CN115772509A - Transaminase mutant and coding gene and application thereof - Google Patents

Abstract

The invention relates to a transaminase mutant, a coding gene and application thereof, wherein the transaminase mutant is derived from the transaminase of Aspergillus fumigatus Af293 and has one or more combined mutations of any two of the following groups: a substitution of valine for methionine at position 113, glutamine for leucine at position 181, leucine for glutamine at position 126, or methionine for leucine at position 143. The transaminase mutant can catalyze a substrate (2R, 4S) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4-pentanoic acid to generate a Sacubuqu intermediate (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methyl pentanoic acid, overcomes the defect of low conversion efficiency of wild transaminase, and has catalytic activity which can be 25 times that of wild transaminase.

Description

Transaminase mutant and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, and particularly relates to a transaminase mutant and a coding gene and application thereof.

Background

Transaminase (TA, EC 2.6.1. X), also called aminotransferase, is mainly used for catalyzing the transamination between amino and keto groups, and is one of the key enzymes for catalyzing the generation of chiral amine. Chiral amine is an important intermediate for synthesizing natural products and chiral drugs, and the asymmetric synthesis research of the chiral amine has profound theoretical value and practical significance.

The natural transaminase has the disadvantages of low catalytic efficiency and poor stability, which limits the wide application of the transaminase. Site-directed mutagenesis refers to the insertion, substitution, and deletion of specific nucleotides in a known gene sequence to alter the primary structure of the protein. The enzyme can be modified by site-directed mutagenesis, so that mutants with improved catalytic activity and stability can be obtained. Chinese patent document CN107653233A discloses an improved transaminase, and the activity of the obtained mutant enzyme is improved by two times by mutating three sites of the transaminase derived from Aspergillus fumigatus Af 293.

The prior art still has the defects that the transaminase source is single, the enzymatic activity is not obviously improved after mutation transformation and the like, and the field needs to develop new transaminase with high catalytic activity and stereoselectivity urgently.

Disclosure of Invention

The transaminase mutant is derived from the transaminase of Aspergillus fumigatus Af293, can catalyze a substrate (2R, 4S) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4 pentanoic acid to generate a Sacubitril intermediate (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methyl pentanoic acid, overcomes the defect of low conversion efficiency of wild-type transaminase, has obviously improved catalytic activity and can reach 25 times of the wild type transaminase.

To this end, in a first aspect, the present invention provides a transaminase mutant, which comprises the amino acid sequence set forth in SEQ ID NO:1, or a combination of any two or more of the following:

substitution of methionine (M) at position 113 to valine (V);

substitution of leucine (L) at position 181 with glutamine (Q);

substitution of glutamine (Q) at position 126 to leucine (L);

substitution of leucine (L) at position 143 with methionine (M).

The transaminase mutants according to the invention have the numerical numbering of the amino acid positions: as set forth in SEQ ID NO:1 is the first amino acid at the N-terminus, and is numbered sequentially in the C-terminal direction.

In some embodiments, the transaminase mutant comprises the amino acid sequence set forth in SEQ ID NO:1 with an amino acid substitution in one of the following groups:

substitution of methionine (M) at position 113 to valine (V);

substitution of leucine (L) at position 181 with glutamine (Q);

substitution of glutamine (Q) at position 126 to leucine (L);

substitution of leucine (L) at position 143 with methionine (M);

a substitution of methionine (M) to valine (V) at position 113 and a substitution of leucine (L) to glutamine (Q) at position 181;

a substitution of methionine (M) to valine (V) at position 113 and a substitution of glutamine (Q) to leucine (L) at position 126;

a substitution of methionine (M) at position 113 with valine (V), and a substitution of leucine (L) at position 143 with methionine (M);

a substitution of leucine (L) for glutamine (Q) at position 181 and a substitution of glutamine (Q) for leucine (L) at position 126;

substitution of leucine (L) at position 181 with glutamine (Q), and substitution of leucine (L) at position 143 with methionine (M);

a substitution of glutamine (Q) at position 126 with leucine (L) and a substitution of leucine (L) at position 143 with methionine (M);

