CN115747317A - A detection method and kit for Shigella nucleic acid molecules - Google Patents

Abstract

The invention discloses a method for detecting nucleic acid molecules of the genus Shigella, which comprises utilizing the characteristics of the Argonaute protein, and after the primary guide ssDNAs mediate the cutting of the target DNA by the Argonaute protein, the secondary guide ssDNA produced by the breakage is used again by the Argonaute protein to remove Cut the fluorescent reporter nucleic acid complementary to the secondary guide ssDNA; the sequence of the target DNA is shown in SEQ ID NO.1. The detection results show that the detection method has better sensitivity and repeatability on the basis of the existing technology.

Description

A detection method and kit for Shigella nucleic acid molecules

technical field

The invention relates to the field of biotechnology, in particular to a detection method and a kit for nucleic acid molecules of the genus Shigella.

Background technique

Argonaute (Ago) protein is a programmable nuclease widely distributed in eukaryotes and prokaryotes. Eukaryotic Ago protein plays a key role in the RNA interference pathway, and can recognize and even cut complementary RNA under the guidance of small RNA or small DNA. Prokaryotic Ago proteins may be involved in host defense and DNA replication, preferring to cut complementary DNA under the guidance of small DNA. Based on these characteristics, Ago protein can be applied in nucleic acid detection and genetic manipulation.

Chronic constipation (CC) is a common multifactorial disorder characterized by decreased bowel movements, hard stools, and excessive straining of stools. Some patients with chronic constipation can be cured, however approximately one-third of patients with chronic metastatic functional constipation (FC) do not respond to treatment and have recurrent episodes, the medically refractory slow transit constipation considered the cause of colectomy Complications (STC), which is also known as intractable functional constipation (IFC) unresponsive to conventional medications. So far, several factors associated with refractory slow transit constipation have been identified, in particular, recent genome-wide analyzes and fecal transplants suggest that the gut microbiota Shigella sp.variant may be influencing Important factors in intestinal transit and the chronic constipation phenotype.

There are a large number of microorganisms in the human intestinal tract. These microorganisms rely on the human intestinal tract to live and help the human body to complete various physiological and biochemical functions. Gut microbes not only serve as an important bridge between diet and host, but also regulate human health by themselves and their metabolites. Therefore, gut microbes are closely related to human health. Therefore, it is very necessary to develop a highly sensitive, specific, fast and efficient detection method for Shigella nucleic acid based on prokaryotic Argonaute protein.

In view of this, the present invention is proposed.

Contents of the invention

The object of the present invention is to provide a method and kit for detecting Shigella nucleic acid molecules, so as to improve the detection sensitivity of Shigella nucleic acid molecules.

The present invention is achieved like this:

The invention provides a method for detecting nucleic acid molecules of the genus Shigella, which comprises utilizing the characteristics of the Argonaute protein, and after the primary guide ssDNAs mediate the shearing of the target DNA by the Argonaute protein, the secondary guide ssDNA produced by the breakage is again used by the Argonaute protein to remove Cut the fluorescent reporter nucleic acid complementary to the secondary guide ssDNA;

The sequence of the above target DNA is shown in SEQ ID NO.1.

In some embodiments, the Argonaute protein is a medium-temperature Argonaute protein that guides the shearing of target DNA by a DNA guide.

In some embodiments, the intermediate temperature Argonaute protein comprises BlAgo enzyme.

In some embodiments, the BlAgo enzyme operates at a temperature of 36-38°C.

In some embodiments, the concentration of target DNA in the detection system is ≥1 copy/microliter.

In some embodiments, the concentration of target DNA in the detection system is ≥4 copies/microliter.

In some embodiments, the concentration of target DNA in the detection system is ≥10 copies/microliter.

In some embodiments, the primary guide ssDNAs are complementary paired with the target DNA, which includes the primary guide ssDNA A strand and the primary guide ssDNA B strand.

The nucleotide sequence of the primary guide ssDNA A chain is shown in SEQ ID NO.2;

The nucleotide sequence of the primary guide ssDNA B chain is shown in SEQ ID NO.3.

In some embodiments, primary guide ssDNAs are 5'-phosphorylated single-stranded DNA molecules.

