CN115772530A - Method for increasing yield of 1, 3-propylene glycol by using glycerol dehydratase gene with tolerance to oxygen and glycerol - Google Patents

Abstract

The invention discloses an over-expression glycerol dehydratase gene, which is derived from vibrio diazotrophicus and comprises two subunits, namely an alpha subunit and a beta subunit; the nucleotide sequence of the alpha subunit contains the nucleotide sequence shown in SEQ ID NO.1 or the nucleotide sequence shown in SEQ ID NO.1 is substituted, deleted and/or added with one or more nucleotides; the nucleotide sequence of the beta subunit contains the nucleotide sequence shown in SEQ ID NO.2 or the nucleotide sequence shown in SEQ ID NO.2 is substituted, deleted and/or added with one or more nucleotides; also discloses an overexpression glycerol dehydratase gene coding protein, a biological material and application. The overexpressed glycerol dehydratase gene disclosed by the invention has strong glycerol resistance and oxygen resistance, and the inhibition effect of glycerol and oxygen on the enzyme activity of the glycerol dehydratase is far lower than that of other currently known B12-dependent glycerol dehydratases containing three subunits.

Description

Method for increasing yield of 1, 3-propylene glycol by using glycerol dehydratase gene with tolerance to oxygen and glycerol

Technical Field

The invention relates to the field of genetic engineering and biological fermentation, in particular to a method for improving the yield of 1, 3-propylene glycol by using a glycerol dehydratase gene with tolerance to oxygen and glycerol.

Background

Glycerol dehydratase is a dehydratase for specifically catalyzing glycerol or 1, 2-propylene glycol to be dehydrated into 3-hydroxypropionaldehyde or propionaldehyde, and is also the first key enzyme for catalyzing glycerol to synthesize 1, 3-propylene glycol and 3-hydroxypropionic acid. Glycerol is catalyzed by glycerol dehydratase to produce first 3-hydroxypropanal which is reduced to 1, 3-propanediol by the action of alcohol dehydrogenase or oxidized to 3-hydroxypropionic acid by the action of aldehyde dehydrogenase. 1, 3-propanediol is an important diol, and is mainly used as a monomer to polymerize with terephthalic acid to produce a novel polyester material, namely polytrimethylene terephthalate (PTT). 3-hydroxypropionic acid is an important platform compound for the production of acrylic acid, malonic acid, 1, 3-propanediol, acrylamide, and the like.

The glycerol dehydratases known at present mainly include two types, one is a coenzyme B12-dependent glycerol dehydratase, and the other is a coenzyme B12-independent glycerol dehydratase. The coenzyme B12-independent glycerol dehydratase has an extreme sensitivity to oxygen, and a small amount of oxygen inactivates it, thus limiting its wide use. Coenzyme B12-dependent glycerol dehydratases are present in Klebsiella pneumoniae, citrobacter freundii, salmonella typhimurium, and the like. The coenzyme B12-dependent glycerol dehydratases known at present are composed of three subunits, including a larger alpha subunit, a medium beta subunit and a smaller gamma subunit, which form a complex structure of alpha 2 beta 2 gamma 2, and the coenzyme B12-dependent glycerol dehydratases are inhibited by glycerol and oxygen. Glycerol forms a suicide inhibitor for glycerol dehydratase, which rapidly inactivates it. The presence of oxygen also significantly reduces the enzymatic activity of glycerol dehydratase. In the micro-aerobic and aerobic fermentation processes, the inhibition of glycerol dehydratase enzyme activity by glycerol and oxygen is one of the key factors limiting the high yield of 1, 3-propanediol or 3-hydroxypropionic acid. How to improve the tolerance of glycerol dehydratase to glycerol and oxygen and improve the yield of 1, 3-propylene glycol or 3-hydroxypropionic acid is an urgent problem to be solved in the field.

Disclosure of Invention

In order to overcome the technical problems, the invention discloses an over-expression glycerol dehydratase gene, a coding protein and a biological material; also discloses an application of the overexpressed glycerol dehydratase gene, the encoded protein or the biological material.

