (h-DRNS) were tested for reduction of Hb damage to nerve cells:
the method specifically comprises the following steps: HT-22 cells (5X 10) 3 Cells/well) were cultured in 100 μ Ι _ of medium (96 well plates) to adherent growth. Blank group: medium without any preparation, positive control group: hb (50 μ M), experimental group 1: hb (50 μ M) + RNS (10 nM), experimental group 2: hb (50 μ M) + RNS (10 nM), experimental group 3: hb (50. Mu.M) + h-DRNS (10 nM), three groups were combined with HT-22 cells (5X 10) in serum-free medium 3 Cells/well) were incubated for 24 hours and cell viability was assessed using the MTT method, the results are shown in figure 5.
As can be seen from the analysis in FIG. 5, both DNS and h-DRNS can significantly reduce the damage of HT-22 cells, indicating that the hybrid nanoflower can protect nerve cells by capturing Hb.
6) Microglial cell phenotype analysis experiment
Measurement of iNOS expression: BV2 cell (2X 10) 5 Cells/well) were cultured in 1mL of medium (6-well plate) to adherent growth. Blank group: medium without FBS was added, positive control group: LPS (10 μ g/ml), experimental group 1: LPS (10 μ g/ml) + RNS (10 nM), experimental group 2: LPS (10 μ g/ml) + RNS (10 nM), experimental group 3: LPS (10. Mu.g/ml) + h-DRNS (10 nM), five groups were combined with BV2 cells (2X 10 cells) in FBS-free medium 5 ) After 24 hours of incubation, the expression of iNOS and CD206 in the cells was detected by immunofluorescence, respectively, and the results are shown in FIG. 6.
As can be seen from FIG. 6, both RNS and h-DRNS can effectively reduce the expression of iNOS and promote the expression of CD206 by BV2 cells, which indicates that the existence of miR-124 in DNA and RNA hybrid nanoflower (h-DRNS) can effectively promote the transformation of BV2 cell phenotype to M2 type.
7) Application of DNA and RNA hybridized nanoflower (h-DRNS) in experiments for resisting apoptosis of nerve cells
Co-culture of HT-22 cells and BV2 cells, HT-22 cells (5X 10) using Transwell Chambers 4 Cells/well) in 0.5ml of medium (lower chamber), BV2 cells (10) 4 Cells/well) were cultured in 0.1ml of medium (upper chamber) to adherence. Blank group: medium without FBS was added, positive control group: hb (100 μ M), experimental group 1: hb (100 μ M) + RNS (10 nM), experimental group 2: hb (100 μ M) + RNS (10 nM), experimental group 3: hb (100. Mu.M) + h-DRNS (10 nM), five groups were incubated with BV2 cells for 24 hours in FBS-free medium, and apoptosis of lower ventricular nerve cells was detected by live-dead cell staining, the results are shown in FIG. 7.
From the analysis in fig. 7, it can be seen that the three agents all protected nerve cells to different degrees, and among them, DNA and RNA hybridized nanoflower (h-DRNS) had the best effect, demonstrating that it inhibited the damage of nerve cells by capturing Hb on one hand and protected nerve cells by modulating BV2 cell phenotype on the other hand.
8) Performing in vivo hemorrhagic apoplexy treatment experiment on DNA and RNA hybridized nanoflower (h-DRNS)
0.0375U collagenase (type iv) was injected intracerebrally into the striatal region of the brain of each mouse to establish a model of cerebral hemorrhage, (1) saline (control); (2) RNS (experiment 1 group), (3) DNS (experiment 2 group), (4) h-DRNS (experiment 3 group). Administration was via tail vein at hours 4, 24, and 36, respectively. Brain tissue was collected 48 hours after treatment, sectioned to examine brain hematoma area, and the results are shown in fig. 8, and stained with NeuN and TUNEL for neural cell inventory and pathology, and shown in fig. 9 and 10.
In fig. 8, the three preparations all reduced the hematoma area to different degrees, wherein the hybrid nanoflower (h-DRNS) was the most effective, and the hematoma area was reduced 21.98 times compared with the saline group, indicating that the hybrid nanoflower (h-DRNS) can synergistically treat cerebral hemorrhage through both Hb capture and inflammation ablation.
The NeuN staining result shows that a large amount of nerve cells die after cerebral hemorrhage, RNS treatment only has weak effect, and the preparation is difficult to efficiently target cerebral hemorrhage parts under the condition without Hb aptamer, AD plays a certain curative effect by targeting the cerebral hemorrhage parts and capturing Hb, and DNA and RNA hybridized nanoflower (h-DRNS) effectively targets the brain and captures Hb by playing a synergistic effect, so that cerebral inflammation is regulated, and nerve cells are effectively protected.