In some embodiments, the primary guide ssDNAs are 18-25 nt in length.

In some embodiments, the molar ratio of target DNA and Argonaute protein to primary guide ssDNAs in the detection system is 8:60:1-40:600:1.

In some embodiments, the secondary guide ssDNA is 10-25 nt in length.

In some embodiments, the fluorescent reporter nucleic acid is 25-50 nt in length.

In some embodiments, the concentration of the fluorescent reporter nucleic acid in the detection system is 200-1000 nM.

In some embodiments, the molar ratio of target DNA to fluorescent reporter nucleic acid is: 10 ² : 1 to 2×10 ⁵ : 1; preferably, the molar ratio of target DNA to fluorescent reporter nucleic acid is 10 ² : 1 to 2×10 ³ :1.

The present invention also provides a kit for detecting nucleic acid molecules of the genus Shigella, which comprises the Argonaute protein used in the above method, primary guide ssDNAs and fluorescent reporter nucleic acid.

The present invention has the following beneficial effects:

The present invention utilizes the characteristics of the Argonaute protein that uses DNA as a guide to guide the shearing of target DNA: that is, after the shearing is mediated by the primary guide ssDNA (guide ssDNA) for the first time, at a suitable reaction temperature, the fragmented 5' nucleic acid fragments can be regenerated. It is used by the Argonaute protein to cut the complementary fluorescent reporter nucleic acid chain, and the content of Shigella nucleic acid in the sample is detected by the fluorescent signal generated by the fragmentation of the fluorescent reporter nucleic acid. The detection results show that the detection method has better sensitivity and repeatability on the basis of the existing technology.

Description of drawings

In order to illustrate the technical solutions of the embodiments of the present invention more clearly, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and thus It should be regarded as a limitation on the scope, and those skilled in the art can also obtain other related drawings based on these drawings without creative work.

Figure 1 is a comparison of the detection results of the two methods in the experimental example: A is the detection results of 0 to 1000 copies of the target gene in the reaction system by the RT-qPCR kit, and the data comes from nine repeated experiments; B is BlAgo-mediated Nucleic acid detection methods are the detection results of 0 copy to 1000 copies of the target gene in the reaction system, and the data come from nine repeated experiments.

Detailed ways

In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Those who do not indicate the specific conditions in the examples are carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments used were not indicated by the manufacturer, and they were all conventional products that could be purchased from the market.

Argonautes are nucleases commonly found in bacteria, plants, fungi, and mammalian cells. In addition to participating in the RNA interference mechanism, some species of Argonaute can also act as DNA endonucleases.

Moderate temperature Argonaute proteins (Ago enzymes) include Brevibacillus laterosporus (BlAgo), Clostridium butyricum (CbAgo), Intestinibacter bartlettii (IbAgo) and their mutants. Through the phylogenetic tree analysis of CbAgo, we found Brevibacillus laterosporus (BlAgo) from mesophilic bacteria ), and studied their biochemical properties for cleaving ssDNA and dsDNA under a wide range of conditions. Among them, the enzyme cutting characteristics of BlAgo are: the enzyme can use 5' phosphorylated or hydroxylated oligonucleotides as guide ssDNA to guide the enzyme to accurately cut the target DNA sequence under moderate temperature conditions; The phosphodiester bond between the target DNA (ssDNA) corresponding to the 10th and 11th nucleotides of the guide ssDNA.

The currently known BlAao can produce a unique canoe-shaped lamellar body attached to one side of the spore. Whole-gene sequencing of this species revealed that it can produce polyketide substances, so BlAao has become a popular strain for biological control of pests. There is no relevant report to prove that BlAao has the biochemical properties of cutting ssDNA and dsDNA.

Based on this, the present invention firstly develops a nucleic acid detection method for Shigella sp.variant 16sRNA which is easy to operate and has good compatibility. The method of the present invention utilizes the characteristics of the BlAgo enzyme that uses DNA as a guide to guide the shearing of target DNA, that is, after the shearing is mediated by the primary guide ssDNA (guide ssDNA) for the first time, at a suitable reaction temperature, the cleaved 5' nucleic acid fragment can be It is used again by the BlAgo enzyme to cut the complementary fluorescent reporter nucleic acid chain.