The technical scheme adopted by the invention for realizing the purpose is as follows:

a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, wherein the overexpressed glycerol dehydratase gene dhaB1B2 is derived from Vibrio diazotrophicus which only comprises two subunits, namely an alpha subunit and a beta subunit;

the nucleotide sequence of the alpha subunit contains a nucleotide sequence shown as SEQ ID NO.1 or a nucleotide sequence shown as SEQ ID NO.1 which is substituted, deleted and/or added with one or more nucleotides;

the nucleotide sequence of the beta subunit contains a nucleotide sequence shown as SEQ ID NO.2 or one or more nucleotides are substituted, deleted and/or added in the nucleotide sequence shown as SEQ ID NO. 2.

The above-mentioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, wherein the nucleotide sequence of said overexpressed glycerol dehydratase gene dhaB1B2 is represented by SEQ ID NO.12, and the gene comprises only two subunits, which are an alpha subunit and a beta subunit, respectively.

A B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 encoding protein encoded by the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 described above;

the amino acid sequence of the alpha subunit coding protein contains an amino acid sequence shown as SEQ ID NO.10 or the amino acid sequence shown as SEQ ID NO.10 is substituted, deleted and/or added with one or more amino acids;

the amino acid sequence of the beta subunit coding protein contains the amino acid sequence shown as SEQ ID NO.11 or the amino acid sequence shown as SEQ ID NO.11 is substituted, deleted and/or added with one or more amino acids.

A biological material comprising a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, wherein the biological material comprises the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the biological material is a vector, a recombinant bacterium, a cell line or an expression cassette.

The application of the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 and the protein coded by the gene in catalyzing glycerol dehydration is disclosed, wherein the overexpressed glycerol dehydratase gene is the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the protein coded by the overexpressed glycerol dehydratase gene is the protein coded by the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2.

Use of a biological material comprising a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 for catalyzing glycerol dehydration, wherein the biological material is the above biological material comprising the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2.

The application of the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 and the protein coded by the gene in improving the yield of 1, 3-propylene glycol is used, wherein the overexpressed glycerol dehydratase gene is the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the protein coded by the overexpressed glycerol dehydratase gene is the protein coded by the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2.

Use of a biological material comprising a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 for increasing the yield of 1, 3-propanediol, wherein said biological material is the above biological material comprising a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2.

Specifically, in the application of improving the yield of 1, 3-propanediol, the overexpressed glycerol dehydratase gene is an overexpressed glycerol dehydratase gene dhaB1B2 in a recombinant bacterium, and the recombinant bacterium is Klebsiella pneumoniae, citrobacter freundii, salmonella typhimurium or Escherichia coli.

Use of a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 and its encoded protein for the preparation of 1, 3-propanediol, wherein the overexpressed glycerol dehydratase gene is the above B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the overexpressed glycerol dehydratase gene encoded protein is the above B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 encoded protein.

The application of the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 and the protein coded by the gene in biological fermentation to tolerate glycerol, wherein the overexpressed glycerol dehydratase gene is the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the overexpressed glycerol dehydratase gene coded protein is the protein coded by the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2.

Use of a B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 for tolerance to oxygen in a biological fermentation, wherein the overexpressed glycerol dehydratase gene is the B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 described above.

The invention has the beneficial effects that:

(1) The overexpressed glycerol dehydratase gene dhaB1B2 has strong glycerol resistance and oxygen resistance, and the inhibition effect of glycerol and oxygen on the enzyme activity of the glycerol dehydratase is far lower than that of other currently known B12-dependent glycerol dehydratases containing three subunits;

(2) The over-expressed glycerol dehydratase gene has high catalytic activity, and the over-expression of the glycerol dehydratase gene in the recombinant bacteria can greatly improve the yield of 1, 3-propanediol.

Detailed Description

The following examples are intended to illustrate the invention, but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the chemical reagents used in the examples are conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1: expression of glycerol dehydratase gene dhaB1B2 derived from Vibrio diazotrophicus (Vibrio diazotrophicus) and verification of catalytic performance thereof

PCR was carried out using the genome of Vibrio diazotrophicus (Vibrio diazotrophicus) as a template and primers dhaB-F (AAGCTTGTCGACGGAGCTCGAATTCTCAGAGCAGGTGGAAT) and dhaB-R (CTGGTGCCGCGGCAGCCATATGatgACGCCGAAACCAGTAT) as primers to obtain dhaB1B2 gene of about 3.6kb and purify the PCR product. The dhaB1B2 gene only contains 2 subunits which are respectively an alpha subunit and a beta subunit, the dhaB1 gene is the alpha subunit, the nucleotide sequence of the alpha subunit is shown in SEQ ID NO.1, the dhaB2 gene is the beta subunit, and the nucleotide sequence of the beta subunit is shown in SEQ ID NO. 2.