From the analysis in fig. 9 and 10, it can be known that the hybrid nanoflower (h-DRNS) can effectively reduce the number of apoptotic cells at the cerebral hemorrhage site, and this benefits from the efficient co-delivery of the hybrid nanoflower (h-DRNS) to the Hb aptamer and the miR-124, so that on one hand, the h-DRNS can capture Hb existing in a large amount at the cerebral hemorrhage site, on the other hand, the precise delivery of the miR-124 to microglia is realized, and the cerebral hemorrhage is synergistically treated by promoting hematoma clearance and protecting nerve cells.
The DNA and RNA hybrid nanoflower (h-DRNS) provides a novel medicament for treating cerebral hemorrhage. Through the targeting effect of the Hb aptamer, the hybrid nanoflower can be efficiently targeted to a cerebral hemorrhage part and is specifically combined with Hb, the transfer of the Hb to microglia is promoted, and the damage of the Hb to nerve cells is relieved. Meanwhile, the delivery of miR-124 to microglia is realized, the conversion of the microglia to an anti-inflammatory phenotype is promoted under the action of the miR-124, the inflammatory microenvironment of the brain is remodeled, and the cerebral hemorrhage is synergistically treated. The DNA and RNA hybrid nanoflower (h-DRNS) provided by the invention is a great innovation of gene therapy on cerebral hemorrhage.
The same or similar results were obtained in the above experiment of example 1 and in other examples, which are not listed here.
Experiments show that the method for preparing the hybrid nano flower is easy to operate, the raw materials are rich and easy to obtain, the product quality is good, the hybrid nano flower can be effectively used for treating cerebral hemorrhage, and compared with the prior art, the hybrid nano flower has the following beneficial technical effects:
1. the DNA and RNA hybrid nanoflower provided by the invention is formed by a self-assembly mode of long-chain nucleic acid containing a hemoglobin DNA aptamer and miR-124, is a carrier-free pure nucleic acid nanostructure, has 100% drug loading, and has high safety as an endogenous molecule in a living body, so that the hybrid nanoflower provided by the invention has almost no side effect, good treatment effect and high safety.
2. The DNA and RNA hybrid nanoflower provided by the invention can be directly targeted to a cerebral hemorrhage part without modifying other brain targeting molecules, and can be specifically combined with hemoglobin to form a hybrid nanoflower-hemoglobin compound, and then can be targeted to microglia again, so that the accurate delivery of miR-124 to the microglia is realized, and the efficient cooperative treatment of cerebral hemorrhage is realized by combining with hemoglobin removal and brain inflammatory microenvironment regulation.
3. The DNA and RNA hybrid nano flower provided by the invention innovates the existing rolling circle amplification technology, simultaneously performs rolling circle replication and rolling circle transcription in a system for the first time, and provides a novel preparation technology of nucleic acid nano flower. The technical principle of the invention is that based on self-assembly between nucleic acids, the nano flower containing other miRNA sequences can be obtained by designing a template DNA sequence, so that the DNA and RNA hybrid nano flower provided by the invention can be used as a universal miRNA delivery platform to realize accurate intracellular delivery of various miRNAs in cerebral hemorrhage.
4. The miR-124 is miRNA capable of regulating microglia phenotype, miR-124 is delivered through hybridized nanoflowers, the half-life period of miR-124 in vivo is improved, the stability and the targeting property of miR-124 are increased by utilizing the targeting capability of a hemoglobin aptamer, a new solution is provided for the in vivo delivery of miRNA, and great economic and social benefits are achieved.