In the present invention, the target DNA is derived from Shigella sp.variant-specific 16s rRNA, the SNP located on the sorbitol dehydrogenase gene, and its nucleotide sequence is shown in SEQ ID NO.1.

SEQ ID NO.1:

5’-GCAAATATAACATCTGCCCGAACGTTGATTTTATGGCGACACAACCTAACTACCGCGGCGCATTAACGCACTATCTGTGTCATCCGGAGAGCTTTACTTACAAACTGCCCGACAATATGGACACGATGGAAGGGGCGCTGGTGGAGCCTGCCGCAGTCGGGATGCATGCCGCGATGCTGGCAGATGTTAAACCGGGTAAGAAGATAATTATTCTGGGAGCGGGTTGTATTGGTTTGATGACGTTGCAAGC-3’。

In some embodiments, the guide ssDNA pair includes a primary guide ssDNA and a secondary guide ssDNA.

The primary guide ssDNAs are complementary to the target DNA, and the primary guide ssDNAs guide the specific cleavage of the BlAgo enzyme to generate the secondary guide ssDNA and the other two single-stranded DNAs.

In some embodiments, there can be one or more pairs of primary guide ssDNA.

In some embodiments, primary guide ssDNAs are 5'-phosphorylated single-stranded DNA molecules.

In some embodiments, the primary guide ssDNAs are 18-30 nt in length.

In some embodiments, the primary guide ssDNA includes a primary guide ssDNA A strand and a primary guide ssDNA B strand; the nucleotide sequence of the primary guide ssDNA A strand is shown in SEQ ID NO.2; the nucleotide sequence of the primary guide ssDNA B strand As shown in SEQ ID NO.3.

SEQ ID NO.2:

5'P-AGGCTCCACCATCGCCCCTTCCATCG 3';

SEQ ID NO.3:

5'P-ACTGCGGCAGGCTCCACCAGCGCC 3'.

The specific cleavage of the BlAgo enzyme is guided by the above-mentioned primary guide ssDNAs to generate the secondary guide ssDNA, which is 10-20nt in length. The sequence of the secondary guide ssDNA is shown in SEQ ID NO.4.

SEQ ID NO.4:

5'-GCGCTGGTGGAGCCT-3'.

After the secondary guide ssDNA is complementary to the sequence of the fluorescent reporter nucleic acid, it guides the BlAgo enzyme to cut the fluorescent reporter nucleic acid, thereby generating a detectable signal.

In some embodiments, the fluorescent reporter nucleic acid complementary to the secondary guide ssDNA is 20-30 nt in length.

In some embodiments, the reporter molecule is a fluorescent molecule or fluorophore. The reporter nucleic acid molecule is a nucleic acid molecule carrying a fluorescent group and a quencher group respectively. Among them, the fluorescent group (F) is labeled at the 5' end, and the quencher group (Q) is labeled at the 3' end.

In some embodiments, the sequence of the fluorescent reporter nucleic acid is shown in SEQ ID NO.5.

SEQ ID NO.5:

3'F-AGCGACTTGACGCGACCACCTCGGAGTGC-Q 5'.

In some embodiments, the concentration of target DNA in the detection system is ≥1 copy/microliter.

In some embodiments, the concentration of the target DNA in the detection system is ≥4 copies/microliter.

In some embodiments, the molar ratio of target DNA, Argonaute protein, and primary guide ssDNAs in the detection system is 8:60:1-40:600:1.

In some embodiments, the concentration of the fluorescent reporter nucleic acid in the detection system is: 200-1000 nM.

In some embodiments, the molar ratio of target DNA to fluorescent reporter nucleic acid is 10 ² :1 to 10 ⁵ :1; preferably, the molar ratio of target DNA to fluorescent reporter nucleic acid is 10 ² :1 to 10 ³ :1.

In some embodiments, the above detection methods are in vitro methods.

In some embodiments, the detection methods described above are non-diagnostic and non-therapeutic.

The present invention also provides a kit for detecting nucleic acid molecules of the genus Shigella, which comprises the Argonaute protein used in the above method, primary guide ssDNAs and fluorescent reporter nucleic acid.