PCR was carried out using the genome of Klebsiella pneumoniae HR526 (Klebsiella pneumoniae) as a template and the primers gld-F (AAGCTTGTCGACGGAGCTCGAATTCTTAGCTTCCTTACGCAGCTTATGC) and gld-R (CTGGTGCCGCGGCAGCCATATGatgAAGATCAAAACGATTTGCAGTACTGG) as primers to obtain gldABC gene of about 2.7kb and purify the PCR product.

The expression plasmid pET-28a was digested with NdeI and EcoRI, and then the dhaB1B2 fragment and the gldABC fragment were ligated to pET-28a using a Gibson Assembly kit (NEB), respectively, and the resulting recombinant plasmids were named pET-dhaB1B2 and pET-gldABC, respectively. The two plasmids are transferred into Escherichia coli BL21 (DE 3) by a chemical transformation method, and recombinant bacteria are obtained by screening on a kanamycin LB plate containing 50mg/L and are named as BL21/pET-dhaB1B2 and BL21/pET-gldABC respectively.

BL21/pET-dhaB1B2 and BL21/pET-gldABC were cultured in LB liquid medium containing 50mg/L kanamycin until OD600 reached 0.6 (37 ℃,150 rpm), 0.5mM IPTG was added and culture was continued for 12 hours to induce expression of the protein. The cells were centrifuged and washed twice with 100ml of 100mM Tris-HCl (pH 8.0), and finally resuspended in 5ml of 100mM HEPES-KOH buffer (pH 8.2 containing 2mM DTT). The resuspension was disrupted by sonication and centrifuged to obtain a supernatant (12000rpm, 30 min). The glycerol dehydratase was isolated and purified using a protein purification kit HisTrap (GE).

Enzyme kinetic analysis was performed using the purified glycerol dehydratase described above. The detection method of the glycerol dehydratase is to use MBTH-colorimetric aldehyde method for determination, and a reaction system (1 mL) comprises: 100mM HEPES-KOH (pH 8.2), 20. Mu.M coenzyme B12, 10mM glycerol, 0.05M KCl, and an appropriate amount of enzyme. After a reaction at 37 ℃ for a certain period of time, the reaction was terminated by adding 1mL of 0.1M potassium citrate (pH 3), 0.5mL of 0.1% MBTH was added, and the mixture was incubated at 37 ℃ for 15min, followed by measurement of the absorbance at 305 nm. To examine the inhibitory effect of glycerol on glycerol dehydratase, the initial enzyme activity (first 3 minutes) and the average enzyme activity for 40 minutes were measured, respectively. In order to examine the inhibitory effect of oxygen on glycerol dehydratase, purified glycerol dehydratase was left in the air for two hours and then the enzyme activity was examined. The results are shown in Table 1.

TABLE 1 comparison of the enzymatic activities of glycerol dehydratases from different sources (unit U/mg)

	Initial enzyme Activity for the first 3 minutes	Average enzyme Activity of 40 min	Enzyme activity after oxygen treatment
				Diazotroph vibrio	38.2	29.2	27.5
Klebsiella pneumoniae	28.4	5.1	6.8

As can be seen from Table 1, glycerol dehydratase (dhaB 1B 2) derived from Vibrio diazotrophicus (Vibrio diazotrophicus) has a high specific activity, reaching 38.2U/mg (initial activity), which is greater than that of glycerol dehydratase (gldABC) derived from Klebsiella pneumoniae (28.4U/mg). The glycerol has obvious inhibition effect on glycerol dehydratase (gldABC) of Klebsiella pneumoniae, the average enzyme activity of the glycerol dehydratase in 40 minutes is 82% lower than that in 3 minutes, and the average enzyme activity of the glycerol dehydratase of Vibrio diazotrophicus (Vibrio diazotrophicus) in 40 minutes is only 24% lower than that in 3 minutes, which indicates that the glycerol dehydratase has higher tolerance to the glycerol. Under the aerobic condition, the enzyme activity of the glycerol dehydratase of the Klebsiella pneumoniae is reduced by 76 percent, while the enzyme activity of the glycerol dehydratase derived from the rhizobium baileyi is only reduced by 28 percent, which indicates that the glycerol dehydratase derived from the vibrio diazotrophicus has higher oxygen tolerance.

Example 2: klebsiella pneumoniae overexpresses glycerol dehydratase gene from diazotrophvibrio to improve the yield of 1, 3-propanediol

pET-dhaB1B2 and pET-gldABC of example 1 were ligated to pEC-K18 (purchased from Addgene) after double digestion with NdeI and EcoRI, respectively, and the resulting plasmids were named pEC-dhaB1B2 and pEC-gldABC. pEC-dhaB1B2 and pEC-gldABC are respectively transformed into Klebsiella pneumoniae HR526 by an electric transformation (the electric transformation condition is 1.8KV, and an electric transformation cup is 1mm), and recombinant bacteria are obtained by screening on a kanamycin LB plate containing 50mg/L and are respectively named as Kp/pEC-dhaB1B2 and Kp/pEC-gldABC.

The wild type Klebsiella pneumoniae HR526 and the two recombinant strains were cultured in the fermentation medium for 48 hours (37 ℃,150 rpm), respectively, and the yield of 1, 3-propanediol was examined. The components of the fermentation medium are as follows (g/L): glycerol 30, (NH) ₄ ) ₂ SO ₄ 4.0、K ₂ HPO ₄ 0.85、MgSO ₄ 0.2、FeSO ₄ 0.005, yeast powder 1.5, kanamycin 0.05 and trace elements 1ml. Wherein the microelement comprises (mg/L) MnSO ₄ ·4H ₂ O 100、CoCl ₂ ·6H ₂ O 200、ZnCl ₂ 70、NaMoO ₄ ·2H ₂ O 35、H ₂ BO ₃ 60、CuSO ₄ ·5H ₂ O 29、NiCl ₂ ·6H ₂ O25, and concentrated hydrochloric acid 0.9mL. The fermentation results were as follows: the yield of 1, 3-propanediol of the wild Klebsiella pneumoniae HR526 is 12.4g/L, the yield of 1, 3-propanediol of the recombinant strain Kp/pEC-gldABC is 12.1g/L, and the yield of 1, 3-propanediol of the recombinant strain Kp/pEC-dhaB1B2 is 16.2g/L. Description tableThe glycerol dehydratase from the diazotrophvibrio can obviously improve the yield of 1, 3-propylene glycol, and the glycerol dehydratase from the diazotrophvibrio only contains 2 subunits, a large alpha subunit and a small beta subunit, wherein the nucleotide sequence of the alpha subunit is shown as SEQ ID NO.1, and the nucleotide sequence of the beta subunit is shown as SEQ ID NO. 2.

The foregoing is merely a preferred embodiment of the invention and is not intended to limit the invention in any manner. Those skilled in the art can make many possible variations and modifications to the invention using the above disclosed technical means and teachings, or can modify equivalent embodiments with equivalent variations, without departing from the scope of the invention. Therefore, all equivalent changes made according to the shape, structure and principle of the present invention should be covered by the protection scope of the present invention without departing from the contents of the technical scheme of the present invention.

Sequence listing

<110> Jiangsu Qing Zhixing biotechnology limited company

<120> a method for increasing the production of 1, 3-propanediol by using a glycerol dehydratase gene having tolerance to oxygen and glycerol

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2544

<212> DNA

<213> dhaB1(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 1

atgagccaat tatcacaggc ttttggtgaa ccaactgacc gaattcgtgc cttacgggaa 60

caaatccttg atacgacccc ctgcattgag acggatcgtg cccgcctgat caccgagtcc 120

tataaggaaa cggaatccct gcccatgatc atccgtcgcg ccaaagcgct tgagaagatc 180

cttgcggaat tgccggtcac catccgggaa ggtgaactaa tcgttggtag tctgacagtc 240

actcctcatt ccacacaaat ttacccggag tactcaaatc gctggcttca ggatgaattc 300

gatcgtctga atctgcgtaa aggcgaccgt tttaccataa ccgatgaagc gaaacagcag 360

ctggatagcg tatttggcta ctgggaaggg aaaacaacga atgaactggc tacatcctat 420

atgttgcctg aaacgcttga ttgcatggca gaaaatgtct tcactgtcgg caactattac 480

tttaatggcg tcggtcatat agccgtggac tacgcgcgtg ttctcgctcg tggatacaaa 540

ggcatcatcc aggatgttgt tgcagcaatg gccagcgctg ataaaaaaga ccccgctttt 600

ctgaaaaaag aatcgttcta caaggcggtc attatttctt gtaacgcagc aatcaatttt 660

gctcatcgtt acgcggttaa agctcgtact ctcgcggaac aggcctcacc agtccgtaaa 720

aaagagctgc tgaaaattgc tgaaatctgt gacaaagtac ctgaaaatgg tgcaagtaat 780

ttctatgaag cctgccagtc attctggttt gcccatgcca ttattcaact tgaatccaac 840

gggcattcta tctccccggc gcgtttcgat cagtacatgt acccttacct ggaaaaggac 900

agctccctga gcgaggaaca ggcgcaggaa ttgctggatt gtctgtggct caagttcaac 960

gacgttaaca aggttcgtga tgaaggctcg accaaaggtt ttggtggcta tccgatgttc 1020

cagaacctga tcgttggcgg tcaaaccagc ggcggacagg acgccactaa cagactgtcc 1080

tttatggcca tgacggctac cgcccatgtt cgtctgcatg aaccttcact gtcagtacgt 1140

gtctggtcaa aatctccgga cgatttttta ctgaaagcct gtgaagtcag tcgtcttggt 1200

atggggatcc cggcctatta caacgatgaa gttgttatcc ctgcattgat taaccgcggc 1260

ctgaccctgg aagatgcgcg ggaatacggc atcatcggct gcgtcgaacc tcaacgtccg 1320

ggaaaaacag aaggctggca cgacgccgcg ttctataaca tgagtaaggt actggaaata 1380

accctgaaca acggacgctg cggggataaa caactcggcc ccaaaactgg tgagctggat 1440

tcattccaga gtattgaaga catcattgaa gcttatcgta aacagaacga atattttgtc 1500

tatcatctgg caatggccgt taacagtgtt gaccttgctc atatggaacg ggcccccctg 1560

ccgttcctgt cctgtatggt ggatgactgt atcagtcgcg gtaaaagcgt tcaggaaggc 1620

ggtgcccatt ataacttcac gggtccgcaa ggtgtcggcg ttgccaatgt gggcgactcg 1680

ctgatggcta tcaaacgtct ggtatttgaa gaaggccaat tatcgctggg tcatctgaaa 1740

gaagcactgg atgccaattt cggtgtatct ggcgggatag agaaacctga cactatagcc 1800

actgaaagta cgccgaaaca ggatgcaacc tatgaactag tccttgaggc cgtgaagaaa 1860

gtgctgggcg aaagcggcgc acttgcactc acctcactca atagcaaccc accggagcct 1920

gtcaaagggg ctaatgccgg gctgacagca gtgcgtcagt tactcattaa tggcgccccc 1980

aagttcggta atgacattga cgaagtggat atgctggccc gtaccggtgc tgaaatttac 2040

tgtcgcgagg tagaaaaata caccaaccca cgtggcggtt tattccaggc tggcttatat 2100

ccggtatccg ctaatgtggc tctcggtgag agcgtcgggg caactccaga tggacgtctg 2160

gccggccagc cgcttcccga tggggtgtcg cccagcaggg gcatggatac aaaaggtcca 2220

accgctgccg ccaactcagt agccaagctg gatcacttcc tggcctcaaa tggcacgctg 2280

tttaatcaga aattccatcc ggcagctctg aaaggcgatg agggattata ccatctggcg 2340

gccttactgc gtggttattt cgatcagaaa ggcatgcatg ttcagttcaa tgtgatcgac 2400

cgtaatacac tgctggcagc acaaaaagaa ccagaaaaat atcgtgatct ggttgtgcgt 2460

gtggcgggtt acagtgcgca atttgtctca ctggataaaa gcgtacagga cgatattatc 2520

ctgcgaaccg aacatgtctt ttaa 2544

<210> 2

<211> 921

<212> DNA

<213> dhaB2(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 2

atggcggaaa ttgattacgc gcagactggc accgtattta atatacaaaa attctcctta 60

catgatggtc cgggcatacg cacaattgta ttcctgaaag gctgttatct ggcatgtaaa 120

tggtgcagta atccggaatc acagcacact gaaccggaaa tattttacta cgaacgcaat 180

tgtatccatt gcggacgctg cgtatccgcc tgccccgttg gggctatcga tgcctcacgt 240

caagggctta ttgaccggaa tgcctgtatt cattgtggag cttgcgctga ggtctgcccg 300

gctggcgcga tggttcagtc aggtaagaga atgtcggtgg tggaggttat agacgaactg 360

cgtaaagatg agacgcatta tcgccgctcc ggtggaggta ttacattgtc cggtggcgaa 420

gcactggctc agcctgcatt tgcagcagca ttgctggccg cctgcaaagc cagaggatgg 480

catacagcga tggaaaccac cggaatagcc tcccgggccg tgctggaaaa ggttatccca 540

ttgcttgata tcgtattgct cgacatcaaa accttttata gtgaacggca taaggaattt 600

acgggacatc cgaatgagac ggttttacgt aatgcactga caatttcaga actggcaaag 660

aatgtcgccg ttcggatccc ggtaattcct ggatttaatg atgatgaaca aagtatcgaa 720

gctattgcca gatttgttac gcacatgaaa aatgtatcgc gattacattt attgccctat 780

cacaactatg gccataataa atataacctg cttggcagaa cgtacgacat gattgaaata 840

aaaccaccgg aagaaagtcg tatgcataaa tataaagata ttgtgacatc ccttggaatc 900

gactgcgtca tcggtgggta a 921

<210> 3

<211> 49

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 3

aagcttgtcg acggagctcg aattctcaga agcggaatgt gaaaaggcc 49

<210> 4

<211> 44

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 4

ctggtgccgc gcggcagcca tatgatgacg ccgaaactga accg 44

<210> 5

<211> 50

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 5

aagcttgtcg acggagctcg aattcttagc ttcctttacg cagcttatgc 50

<210> 6

<211> 55

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 6

ctggtgccgc gcggcagcca tatgatgaaa agatcaaaac gatttgcagt actgg 55

<210> 7

<211> 53

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 7

tgcatgcctg caggtcgact ctgacgttca caaactgcat atatctgata gac 53

<210> 8

<211> 32

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 8

tatatctcct ttcaggcctc caggcttatc ca 32

<210> 9

<211> 0

<212> PRT

<213> dhaB1(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 9

<210> 10

<211> 0

<212> PRT

<213> dhaB2(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 10

<210> 11

<211> 3620

<212> DNA

<213> dhaB1B2(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 11

gtagtggaga acaagaaatg agccaattat cacaggcttt tggtgaacca actgaccgaa 60

ttcgtgcctt acgggaacaa atccttgata cgaccccctg cattgagacg gatcgtgccc 120

gcctgatcac cgagtcctat aaggaaacgg aatccctgcc catgatcatc cgtcgcgcca 180

aagcgcttga gaagatcctt gcggaattgc cggtcaccat ccgggaaggt gaactaatcg 240

ttggtagtct gacagtcact cctcattcca cacaaattta cccggagtac tcaaatcgct 300

ggcttcagga tgaattcgat cgtctgaatc tgcgtaaagg cgaccgtttt accataaccg 360

atgaagcgaa acagcagctg gatagcgtat ttggctactg ggaagggaaa acaacgaatg 420

aactggctac atcctatatg ttgcctgaaa cgcttgattg catggcagaa aatgtcttca 480

ctgtcggcaa ctattacttt aatggcgtcg gtcatatagc cgtggactac gcgcgtgttc 540

tcgctcgtgg atacaaaggc atcatccagg atgttgttgc agcaatggcc agcgctgata 600

aaaaagaccc cgcttttctg aaaaaagaat cgttctacaa ggcggtcatt atttcttgta 660

acgcagcaat caattttgct catcgttacg cggttaaagc tcgtactctc gcggaacagg 720

cctcaccagt ccgtaaaaaa gagctgctga aaattgctga aatctgtgac aaagtacctg 780

aaaatggtgc aagtaatttc tatgaagcct gccagtcatt ctggtttgcc catgccatta 840

ttcaacttga atccaacggg cattctatct ccccggcgcg tttcgatcag tacatgtacc 900

cttacctgga aaaggacagc tccctgagcg aggaacaggc gcaggaattg ctggattgtc 960

tgtggctcaa gttcaacgac gttaacaagg ttcgtgatga aggctcgacc aaaggttttg 1020

gtggctatcc gatgttccag aacctgatcg ttggcggtca aaccagcggc ggacaggacg 1080

ccactaacag actgtccttt atggccatga cggctaccgc ccatgttcgt ctgcatgaac 1140

cttcactgtc agtacgtgtc tggtcaaaat ctccggacga ttttttactg aaagcctgtg 1200

aagtcagtcg tcttggtatg gggatcccgg cctattacaa cgatgaagtt gttatccctg 1260

cattgattaa ccgcggcctg accctggaag atgcgcggga atacggcatc atcggctgcg 1320

tcgaacctca acgtccggga aaaacagaag gctggcacga cgccgcgttc tataacatga 1380

gtaaggtact ggaaataacc ctgaacaacg gacgctgcgg ggataaacaa ctcggcccca 1440

aaactggtga gctggattca ttccagagta ttgaagacat cattgaagct tatcgtaaac 1500

agaacgaata ttttgtctat catctggcaa tggccgttaa cagtgttgac cttgctcata 1560

tggaacgggc ccccctgccg ttcctgtcct gtatggtgga tgactgtatc agtcgcggta 1620

aaagcgttca ggaaggcggt gcccattata acttcacggg tccgcaaggt gtcggcgttg 1680

ccaatgtggg cgactcgctg atggctatca aacgtctggt atttgaagaa ggccaattat 1740

cgctgggtca tctgaaagaa gcactggatg ccaatttcgg tgtatctggc gggatagaga 1800

aacctgacac tatagccact gaaagtacgc cgaaacagga tgcaacctat gaactagtcc 1860

ttgaggccgt gaagaaagtg ctgggcgaaa gcggcgcact tgcactcacc tcactcaata 1920

gcaacccacc ggagcctgtc aaaggggcta atgccgggct gacagcagtg cgtcagttac 1980

tcattaatgg cgcccccaag ttcggtaatg acattgacga agtggatatg ctggcccgta 2040

ccggtgctga aatttactgt cgcgaggtag aaaaatacac caacccacgt ggcggtttat 2100

tccaggctgg cttatatccg gtatccgcta atgtggctct cggtgagagc gtcggggcaa 2160

ctccagatgg acgtctggcc ggccagccgc ttcccgatgg ggtgtcgccc agcaggggca 2220

tggatacaaa aggtccaacc gctgccgcca actcagtagc caagctggat cacttcctgg 2280

cctcaaatgg cacgctgttt aatcagaaat tccatccggc agctctgaaa ggcgatgagg 2340

gattatacca tctggcggcc ttactgcgtg gttatttcga tcagaaaggc atgcatgttc 2400

agttcaatgt gatcgaccgt aatacactgc tggcagcaca aaaagaacca gaaaaatatc 2460

gtgatctggt tgtgcgtgtg gcgggttaca gtgcgcaatt tgtctcactg gataaaagcg 2520

tacaggacga tattatcctg cgaaccgaac atgtctttta attgacagtc ggccggattt 2580

ctcaacataa ggatattatc ttctgatgat tgttttcctt gtttttacag acaaggaaaa 2640

cacatccggc caataacatg ctgaatatca gcatgaagaa aagaaataaa ggtattgaca 2700

tggcggaaat tgattacgcg cagactggca ccgtatttaa tatacaaaaa ttctccttac 2760

atgatggtcc gggcatacgc acaattgtat tcctgaaagg ctgttatctg gcatgtaaat 2820

ggtgcagtaa tccggaatca cagcacactg aaccggaaat attttactac gaacgcaatt 2880

gtatccattg cggacgctgc gtatccgcct gccccgttgg ggctatcgat gcctcacgtc 2940

aagggcttat tgaccggaat gcctgtattc attgtggagc ttgcgctgag gtctgcccgg 3000

ctggcgcgat ggttcagtca ggtaagagaa tgtcggtggt ggaggttata gacgaactgc 3060

gtaaagatga gacgcattat cgccgctccg gtggaggtat tacattgtcc ggtggcgaag 3120

cactggctca gcctgcattt gcagcagcat tgctggccgc ctgcaaagcc agaggatggc 3180

atacagcgat ggaaaccacc ggaatagcct cccgggccgt gctggaaaag gttatcccat 3240

tgcttgatat cgtattgctc gacatcaaaa ccttttatag tgaacggcat aaggaattta 3300

cgggacatcc gaatgagacg gttttacgta atgcactgac aatttcagaa ctggcaaaga 3360

atgtcgccgt tcggatcccg gtaattcctg gatttaatga tgatgaacaa agtatcgaag 3420

ctattgccag atttgttacg cacatgaaaa atgtatcgcg attacattta ttgccctatc 3480

acaactatgg ccataataaa tataacctgc ttggcagaac gtacgacatg attgaaataa 3540

aaccaccgga agaaagtcgt atgcataaat ataaagatat tgtgacatcc cttggaatcg 3600

actgcgtcat cggtgggtaa 3620

Claims (10)

1. An overexpressed glycerol dehydratase gene is derived from Vibrio diazotrophicus and comprises two subunits, namely an alpha subunit and a beta subunit;

the nucleotide sequence of the alpha subunit contains a nucleotide sequence shown as SEQ ID NO.1 or a nucleotide sequence shown as SEQ ID NO.1 which is substituted, deleted and/or added with one or more nucleotides;

the nucleotide sequence of the beta subunit contains a nucleotide sequence shown as SEQ ID NO.2 or a nucleotide sequence shown as SEQ ID NO.2 which is substituted, deleted and/or added with one or more nucleotides.

2. An overexpressed glycerol dehydratase gene encoding protein encoded by the overexpressed glycerol dehydratase gene of claim 1;

the amino acid sequence of the alpha subunit coding protein contains an amino acid sequence shown as SEQ ID NO.10 or the amino acid sequence shown as SEQ ID NO.10 is substituted, deleted and/or added with one or more amino acids;

the amino acid sequence of the beta subunit coding protein contains the amino acid sequence shown as SEQ ID NO.11 or the amino acid sequence shown as SEQ ID NO.11 is substituted, deleted and/or added with one or more amino acids.

3. A biomaterial comprising an overexpressed glycerol dehydratase gene comprising the overexpressed glycerol dehydratase gene of claim 1, wherein the biomaterial is a vector, a recombinant bacterium, a cell line, or an expression cassette.

4. The use of an overexpressed glycerol dehydratase gene and a protein encoded by the overexpressed glycerol dehydratase gene in catalyzing glycerol dehydration is characterized in that the overexpressed glycerol dehydratase gene is the overexpressed glycerol dehydratase gene according to claim 1, and the overexpressed glycerol dehydratase gene-encoded protein is the overexpressed glycerol dehydratase gene-encoded protein according to claim 2.

5. Use of a biological material comprising an overexpressed glycerol dehydratase gene in the catalysis of glycerol dehydration, wherein the biological material is the biological material comprising an overexpressed glycerol dehydratase gene according to claim 3.

6. Use of an overexpressed glycerol dehydratase gene and its encoded protein for increasing the production of 1, 3-propanediol, wherein the overexpressed glycerol dehydratase gene is the overexpressed glycerol dehydratase gene of claim 1 and the overexpressed glycerol dehydratase gene-encoded protein is the overexpressed glycerol dehydratase gene-encoded protein of claim 2.

7. Use of a biological material comprising an overexpressed glycerol dehydratase gene in the production of 1, 3-propanediol comprising the biological material of claim 3.

8. Use of an overexpressed glycerol dehydratase gene and its encoded protein for the production of 1, 3-propanediol, wherein the overexpressed glycerol dehydratase gene is the overexpressed glycerol dehydratase gene of claim 1 and the overexpressed glycerol dehydratase gene-encoded protein is the overexpressed glycerol dehydratase gene-encoded protein of claim 2.

9. Use of an overexpressed glycerol dehydratase gene and its encoded protein to tolerate glycerol in biological fermentations, wherein the overexpressed glycerol dehydratase gene is the overexpressed glycerol dehydratase gene of claim 1 and the overexpressed glycerol dehydratase gene-encoded protein is the overexpressed glycerol dehydratase gene-encoded protein of claim 2.

10. Use of an overexpressed glycerol dehydratase gene in tolerance to oxygen in a biological fermentation, wherein the overexpressed glycerol dehydratase gene is the overexpressed glycerol dehydratase gene of claim 1.