Claims (5)
1. A method for preparing a DNA and RNA hybrid nanoflower containing a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), comprising the steps of:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 18-25 deg.C for 3-4h to obtain annular DNA template containing hemoglobin aptamer sequence;
the phosphorylated DNA template containing a hemoglobin aptamer sequence is prepared by mixing a DNA template containing a hemoglobin aptamer sequence at a concentration of 10 μ M, APT at a concentration of 1mM, and a buffer solution of T4 polynucleotide kinase and T4 polynucleotide kinase at a concentration of 0.25U/μ M/ml, at a volume ratio of 1: 0.25:10, carrying out phosphorylation reaction at 37 ℃ for 1 h to obtain a phosphorylation DNA template containing a hemoglobin aptamer sequence;
the buffer solution of the T4 polynucleotide kinase contains 50 mM Tris-HCl and 10mM MgCl 2 5mM dithiothreitol, 0.1 mM spermidine, 0.1 mM adenosine diphosphate in water;
the sequence information of the hemoglobin aptamer is 5'-ACAGCACCACAGACCAACAGCTACCATCTAACACTCGCGTCGTCTCCCTCACCT-3';
the DNA ligase-containingThe buffer was 40 mM Tris-HCl, 10mM MgCl 2 10mM dithiothreitol, 0.5 mM adenosine triphosphate, 0.5U/. Mu. L T4DNA ligase;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a mixing ratio of 10: 1.5: 10 in terms of volume ratio, and performing cyclization reaction at the temperature of 18-25 ℃ for 3-4h to obtain a circular DNA template with the miR-124 sequence;
the phosphorylated DNA template containing the miR-124 sequence is prepared by mixing a DNA template containing the miR-124 sequence at a concentration of 10 mu M, ATP at a concentration of 1mM and T4 polynucleotide kinase at a concentration of 0.5U/mu L in a buffer solution containing the T4 polynucleotide kinase, and mixing the two in a volume ratio of 1: 0.5:10, carrying out phosphorylation reaction at 37 ℃ for 1 h to obtain a phosphorylation DNA template containing a miR-124 sequence;
the sequence information of the DNA template containing the miR-124 sequence is 5'-TCGTATTAACGTACCAACAATAAGGCACGCGGTGAATGCCACTTGGGCATTCACCGCGTGCCTTATTTAGAGGCATATCCCTATAGTGAG-3';
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, the dNTP and DNA polymerase in an RNA polymerase buffer solution;
the DNA polymerase is phi29DNA polymerase, the concentration is 1U/mu L, and the concentration of dNTP is 1mM;
the concentration of the RNA polymerase buffer solution is 40 mM Tris-HCl and 6 mM MgCl 2 1mM dithiothreitol, 2 mM spermidine in water;
4) After rolling circle replication reaction is carried out for 18-22min at 36-38 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 36-38 deg.C for 28-32h, maintaining the reaction mixture at 92-98 deg.C for 4-6min, terminating the reaction, centrifuging at 10000-12000g for 20-22min to obtain precipitate, and washing the precipitate with double distilled water for 20-22min to obtain hybridized nanoflower;
the final concentration of the rNTP is 2.5mM;
the RNA polymerase is T7 RNA polymerase, and the concentration is 0.5U/mu L;
the final concentration of the RNA polymerase buffer solution is 40 mM Tris-HCl and 6 mM MgCl 2 1mM dithiothreitol, 2 mM spermidine in water;
the hybrid nanometer flower particle is a spherical particle with the particle size of 400-600nm, and the surface of the hybrid nanometer flower particle contains laminated petal-shaped folds.
2. The method for preparing DNA and RNA hybridized nanoflower according to claim 1, comprising the steps of:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 22 ℃ for 3.5h to obtain annular DNA template containing hemoglobin aptamer sequence;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a mixing ratio of 10: 1.5: 10 in terms of volume ratio, and performing cyclization reaction at 22 ℃ for 3.5 hours to obtain a circular DNA template with a miR-124 sequence;
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution;
4) After rolling circle replication reaction is carried out for 20min at 37 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 37 ℃ for 30h, keeping the reaction mixture at 95 ℃ for 5min, stopping the reaction, centrifuging 12000g for 20min to obtain a precipitate, and washing the precipitate with double distilled water for 21min to obtain the hybridized nanoflower.
3. The method for preparing DNA and RNA hybridized nanoflower according to claim 1, comprising the steps of:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing a hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and a buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 19 ℃ for 4 hours to obtain a circular DNA template containing a hemoglobin aptamer sequence;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a volume ratio of 10: 1.5: 10, and performing cyclization reaction at the temperature of 19 ℃ for 4 hours to obtain a circular DNA template with the miR-124 sequence;
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution;
4) After rolling circle replication reaction is carried out for 19min at 37.5 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 36 ℃ for 32h, keeping the reaction mixture at 92 ℃ for 6min, stopping the reaction, centrifuging at 10000g for 22min to obtain a precipitate, and washing the precipitate with double distilled water for 20min to obtain the hybrid nanoflower.