The usage method of above-mentioned kit is as follows:

1. The obtained sample to be tested is used as a template and added to the PCR system to amplify it to obtain the target DNA;

2. Add specific oligonucleotide guide ssDNAs, corresponding fluorescent reporter nucleic acid and BlAgo enzyme to perform specific shearing under the condition of continuous incubation at 36-38°C, and collect the fluorescent signal;

3. Analyze the fluorescence signal value, adjust the Start value, End value and threshold line of Baseline, and judge the result.

The characteristics and performance of the present invention will be described in further detail below in conjunction with the examples.

Example 1

This example provides a method for detecting Shigella nucleic acid molecules.

Among them, the detection reagents include:

(1) The primary guide ssDNA, including the primary guide ssDNA A strand and the primary guide ssDNA B strand; the nucleotide sequence of the primary guide ssDNA A strand is as follows:

5'P-AGGCTCCACCATCGCCCCTTCCATCG 3';

The nucleotide sequence of the primary guide ssDNA B strand is as follows:

5'P-ACTGCGGCAGGCTCCACCAGCGCC 3'.

(2) fluorescent reporter nucleic acid, its sequence is as follows:

3'F-AGCGACTTGACGCGACCACCTCGGAGTGC-Q 5'.

(3) B1Ago enzyme.

(4) The reverse transcription primer is: Oligo(dT)

(5) Reverse transcription reaction enzyme and buffer: 2×ES Reaction mix.

(6) dNTPs.

(7) Mouse RNase inhibitor.

(8) MgCl ₂ solution.

The detection method is as follows:

(1) Prepare primary guide ssDNA, fluorescent reporter nucleic acid and BlAgo enzyme with ultrapure water to make a solution with a concentration of 10 μM; reverse transcription primer R-primer dry powder is dissolved with ultrapure water to make a 2 μM solution.

(2) Add the sample to be tested as a template to the PCR system to amplify it to obtain the target DNA; the amplification system is: 5 μL RNA, 10 μL 2×ES Reaction mix and 1 μL Oligo (dT), and finally make it to 20 μL volume .

(3) Add specific oligonucleotide guide ssDNAs, corresponding fluorescent reporter nucleic acid and BlAgo enzyme to react for 2 hours under the condition of continuous incubation at 37°C, perform specific shearing, and collect the fluorescent signal, every minute Fluorescence signal is detected once. The usage amounts of guide ssDNAs, fluorescent reporter nucleic acid and BlAgo enzyme were 0.27mM, 0.625nM and 40.5nM respectively;

Specifically, combine target DNA with reverse transcription primer R-primer, dNTP, ProtoScript II RT, 5×ProtoScript II Buffer, DTT, mouse RNase inhibitor, BlAgo enzyme, MgCl ₂ , primary guide ssDNA A chain B chain, fluorescent Mix the reporter nucleic acid and RNase-free double distilled water to make a 30 μL system. The system is: the final concentration of R-primer is 400nM, the final concentration of dNTP is 1mM, ProtoScriptII RT 200U, mouse RNase inhibitor 8U, the final concentration of DTT is 100mM, the final concentration of MgCl ₂ is 0.83mM, and the final concentration of fluorescent reporter nucleic acid is 0.27 mM, the final concentrations of target nucleic acid molecules were 5nM, 12.5nM, 25nM, 50nM, 125nM, 250nM, and 500nM, and the molar ratio of the final concentration of target nucleic acid molecules to BlAgo to guide ssDNAs was 40:324:5.

(4) Analyze the fluorescent signal value, adjust the Start value, End value and threshold line of the Baseline, and judge the result.

comparative example

In this comparative example, RT-qPCR is used to detect Shigella nucleic acid molecules, and the specific operation steps are as follows:

Among them, the detection reagents include:

(1) 2 × HSYBR qPCR Mix 5 μl

(2) DNA template (1-10 ng cDNA) 2 μl

(3) 0.4 μl each of primer-F and primer-R (10 μM)

(4) RNase-free water 2.2μl

The PCR program is:

(1) 95°C for 10 minutes

(2) 95°C for 15 s, 55°C for 30s, 72°C for 30s, 42 cycles

(3) 10min at 4°C

Experimental example

The detection results of Examples and Comparative Examples are shown in Figure 1. Among them, A is the detection result of 0 copy to 1000 copy target gene in the reaction system by RT-qPCR kit, and the data comes from nine repeated experiments; The detection results of target genes, the data come from nine repeated experiments.

It can be seen from Figure 1 that both methods can effectively detect the target nucleic acid when the nucleic acid concentration in the reaction system is greater than or equal to 100 copies.

When the concentration of nucleic acid in the reaction system is 10 copies, the Ct value of the experimental results in only three of the nine repetitions of the RT-qPCR kit is less than 37. When the concentration of nucleic acid in the reaction system is 8 copies or 4 copies, the corresponding Ct value Or it is 0 or greater than 38, indicating that the nucleic acid sample of this concentration cannot be accurately detected at this time.

The BlAgo-mediated nucleic acid detection method can accurately detect nucleic acid samples containing 8 copies or 4 copies in the reaction system, and the intensity of the fluorescent signal is higher than that of the negative control. When only 1 copy of the nucleic acid sample is contained in the reaction system, nine times Fluorescent signals higher than those of the negative control were detected in four replicates, indicating that the detection limit of the BlAgo-mediated nucleic acid detection method can reach 1 copy per reaction.

Therefore, compared with RT-qPCR, the BlAgo-mediated nucleic acid detection method has higher sensitivity and stability when detecting extremely low concentrations of nucleic acids.

The above descriptions are only preferred embodiments of the present invention, and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims (10)

1. A detection method for Shigella nucleic acid molecules, characterized in that, comprising utilizing the characteristics of the Argonaute protein, after the primary guide ssDNAs mediates the shearing target DNA of the Argonaute protein, the secondary guide ssDNA produced by the breakage is utilized by the Argonaute protein again To cut the fluorescent reporter nucleic acid complementary to the secondary guide ssDNA; The sequence of the target DNA is shown in SEQ ID NO.1. 2. The detection method according to claim 1, wherein the Argonaute protein is a medium-temperature Argonaute protein that guides shearing target DNA with DNA as a guide; Preferably, said intermediate temperature Argonaute protein comprises a BlAgo enzyme; Preferably, the working temperature of the BlAgo enzyme is 36-38°C. 3. The detection method according to claim 1, wherein the concentration of the target DNA in the detection system is ≥ 1 copy/microliter; Preferably, the concentration of the target DNA in the detection system is ≥4 copies/microliter. 4. detection method according to claim 1, is characterized in that, described primary guide ssDNAs and target DNA complementary pairing, it comprises primary guide ssDNA A chain and primary guide ssDNA B chain; The nucleotide sequence of the primary guide ssDNAA chain is shown in SEQ ID NO.2; The nucleotide sequence of the primary guide ssDNA B chain is shown in SEQ ID NO.3. 5. detection method according to claim 4, is characterized in that, described primary guide ssDNAs is the single-stranded DNA molecule of 5 '-phosphorylation; Preferably, the length of the primary guide ssDNAs is 16-40nt. 6. according to the detection method described in any one of claim 1-5, it is characterized in that, the mol ratio of described target DNA and Argonaute protein and described primary guide ssDNAs in detection system is 8:60:1-40: 600:1. 7. The detection method according to claim 1, characterized in that, the length of the secondary guide ssDNA is 10-25nt. 8. detection method according to claim 1, is characterized in that, the length of described fluorescent reporter nucleic acid is 25-50nt; Preferably, the concentration of the fluorescent reporter nucleic acid in the detection system is 200-1000 nM. 9. The detection method according to claim 8, wherein the molar ratio of the target DNA to the fluorescent reporter nucleic acid is: 1*10 ² : 1 to 2*10 ⁵ : 1, preferably 1*10 ² : 1 to 2*10 ³ :1. 10. A kit for detecting nucleic acid molecules of the genus Shigella, characterized in that the kit includes the Argonaute protein, primary guide ssDNAs and fluorescent reporter nucleic acid used in the method described in any one of 1-7.

Images