a substitution of methionine (M) at position 113 with valine (V), a substitution of leucine (L) at position 181 with glutamine (Q), and a substitution of glutamine (Q) at position 126 with leucine (L);

a substitution of methionine (M) at position 113 with valine (V), a substitution of leucine (L) at position 181 with glutamine (Q), and a substitution of leucine (L) at position 143 with methionine (M);

a substitution of methionine (M) at position 113 with valine (V), a substitution of glutamine (Q) at position 126 with leucine (L), and a substitution of leucine (L) at position 143 with methionine (M);

a substitution of leucine (L) at position 181 with glutamine (Q), a substitution of glutamine (Q) at position 126 with leucine (L), and a substitution of leucine (L) at position 143 with methionine (M);

substitution of methionine (M) at position 113 with valine (V), substitution of leucine (L) at position 181 with glutamine (Q), substitution of glutamine (Q) at position 126 with leucine (L), and substitution of leucine (L) at position 143 with methionine (M).

In a second aspect of the invention, there is provided a nucleic acid molecule encoding a transaminase mutant of the invention.

In a third aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the invention.

Further, the carrier may be selected from one of the following groups: a plasmid, phage, cosmid, artificial chromosome, plant cell virus, mammalian cell virus, or retrovirus.

In some embodiments, the plasmid may be selected from pET28 such as pET28a (+), pET32, pQE-30, pGEX-4T-2, pBR322, or pUC18, and the like.

In a fourth aspect of the invention, there is provided a host cell expressing a transaminase mutant of the invention, and/or comprising a nucleic acid molecule of the invention, and/or comprising a vector of the invention.

Further, the host cell is a prokaryotic cell, a yeast cell, an insect cell, or a mammalian cell.

In some embodiments, the host cell may be selected from Escherichia coli, bacillus subtilis, diplococcus pneumoniae, etc.

In some embodiments, the escherichia coli can be selected from escherichia coli DH5 α strain, escherichia coli BL21 (DE 3) strain, escherichia coli JM109 strain, escherichia coli TOP10 strain, escherichia coli HB101 strain, and the like.

Further, the host cell is transaminase mutant engineering bacteria, and the engineering bacteria are E.coli BL21 (DE 3) containing the vector; preferably, the vector is a plasmid pET28a (+) containing the nucleic acid molecule of the invention.

In a fifth aspect of the present invention, there is provided a method for preparing the transaminase mutant of the present invention, comprising the following steps: allowing the host cell of the fourth aspect of the invention to express the transaminase mutant of the invention, and isolating and purifying the transaminase mutant.

According to a sixth aspect of the present invention, there is provided a transaminase mutant according to the present invention, and/or a nucleic acid molecule according to the present invention, and/or a vector according to the present invention, and/or a host cell according to the present invention for catalyzing asymmetric transamination of a ketone compound to produce a chiral amine.

In some embodiments, the ketone compound is (2r, 4s) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4 pentanoic acid and the chiral amine is (2r, 4s) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylpentanoic acid.

In a seventh aspect of the present invention, there is provided a process for the preparation of a Sacubitril intermediate, which comprises subjecting the substrate (2R, 4S) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4-pentanoic acid to the catalytic action of said transaminase mutant to produce (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylpentanoic acid.

Further, the catalyzed reaction conditions include: the alkaline conditions are, for example, pH 8.5 to 9.5 and the reaction temperature 35 to 45 ℃.

Compared with the prior art, the invention has at least the following advantages:

(1) The invention screens and obtains 4 positive mutation amino acid sites based on the transaminase derived from Aspergillus fumigatus Af293 of Aspergillus fumigatus: a transaminase mutant is provided in which methionine at position 113 is substituted with valine, leucine at position 181 is substituted with glutamine, glutamine at position 126 is substituted with leucine, and leucine at position 143 is substituted with methionine. The invention provides the transaminase mutant with amino acid mutation of one or two of the four groups, and the catalytic activity of the transaminase mutant is obviously improved compared with that of wild transaminase and can reach 25 times that of wild transaminase.

(2) The transaminase mutant provided by the invention can be used for preparing a Sacubitril intermediate (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylvaleric acid, has the advantages of simple operation, mild reaction conditions, high product yield, high purity, low production cost and the like compared with a chemical synthesis method, provides a more novel, green and environment-friendly direction for a synthesis process of LCZ696, and has good industrial application prospects.

Drawings

Various other advantages and benefits will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. The drawings are only for purposes of illustrating the preferred embodiments and are not to be construed as limiting the invention. In the drawings:

FIG. 1: performing high performance liquid chromatogram of (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methyl pentanoic acid generated by transaminase before mutation transformation;

FIG. 2: the transaminase mutant provided by the invention catalyzes and generates (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methyl pentanoic acid high performance liquid chromatogram;

FIG. 3: in an amplification reaction, the transaminase mutant provided by the invention catalyzes to generate (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylpentanoic acid by a high performance liquid chromatography.

Detailed Description

Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Herein, an amino acid "substitution" refers to the replacement of one amino acid with another amino acid in a polypeptide.

Herein, amino acid substitutions are indicated by a first letter followed by a number followed by a second letter. The first letter represents a substituted amino acid; the numbers refer to the positions of amino acids substituted therein, numbered as SEQ ID NO:1, the first amino acid at the N terminal is the first position, and the amino acids are numbered in the direction of the C terminal in sequence; the second letter indicates the amino acid used to replace the amino acid indicated in the first letter.

As used herein, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When a vector allows the expression of a protein encoded by a polynucleotide inserted therein, the vector is referred to as an expression vector. The vector may be used to express the carried genetic material element in a host cell by transformation, transduction, or transfection into the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, phages, cosmids, artificial chromosomes such as Yeast Artificial Chromosomes (YACs), bacterial Artificial Chromosomes (BACs) or P1-derived artificial chromosomes (PACs); bacteriophages such as lambda bacteriophage or M13 bacteriophage and animal viruses. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), pox viruses, baculoviruses, papilloma viruses, papova viruses (e.g., SV 40). The vector may contain a number of elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may comprise an origin of replication.

As used herein, "host cell" refers to a cell into which an exogenous nucleic acid has been introduced, including progeny of such a cell. Host cells include the initially transformed cells and progeny derived therefrom (irrespective of the number of passages). Progeny may not be identical to the parent cell in nucleic acid content, but may contain mutations. Included herein are mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell. The host cell is any type of cell system that can be used to produce the fusion protein of the invention. Host cells include cultured mammalian cells such as CHO cells, BHK cells, NS0 cells, SP2/0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER. C6 cells or hybridoma cells, yeast cells, bacterial cells such as E.coli, insect cells and plant cells, etc., and also include cells contained in transgenic animals, transgenic plants or cultured plants or animal tissues.

Herein, "engineered bacterium" or "genetically engineered bacterium" refers to a fungus cell line in which a foreign gene is expressed efficiently by genetic engineering. The fungus cell strain can be called as recipient fungus. In some embodiments, the recipient bacterium can be e.coli BL21 (DE 3), and the exogenous gene is a gene expressing a transaminase mutant described herein. Methods for preparing the engineered bacteria are within the technical scope of those skilled in the art, and in some embodiments, the methods for preparing the engineered bacteria comprise cloning the gene of the transaminase mutant provided by the invention into a plasmid pET28a (+), and then transferring the plasmid into E.coli BL21 (DE 3) to obtain the transaminase mutant engineered bacteria.

Herein, "sacuba koji" is a prodrug with the chemical name 4- ((2s, 4r) -1- ([ 1,1' -biphenyl ] -4-yl) -5-ethoxy-4-methyl-5-oxopentan-2-yl) amino) -4-oxobutanoic acid. LCZ696 is a new antihypertensive drug developed by Nonhua for treating NYHAII-IV grade heart failure patients, and comprises two components of valsartan and sabotarol, which are cocrystals of the two components, wherein valsartan can improve vasodilation and stimulate the body to excrete sodium and water, and sabotarol can block the action of two polypeptides threatening to lower blood pressure. In some embodiments of the invention, the substrate (2r, 4 s) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4-pentanoic acid is catalyzed to form the shakubata intermediate (2r, 4 s) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylpentanoic acid by the catalytic action of the transaminase mutants provided herein.

The conventional single or three letter code for natural amino acids is used herein:

in some embodiments of the invention, there is provided a transaminase mutant comprising the amino acid sequence: in SEQ ID NO:1 or a combination of any two or more of the following groups: substitution of M at position 113 with V, substitution of L at position 181 with Q, substitution of Q at position 126 with L, and substitution of L at position 143 with M.

In some embodiments of the invention, there is provided a transaminase mutant comprising the amino acid sequence: in SEQ ID NO:1 with an amino acid substitution of one of the following groups: M113V, L181Q, Q126L, L143M, M113V + Q126L, M113V + L143M, Q126L + L143M, L143M + L181Q, M113V + Q126L + L143M, M113V + Q126L + L181Q, M113V + L143M + L181Q, Q126L + L143M + L181Q, or M113V + Q126L + L181Q + L143M.

The transaminase mutant provided by the invention has the activity of catalyzing asymmetric transamination reaction of ketone compounds to generate chiral amine, and comprises the following activities of effectively catalyzing a substrate (2R, 4S) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4 pentanoic acid to generate a shakubatu intermediate (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methyl pentanoic acid, wherein the reaction formula of the catalytic reaction is as follows:

example 1 directed mutagenesis of transaminases

(I) construction of plasmids for directed mutagenesis engineering

Providing a gene of an initial transaminase for modification by a synthetic method, wherein the nucleotide sequence is SEQ ID NO: 2) The transaminase was engineered from Aspergillus fumigatus Af293 (Aspergillus fumigatus) branched chain amino acid transferase (NCBI SEQ ID: XM-743728.1), with a similarity of 96.28%. The initial transaminase gene for modification was constructed into pET28a (+) expression vector by double enzyme digestion (NdeI/XhoI) ligation to obtain a recombinant expression plasmid for the initial transaminase.

Transforming the recombinant expression plasmid of the initial transaminase into E.coli BL21 competent cells, screening on an LB solid medium (protein vein L0g/L, yeast extract 5g/L, sodium chloride L0g/L and agar 15 g/L) containing kanamycin (50 mu g/mL), selecting a monoclonal, culturing a recombinant strain, extracting a plasmid after plasmid amplification, obtaining a positive recombinant escherichia coli expressing the initial transaminase for modification after sequencing verification is correct, enabling the strain to be numbered as # 1, and using the positive recombinant escherichia coli for directed mutagenesis modification in the following steps.

(II) directed mutagenesis engineering

The 1# strain is used as a template, and directed mutation transformation is carried out by a PCR amplification method, wherein the used primers are shown in table 1, and the PCR reaction system is shown in table 2.

TABLE 1 Directional mutation engineering primers

Primer and method for producing the sameName (name)	Primer sequences	SEQ ID NO：
			M113V-F1	CCGGGATGCGGTGGTGAAGGTTATCGTGAC		29
M113V-R1	TAACCTTCACCACCGCATCCCGGATACCAC						30
			Q126L-F1	GACAGGTGTATTGGGTTCGAAGCCTGAGGA		31
Q126L-R1	GCTTCGAACCCAATACACCTGTCAGACCAC						32
			L143M-F	CTGCTTGTTATGCCATACATTTGGTTGATG		33
L143M-R	AATGTATGGCATAACAAGCAGGTATATGTT						34
			L181Q-F	ATCAAAAATCAGCAGTGGGGTGATTTAATT		35
L181Q-R	ACCCCACTGCTGATTTTTGATAGTAGGATC						36

TABLE 2 directed mutagenesis PCR reaction System

Components	Volume of
		SapphireAmp Fast PCR Master Mix	25μL
Primer forward	1μL
		Primer reverse	1μL
Stencil (50-100 ng)	3μL
		ddH 2 O	Up to 50μL

The PCR program conditions were set as: performing pre-denaturation at 98 ℃ for 2min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, extension at 72 ℃ for 2min30s,34 cycles, and final extension at 72 ℃ for 5min.

And (3) carrying out l% agarose gel electrophoresis detection on the PCR product, and then recovering and purifying the PCR product obtained by amplification by using a DNA gel electrophoresis recovery kit to obtain a purified PCR product. After a purified PCR product is subjected to template digestion by using DpnI, taking 2 mu L of the purified PCR product, adding the obtained product into 100 mu L of E.coli BL21 competent cells, gently mixing the obtained product uniformly, placing the obtained product on ice for 30min, thermally beating the obtained product in a 42 ℃ water bath kettle for 90s, carrying out ice bath for 2min, adding 800 mu L of LB liquid culture medium, incubating the obtained product at 37 ℃ and 220rpm for 1h, centrifuging the obtained product at 4000rpm, discarding 800 mu L of supernatant, uniformly coating resuspended thalli on an LB solid plate (containing 50ug/mL of kanamycin) for overnight culture, taking single colony for amplification culture, and then carrying out sequencing verification to verify that a correct transformant is the genetically engineered bacterium for expressing the transaminase mutant; the serial numbers of the prepared genetic engineering strains and the amino acid sequences of the transaminases expressed by the genetic engineering strains are shown in Table 3.

TABLE 3 transaminase amino acid sequences

Example 2 expression of transaminase

This example describes the protein expression of the initial transaminase and the respective transaminase mutants of example 1, comprising the following steps: the strains numbered 1# -16 # prepared in example 1 were inoculated into LB liquid medium (containing kanamycin at a final concentration of 50. Mu.g/mL) and cultured overnight with shaking at 37 ℃; then inoculating the mixture into a 250mL triangular flask containing 50mL LB liquid culture medium (containing kanamycin and having a final concentration of 50 mu g/mL) according to the inoculation amount of 2% (v/v), and placing the flask at 37 ℃ for shake culture at 220 rpm; when OD of culture solution ₆₀₀ When the concentration reaches 0.8, IPTG with the final concentration of 0.5mmol/L is added for induction expression; after 18h of induction expression at 25 ℃, the culture broth was centrifuged, wet cells were collected and cells were disrupted at-20 ℃ to obtain transaminase samples (for each transaminase, multiple parallel transaminase samples were prepared).

Example 3 enzyme catalyzed reaction

Each of the transaminase samples prepared in example 2 (two parallel transaminase samples for each transaminase) was taken, and a substrate solution (1.2 mg of (2R, 4S) -5- ([ 1,1' -biphenyl) was added thereto]-4-yl) -2-methyl-4-pentanoneKeto acid in 0.25mL PBS buffer, adding 0.75mL i-PrNH ₂ HCl and 1mg of PLP, adjusted to pH 9.0 to prepare a substrate solution), adjusted to pH 9.0, and reacted at 40 ℃ overnight to obtain a reaction solution. Sampling 100 mu L of the reaction solution, adding 100 mu L of acetonitrile, performing ultrasonic treatment for 2min, centrifuging, taking supernatant, filtering, and performing HPLC detection. Substrate (2R, 4S) -5- ([ 1,1' -biphenyl)]Catalyzing (4-yl) -2-methyl-4 pentanoic acid to generate (2R, 4S) -5- ([ 1,1' -biphenyl)]-4-yl) -4-amino-2-methylpentanoic acid.

In FIG. 1, the HPLC profile of the reaction solution obtained from the initial transaminase catalysis is shown; in figure 2 is shown that the amino acid sequence is SEQ ID NO: HPLC profile of reaction solution catalyzed by the transaminase mutant of 25 (mutation sites M113V, Q126L, L181Q).

The conversion of each transaminase-catalyzed substrate (2r, 4s) -5- ([ 1,1' -biphenyl ] -4-yl) -2-methyl-4-pentanoic acid was calculated from the HPLC assay results (for each transaminase, the average of the conversions of its two parallel transaminase samples was taken) and the conversion calculation results are shown in table 4.

TABLE 4 catalytic conversion of the transaminases

Numbering	Mutation site	Conversion rate
				1#		1.11％
2#	L143M	1.81％
			3#	Q126L	2.01％
4#	M113V	15.02％
			5#	L181Q	3.84％
6#	M113V、Q126L	24.91％
			7#	M113V、L143M	24.15％
8#	Q126L、L143M	4.51％
			9#	L143M、L181Q	9.02％
10#	M113V、Q126L、L143M	13.04％
			11#	M113V、Q126L、L181Q	29.63％
12#	M113V、L143M、L181Q	15.28％
			13#	Q126L、L143M、L181Q	7.91％
14#	M113V、Q126L、L181Q、L143M	11.12％

According to table 4, the enzyme activity was significantly improved after single point mutation of L143M, Q126L, M113V or L181Q of the initial transaminase; and, by combining the four mutations in an overlapping manner, a catalytic effect significantly superior to that of the original transaminase was obtained.

EXAMPLE 4 enzymatic amplification reaction

The transaminase sample No. 11 prepared in example 2 was sampled and added to the amplified substrate solution (10 g of (2R, 4S) -5- ([ 1,1' -biphenyl)]-4-yl) -2-methyl-4-pentanoic acid to 25mL PBS buffer, add i-PrNH ₂ Adjusting the pH value of HCl (4M, 75mL) and PLP (50 mg) to 9.0 to prepare an amplified substrate solution, adjusting the pH value to 9.0, and reacting at 40 ℃; after the reaction is carried out overnight, sampling 100 mu L, adding 100 mu L acetonitrile, carrying out ultrasonic treatment for 2min, centrifuging, taking supernate, filtering, and carrying out HPLC detection, wherein a detection map is shown in figure 3; and stopping the reaction when the substrate residue is less than 5%, and cooling the reaction temperature to room temperature to obtain a reaction product solution. Adding 2-methyltetrahydrofuran (50 mL) into the reaction product solution, stirring, adding concentrated hydrochloric acid, adjusting the pH value to 2.0, adding sodium chloride until the solution is saturated until layering occurs, collecting an organic phase, extracting the aqueous phase with 2-methyltetrahydrofuran (50 mL) for 3 times, and combining the organic phases; the combined organic phases were washed with saturated sodium chloride solution (50 mL), and the solvent was removed under reduced pressure by the organic phase to give a white solid (10.77 g,yield 95.2%, dr > 99

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the appended claims.

Sequence listing

<110> Guangdong Dongyuang pharmaceutical Co., ltd

<120> transaminase mutant and coding gene and application thereof

<160> 36

<170> PatentIn version 3.5

<210> 1

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Leu Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 2

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttttgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 3

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 4

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 5

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Leu Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 6

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttttgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 7

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Leu Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 8

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttttgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 9

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Leu Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Gln Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 10

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttttgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

aagcagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 11

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Leu Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 12

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttttgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 13

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 14

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 15

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 15

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 16

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 17

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 17

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Gln Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 18

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

aagcagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 19

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 19

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Leu Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 20

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

ctacagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 21

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 21

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Leu Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Gln Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 22

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttttgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

aagcagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 23

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 23

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Gln Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Gln Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 24

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtacaggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

aagcagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 25

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 25

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Met Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Gln Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 26

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcgatgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

aagcagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 27

<211> 323

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 27

Met Ala Ser Met Asp Lys Val Phe Ser Gly Tyr Tyr Ala Arg Gln Lys

1 5 10 15

Leu Leu Glu Arg Ser Asp Asn Pro Phe Ser Lys Gly Ile Ala Tyr Val

20 25 30

Glu Gly Lys Leu Val Leu Pro Ser Asp Ala Arg Ile Pro Leu Leu Asp

35 40 45

Glu Gly Phe Met His Ser Asp Leu Thr Tyr Asp Gly Phe His Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Gln Arg Ile Leu Glu

65 70 75 80

Ser Cys Asp Lys Met Arg Leu Lys Phe Pro Leu Ala Leu Ser Ser Val

85 90 95

Lys Asn Ile Leu Ala Glu Met Val Ala Lys Ser Gly Ile Arg Asp Ala

100 105 110

Val Val Lys Val Ile Val Thr Arg Gly Leu Thr Gly Val Leu Gly Ser

115 120 125

Lys Pro Glu Asp Leu Tyr Asn Asn Asn Ile Tyr Leu Leu Val Met Pro

130 135 140

Tyr Ile Trp Leu Met Ala Pro Glu Asn Gln Leu His Gly Gly Glu Ala

145 150 155 160

Ile Ile Thr Arg Thr Val Arg Arg Thr Pro Pro Gly Ala Phe Asp Pro

165 170 175

Thr Ile Lys Asn Gln Gln Trp Gly Asp Leu Ile Lys Gly Met Phe Glu

180 185 190

Ala Met Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Leu Thr Glu Gly Pro Gly Phe Asn Ile Val Leu Val Lys Asn Gly

210 215 220

Ile Ile Tyr Thr Pro Asp Arg Gly Val Leu Glu Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Val Ala Arg Ala Asn Ser Ile Asp Ile Arg Leu Glu

245 250 255

Val Val Pro Val Glu Gln Ala Tyr His Ser Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Gly Gly Gly Ile Met Pro Ile Thr Leu Leu Asp Gly Gln Pro

275 280 285

Val Asn Asp Gly Gln Val Gly Pro Ile Thr Lys Lys Ile Trp Asp Gly

290 295 300

Tyr Trp Glu Met His Tyr Asn Pro Ala Tyr Ser Phe Pro Val Asp Tyr

305 310 315 320

Gly Ser Gly

<210> 28

<211> 969

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

atggcctcta tggacaaagt cttttcggga tattatgcgc gccagaagct gcttgaacgg 60

agcgacaatc ctttctctaa gggcattgct tatgtggaag gaaagctcgt cttacctagt 120

gatgctagaa taccgctatt ggacgaaggt ttcatgcaca gtgacctaac ctatgatggc 180

ttccacgttt gggatggtcg cttctttcga ttggacgatc atttgcaacg gattttggaa 240

agctgcgata agatgcggct caagttccca cttgcactga gctcagtgaa aaatattctg 300

gctgagatgg tcgccaagag tggtatccgg gatgcggtgg tgaaggttat cgtgacacgt 360

ggtctgacag gtgtattggg ttcgaagcct gaggatctgt ataataacaa catatacctg 420

cttgttatgc catacatttg gttgatggcg cctgagaacc agctccatgg tggcgaggct 480

atcattacaa ggacagtgcg acgaacaccc ccaggtgcat ttgatcctac tatcaaaaat 540

aagcagtggg gtgatttaat taagggaatg tttgaggcaa tggaccgtgg cgccacatac 600

ccatttctca ctgatggaga caccaacctt actgaaggac cgggtttcaa cattgttttg 660

gtgaagaacg gtattatcta tacccctgat cgaggtgtct tggaggggat cacacgtaaa 720

agtgtgattg acgttgcccg agccaacagc atcgacatcc gccttgaggt cgtaccagtg 780

gagcaggctt atcactctga tgagatcttc atgtgcacaa ctggcggcgg cattatgcct 840

ataacattgc ttgatggtca acctgttaat gacggccagg ttggcccaat cacaaagaag 900

atatgggatg gctattggga gatgcactac aatccggcgt atagttttcc tgttgactat 960

ggcagtggc 969

<210> 29

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ccgggatgcg gtggtgaagg ttatcgtgac 30

<210> 30

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

taaccttcac caccgcatcc cggataccac 30

<210> 31

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

gacaggtgta ttgggttcga agcctgagga 30

<210> 32

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

gcttcgaacc caatacacct gtcagaccac 30

<210> 33

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ctgcttgtta tgccatacat ttggttgatg 30

<210> 34

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

aatgtatggc ataacaagca ggtatatgtt 30

<210> 35

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

atcaaaaatc agcagtgggg tgatttaatt 30

<210> 36

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

accccactgc tgatttttga tagtaggatc 30

Claims (10)

1. A transaminase mutant, which comprises the amino acid sequence set forth in SEQ ID NO:1, or a combination of any two or more of the following:

substitution of methionine (M) at position 113 to valine (V);

substitution of leucine (L) at position 181 with glutamine (Q);

substitution of glutamine (Q) at position 126 to leucine (L);

substitution of leucine (L) at position 143 with methionine (M).

2. The transaminase mutant of claim 1, characterized in that it comprises the amino acid sequence shown in SEQ ID NO:1 with an amino acid substitution in one of the following groups:

substitution of methionine (M) at position 113 to valine (V);

or, substitution of leucine (L) at position 181 with glutamine (Q);

or, a substitution of glutamine (Q) at position 126 with leucine (L);

or, substitution of leucine (L) at position 143 with methionine (M);

or, substitution of methionine (M) to valine (V) at position 113 and substitution of leucine (L) to glutamine (Q) at position 181;

or, the substitution of methionine (M) at position 113 with valine (V) and the substitution of glutamine (Q) at position 126 with leucine (L);

or, the substitution of methionine (M) at position 113 with valine (V) and the substitution of leucine (L) at position 143 with methionine (M);

or, a substitution of leucine (L) at position 181 with glutamine (Q), and a substitution of glutamine (Q) at position 126 with leucine (L);

or, leucine (L) at position 181 is substituted with glutamine (Q), and leucine (L) at position 143 is substituted with methionine (M);

or, a substitution of glutamine (Q) at position 126 with leucine (L), and a substitution of leucine (L) at position 143 with methionine (M);

or, the substitution of methionine (M) at position 113 with valine (V), the substitution of leucine (L) at position 181 with glutamine (Q), and the substitution of glutamine (Q) at position 126 with leucine (L);

or, a substitution of methionine (M) at position 113 with valine (V), a substitution of leucine (L) at position 181 with glutamine (Q), and a substitution of leucine (L) at position 143 with methionine (M);

or, the substitution of methionine (M) at position 113 with valine (V), the substitution of glutamine (Q) at position 126 with leucine (L), and the substitution of leucine (L) at position 143 with methionine (M);

or, a substitution of leucine (L) at position 181 with glutamine (Q), a substitution of glutamine (Q) at position 126 with leucine (L), and a substitution of leucine (L) at position 143 with methionine (M);

alternatively, methionine (M) at position 113 is substituted with valine (V), leucine (L) at position 181 is substituted with glutamine (Q), glutamine (Q) at position 126 is substituted with leucine (L), and leucine (L) at position 143 is substituted with methionine (M).

3. A nucleic acid molecule encoding the transaminase mutant of claim 1 or 2.

4. A vector comprising the nucleic acid molecule of claim 3;

preferably, the carrier is selected from one of the following groups: a plasmid, phage, cosmid, artificial chromosome, plant cell virus, mammalian cell virus, or retrovirus.

5. A host cell expressing the transaminase mutant of claim 1 or 2 and/or comprising the nucleic acid molecule of claim 3 and/or comprising the vector of claim 4.

6. The host cell of claim 5, wherein the host cell is a prokaryotic cell, a yeast cell, an insect cell, or a mammalian cell;

preferably, the host cell is transaminase mutant engineering bacteria, the engineering bacteria are E.coli BL21 (DE 3) containing the vector of claim 4; preferably, the vector is the plasmid pET28a (+) containing the nucleic acid molecule of claim 3.

7. The process for the preparation of a transaminase mutant as claimed in claim 1 or 2, which comprises the following steps: expressing said transaminase mutant in the host cell of claim 5 and isolating and purifying the transaminase mutant.

8. Use of the transaminase mutant of claim 1 or 2, and/or the nucleic acid molecule of claim 3, and/or the vector of claim 4, and/or the host cell of claim 5 or 6 for catalyzing the asymmetric transamination of ketones to chiral amines.

9. The use according to claim 8, wherein the ketone compound is (2R, 4S) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4-pentanoic acid and the chiral amine is (2R, 4S) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylpentanoic acid.

10. A method for preparing a Sacubitril intermediate, comprising subjecting a substrate (2r, 4s) -5- ([ 1,1 '-biphenyl ] -4-yl) -2-methyl-4-pentanoic acid to the catalytic action of the transaminase mutant of claim 1 or 2 to produce (2r, 4s) -5- ([ 1,1' -biphenyl ] -4-yl) -4-amino-2-methylpentanoic acid;

preferably, the catalysis is carried out under basic conditions; preferably, the reaction temperature of the catalysis is 35-45 ℃.

Images