4. The method for preparing DNA and RNA hybridized nanoflower according to claim 1, comprising the steps of:
1) Mixing 1 mu M phosphorylated DNA template SEQ ID No.1 containing hemoglobin aptamer sequence, 1 mu M primer SEQ ID No.2 and buffer solution containing DNA ligase together at a volume ratio of 10: 1: 10, and performing cyclization reaction at 25 ℃ for 3h to obtain annular DNA template containing hemoglobin aptamer sequence;
2) Mixing a phosphorylated DNA template SEQ ID No.3 with a miR-124 sequence at a concentration of 1 mu M and a primer SEQ ID No.4 with a concentration of 1.5 mu M in a buffer solution containing DNA ligase at a mixing ratio of 10: 1.5: 10 in terms of volume ratio, and performing cyclization reaction at the temperature of 25 ℃ for 3 hours to obtain a circular DNA template with the miR-124 sequence;
3) Calculating the volume ratio as 100:20:2.5:20, performing rolling circle replication on the circular DNA template containing the hemoglobin aptamer sequence, dNTP and DNA polymerase in an RNA polymerase buffer solution;
4) After 18min of rolling circle replication reaction at 38 ℃, mixing a circular DNA template containing a miR-124 sequence with rNTP, RNA polymerase and RNA polymerase buffer solution into a rolling circle replication system, and simultaneously carrying out rolling circle replication and rolling circle transcription, wherein the circular DNA template containing the miR-124 sequence, the rNTP, the RNA polymerase and the RNA polymerase buffer solution are 100:16:20:20 Reacting at 38 ℃ for 28h, keeping the reaction mixture at 98 ℃ for 4min, stopping the reaction, centrifuging 11000g for 22min to obtain a precipitate, and washing the precipitate with double distilled water for 22min to obtain the hybridized nanoflower.
5. Use of DNA and RNA hybridized nanoflower prepared by the method of any one of claims 1-4 in the preparation of a medicament for treating cerebral hemorrhage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211583653.8A CN115778978A (en) | 2022-12-10 | 2022-12-10 | Preparation method and application of DNA and RNA hybrid nanoflower |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211583653.8A CN115778978A (en) | 2022-12-10 | 2022-12-10 | Preparation method and application of DNA and RNA hybrid nanoflower |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115778978A true CN115778978A (en) | 2023-03-14 |
Family
ID=85418448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211583653.8A Pending CN115778978A (en) | 2022-12-10 | 2022-12-10 | Preparation method and application of DNA and RNA hybrid nanoflower |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115778978A (en) |
-
2022
- 2022-12-10 CN CN202211583653.8A patent/CN115778978A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2018214137B2 (en) | MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway | |
| JP6231099B2 (en) | Extraction, production and application of plant microribonucleic acid | |
| CN108883201A (en) | The method and composition of the treatment HIV infection of RNA guidance | |
| US10201556B2 (en) | Combination for use in treating diseases or conditions associated with melanoma, or treating diseases or conditions associated with activated B-raf pathway | |
| US20210038732A1 (en) | Anticancer microrna and lipid formulations thereof | |
| EP2296669B1 (en) | Targeted oligonucleotide compositions for modifying gene expression | |
| CN115778978A (en) | Preparation method and application of DNA and RNA hybrid nanoflower | |
| CA3079524A1 (en) | Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation | |
| CN115161289A (en) | Recombinant adeno-associated virus for treating inflammatory diseases and construction method and application thereof | |
| EP4119665A1 (en) | Sirna based on rna sequence of sars-cov-2 and use thereof | |
| CN111094324A (en) | Oncolytic virus, synthetic DNA sequence and application thereof | |
| CN102161991B (en) | Single-strand multi-target interfering nucleic acid molecule and application thereof | |
| JP2023013932A (en) | NOVEL siRNA BASED ON SARS-CoV-2 RNA SEQUENCE, AND USE OF THE SAME | |
| JP5789927B2 (en) | Nucleic acid introduction method using irradiated collagen-like peptide | |
| US9617538B2 (en) | Heptamer-type small guide nucleic acids inducing apoptosis of human leukemia cells | |
| US11617729B2 (en) | Uses of guanidine hydrochloride as a drug for treating cancers/tumors | |
| CN107693534A (en) | MiR 491 is preparing the application in being used to treat the medicine of osteosarcoma | |
| CN115261387A (en) | siRNA for specifically inhibiting LILRB4 gene expression and application thereof | |
| CN102140471A (en) | Oligo-nucleic acid for suppressing tumor growth and application thereof | |
| CN102174520B (en) | Interference nucleic acid molecule and application thereof | |
| WO2020155534A1 (en) | Oligonucleotide molecule and application thereof in tumor therapy | |
| CN104388429B (en) | Novel nucleic acid based on small RNA interference principle | |
| CA3175539A1 (en) | Modified short-interfering rna compositions and their use in the treatment of cancer | |
| CN117752676A (en) | microRNA-124 nano-composite based on tetrahedral framework nucleic acid and preparation method and application thereof | |
| CN116942692A (en) | RNA particle compound, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |