CN115747317A - Detection method and kit for shigella nucleic acid molecules - Google Patents
Detection method and kit for shigella nucleic acid molecules Download PDFInfo
- Publication number
- CN115747317A CN115747317A CN202211549907.4A CN202211549907A CN115747317A CN 115747317 A CN115747317 A CN 115747317A CN 202211549907 A CN202211549907 A CN 202211549907A CN 115747317 A CN115747317 A CN 115747317A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- target dna
- detection method
- ssdna
- primary
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection method of shigella nucleic acid molecules, which comprises the steps of utilizing the characteristics of Argonaute protein, shearing target DNA by primary guided ssDNAs mediated by the Argonaute protein, and shearing fluorescent reporter nucleic acid complementary with secondary guided ssDNA by the secondary guided ssDNA generated by fragmentation again by the Argonaute protein; the sequence of the target DNA is shown in SEQ ID NO. 1. The detection result shows that the detection method has better sensitivity and repeatability on the basis of the prior art.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a detection method and a kit for a nucleic acid molecule of Shigella.
Background
The Argonaute (Ago) protein is a programmable nuclease, widely distributed in eukaryotes and prokaryotes. Eukaryotic Ago proteins play a key role in RNA interference pathways and are capable of recognizing and even cleaving complementary RNA under the guidance of small RNA or small DNA. Prokaryotic Ago proteins may be involved in host defense and DNA replication, favoring cleavage of complementary DNA under the guidance of small DNA. Based on these properties, ago proteins can be applied to nucleic acid detection, genetic manipulation, and the like.
Chronic Constipation (CC) is a common multifactorial disease characterized by reduced defecation, hard stools and excessive stress. Some patients with chronic constipation can be cured, however about one third of patients with chronic metastatic Functional Constipation (FC) do not respond to treatment and have recurrent episodes, and this medically refractory slow transit constipation is considered as a complication of colectomy (STC), a disease also known as Intractable Functional Constipation (IFC) that is ineffective against conventional medications. Several factors have been identified so far in connection with intractable slow transit constipation, and in particular, recent genome wide analyses and fecal transplantation suggest that the gut microorganism Shigella sp.
The large number of microorganisms exist in the intestinal tract of a human body, and the microorganisms depend on the intestinal life of the human body and help the human body to complete various physiological and biochemical functions. The intestinal microorganisms play an important role of a bridge between diet and a host, and can regulate the health of a human body by themselves and metabolites, so that the intestinal microorganisms are closely related to the health of the human body. Therefore, it is necessary to develop a rapid and efficient shigella nucleic acid detection method with high sensitivity and good specificity based on prokaryotic Argonaute protein.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a method and a kit for detecting a nucleic acid molecule of Shigella, so as to improve the detection sensitivity of the nucleic acid molecule of Shigella.
The invention is realized by the following steps:
the invention provides a detection method of shigella nucleic acid molecules, which comprises the steps of utilizing the characteristics of Argonaute protein, after primary guided ssDNAs mediate Argonaute protein to shear target DNA, secondary guided ssDNA generated by fragmentation is utilized by the Argonaute protein to shear fluorescent reporter nucleic acid complementary with the secondary guided ssDNA;
the sequence of the target DNA is shown in SEQ ID NO. 1.
In some embodiments, the Argonaute protein is a moderate temperature Argonaute protein that directs cleavage of target DNA with DNA as a guide.
In some embodiments, the moderate temperature Argonaute protein comprises a BlAgo enzyme.
In some embodiments, the BlAgo enzyme has an operating temperature of 36-38 ℃.
In some embodiments, the concentration of target DNA in the detection system is ≧ 1 copy/microliter.
In some embodiments, the concentration of target DNA in the detection system is 4 copies/microliter.
In some embodiments, the concentration of target DNA in the detection system is ≧ 10 copies/microliter.
In some embodiments, the primary guide ssDNAs are complementarily paired to the target DNA, which includes a primary guide ssDNA a strand and a primary guide ssDNA B strand.
The nucleotide sequence of the primary guide ssDNA A chain is shown as SEQ ID NO. 2;
the nucleotide sequence of the primary guide ssDNA B chain is shown in SEQ ID NO. 3.
In some embodiments, the primary guide ssDNAs are 5' -phosphorylated single stranded DNA molecules.
In some embodiments, the primary guide ssDNAs are 18-25nt in length.
In some embodiments, the molar ratio of target DNA and Argonaute protein to primary guide ssDNAs in the detection system is 8.
In some embodiments, the secondary guide ssDNA is 10-25nt in length.
In some embodiments, the fluorescent reporter nucleic acid is 25 to 50nt in length.
In some embodiments, the concentration of the fluorescent reporter nucleic acid in the detection system is 200-1000nM.
In some embodiments, the molar ratio of target DNA to fluorescent reporter nucleic acid is: 10 2 :1 to 2X 10 5 :1; preferably, the molar ratio of target DNA to fluorescent reporter nucleic acid is 10 2 :1 to 2X 10 3 ：1。
The invention also provides a kit for detecting the nucleic acid molecules of the Shigella, which comprises the Argonaute protein, the primary guide ssDNAs and the fluorescent reporter nucleic acid adopted in the method.
The invention has the following beneficial effects:
the invention utilizes the characteristics of Argonaute protein which takes DNA as guide to guide and cut target DNA: after the cleavage is mediated by the primary guide ssDNA (guide ssDNA) for the first time, the cleaved 5' nucleic acid fragment can be cleaved by the Argonaute protein again at a proper reaction temperature by using a fluorescent reporter nucleic acid chain complementary to the cleavage, and the content of the nucleic acid of Shigella in the sample can be detected through a fluorescent signal generated by the cleavage of the fluorescent reporter nucleic acid. The detection result shows that the detection method has better sensitivity and repeatability on the basis of the prior art.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a comparison of the results of the two methods in the experimental examples: a is the detection result of the RT-qPCR kit on 0-1000 copies of the target gene in the reaction system respectively, and the data come from nine repeated experiments; b is the detection result of the Blago-mediated nucleic acid detection method on 0 to 1000 copies of the target gene in the reaction system respectively, and the data come from nine repeated experiments.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
Argonautes is a nuclease, which is ubiquitous in bacterial, plant, fungal, mammalian cells. In addition to its involvement in the RNA interference mechanism, argonaute from certain species may also act as a DNA endonuclease.
Medium temperature Argonaute proteins (Ago enzymes) include Brevibacillus laterosporus (Blago), clostridium butyricum (Cbago), intestibacter bartlettii (Ibago) and mutants thereof, and we found Brevibacillus laterosporus (Blago) from mesophilic bacteria by phylogenetic tree analysis of Cbago and studied their biochemical properties of cleaving ssDNA and dsDNA under a wide range of conditions. The BlAgo enzyme digestion characteristics are as follows: the enzyme can guide the precise shearing of a target DNA sequence by the enzyme under the medium temperature condition by using 5' phosphorylated or hydroxylated oligonucleotides as guide ssDNA; the cleavage site is located in the phosphodiester linkage between the target DNA (ssDNA) corresponding to nucleotides 10 and 11 of the guide ssDNA.
The currently known BlAao produces a unique Canoe lamina attached to the spore side, and whole-gene sequencing of this species revealed that it produces polyketide, making BlAao a phylum of bioterrosis. There have been no reports of BlAao having biochemical properties of cleaving ssDNA and dsDNA.
Based on the above, the invention develops a nucleic acid detection method aiming at Shigella sp. The method of the invention utilizes the characteristic of the Blago enzyme which uses DNA as guide to guide the cutting of target DNA, namely, after the cutting is mediated by primary guide ssDNA (guide ssDNA) for the first time, at a proper reaction temperature, the broken 5 'nucleic acid fragment can be used by the Blago enzyme to cut a fluorescent reporter nucleic acid chain which is complementary with the broken 5' nucleic acid fragment.
In the present invention, the target DNA is derived from Shigella sp. Variant specific 16s rRNA, and the nucleotide sequence of the SNP located on the sorbitol dehydrogenase gene is shown in SEQ ID No. 1.
SEQ ID NO.1：
5’-GCAAATATAACATCTGCCCGAACGTTGATTTTATGGCGACACAACCTAACTACCGCGGCGCATTAACGCACTATCTGTGTCATCCGGAGAGCTTTACTTACAAACTGCCCGACAATATGGACACGATGGAAGGGGCGCTGGTGGAGCCTGCCGCAGTCGGGATGCATGCCGCGATGCTGGCAGATGTTAAACCGGGTAAGAAGATAATTATTCTGGGAGCGGGTTGTATTGGTTTGATGACGTTGCAAGC-3’。
In some embodiments, the pair of guide ssDNA comprises primary guide ssDNA and secondary guide ssDNA.
The primary guided ssDNAs are complementarily paired with the target DNA, and specific cleavage by BlAgo enzyme is guided by the primary guided ssDNAs to generate secondary guided ssDNA and two additional segments of single-stranded DNA.
In some embodiments, the primary guide ssDNA may be in one or more pairs.
In some embodiments, the primary guide ssDNAs are 5' -phosphorylated single stranded DNA molecules.
In some embodiments, the primary guide ssDNAs are 18-30nt in length.
In some embodiments, the primary guide ssDNA comprises a primary guide ssDNA a strand and a primary guide ssDNAB strand; the nucleotide sequence of the primary guide ssDNA A chain is shown as SEQ ID NO. 2; the nucleotide sequence of the primary guide ssDNA B chain is shown in SEQ ID NO. 3.
SEQ ID NO.2：
5’P-AGGCTCCACCATCGCCCCTTCCATCG 3’；
SEQ ID NO.3：
5’P-ACTGCGGCAGGCTCCACCAGCGCC 3’。
Specific cleavage of the Blago enzyme was guided by the primary guided ssDNAs described above, resulting in secondary guided ssDNA that was 10-20nt in length. The sequence of the secondary guide ssDNA is shown in SEQ ID NO. 4.
SEQ ID NO.4：
5’-GCGCTGGTGGAGCCT-3’。
After the secondary guide ssDNA is complementarily bound to the sequence of the fluorescent reporter nucleic acid, the BlAgo enzyme is guided to cut the fluorescent reporter nucleic acid, thereby generating a detectable signal.
In some embodiments, the fluorescent reporter nucleic acid complementary to the secondary guide ssDNA is 20-30nt in length.
In some embodiments, the reporter molecule is a fluorescent molecule or fluorophore. Reporter nucleic acid molecules are nucleic acid molecules that carry a fluorescent group and a quencher group, respectively. Wherein, a fluorescent group (F) is labeled at the 5 'end, and a quenching group (Q) is labeled at the 3' end.
In some embodiments, the sequence of the fluorescent reporter nucleic acid is set forth in SEQ ID No. 5.
SEQ ID NO.5：
3’F-AGCGACTTGACGCGACCACCTCGGAGTGC-Q 5’。
In some embodiments, the concentration of target DNA in the detection system is ≧ 1 copy/microliter.
In some embodiments, the concentration of target DNA in the detection system is 4 copies/microliter or more.
In some embodiments, the molar ratio of target DNA, argonaute protein, primary-guided ssDNAs in the detection system is 8.
In some embodiments, the concentration of the fluorescent reporter nucleic acid in the detection system is: 200-1000nM.
In some embodiments, the molar ratio of target DNA to fluorescent reporter nucleic acid is: 10 2 :1 to 10 5 :1; preferably, the molar ratio of target DNA to fluorescent reporter nucleic acid is 10 2 :1 to 10 3 ：1。
In some embodiments, the detection method is an in vitro method.
In some embodiments, the detection methods described above are non-diagnostic and non-therapeutic.
The invention also provides a kit for detecting the nucleic acid molecules of the Shigella, which comprises the Argonaute protein, the primary guide ssDNAs and the fluorescent reporter nucleic acid adopted in the method.
The use method of the kit comprises the following steps:
1. adding the obtained sample to be detected as a template into a PCR system for amplification to obtain target DNA;
2. adding specific oligonucleotide guide ssDNAs, fluorescent reporter nucleic acids corresponding to the ssDNAs and Blago enzyme, performing specific shearing under the condition of continuous heat preservation at 36-38 ℃, and collecting fluorescent signals;
3. and analyzing the fluorescence signal value, adjusting the Start value, the End value and the threshold line of Baseline, and judging the result.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
This example provides a method for detecting a shigella nucleic acid molecule.
Wherein, the detection reagent comprises:
(1) A primary guide ssDNA comprising a primary guide ssDNA a strand and a primary guide ssDNAB strand; the nucleotide sequence of the primary guide ssDNA a strand is as follows:
5’P-AGGCTCCACCATCGCCCCTTCCATCG 3’；
the nucleotide sequence of the primary guide ssDNA B strand is as follows:
5’P-ACTGCGGCAGGCTCCACCAGCGCC 3’。
(2) A fluorescent reporter nucleic acid having the sequence:
3’F-AGCGACTTGACGCGACCACCTCGGAGTGC-Q 5’。
(3) A BlAgo enzyme.
(4) The reverse transcription primer is as follows: oligo (dT)
(5) Reverse transcriptase and buffer: 2 × ES Reaction mix.
(6)dNTP。
(7) Mouse RNase inhibitors.
(8)MgCl 2 And (3) solution.
The detection method comprises the following steps:
(1) Preparing the primary guide ssDNA, the fluorescent reporter nucleic acid and the Blago enzyme into a solution with the concentration of 10 mu M by using ultrapure water; the reverse transcription primer R-primer dry powder was dissolved in ultrapure water to prepare a 2. Mu.M solution.
(2) Adding the obtained sample to be detected as a template into a PCR system for amplification to obtain target DNA; the amplification system is as follows: mu.L of RNA, 10. Mu.L of 2 × ES Reaction mix and 1. Mu.L of Oligo (dT) were finally brought to a volume of 20. Mu.L.
(3) Adding specific oligonucleotide guide ssDNAs, fluorescent reporter nucleic acids corresponding to the oligonucleotide guide ssDNAs and BlAgo enzyme, reacting for 2h under the condition of continuous heat preservation at 37 ℃, performing specific shearing, collecting fluorescent signals, and detecting the fluorescent signals once per minute. Wherein the usage amounts of the wizardssDNAs, the fluorescent reporter nucleic acids and the BlAgo enzyme are 0.27mM, 0.625nM and 40.5nM, respectively;
specifically, the target DNA is mixed with reverse transcription primer R-primer, dNTP, protoScript II RT, 5 XProScript II Buffer, DTT, mouse RNase inhibitor, blago enzyme, mgCl 2 The primary guide ssDNA A chain and the B chain, the fluorescent reporter nucleic acid, and RNase-free double distilled water were mixed to prepare a 30. Mu.L system. The system is as follows: the final concentration of R-primer is 400nM, the final concentration of dNTP is 1mM, protoScriptII RT 200U, the final concentration of mouse RNase inhibitor is 8U, the final concentration of DTT is 100mM 2 Final concentration of 0.83mM, final concentration of fluorescent reporter nucleic acid of 0.27mM, final concentration of target nucleic acid molecules of 5nM, 12.5nM, 25nM, 50nM, 125nM, 250nM, 500nM, molar ratio of target nucleic acid molecules to blugo to final concentration of guide ssDNAs of 40:324:5.
(4) And analyzing the fluorescence signal value, adjusting the Start value, the End value and the threshold line of Baseline, and judging the result.
Comparative example
The comparative example adopts an RT-qPCR detection method for Shigella nucleic acid molecules, and comprises the following specific operation steps:
wherein, the detection reagent comprises:
(1)2 × HSYBR qPCR Mix 5 μl
(2) DNA template (1-10 ng cDNA) 2. Mu.l
(3) primer-F and primer-R (10. Mu.M) each in an amount of 0.4. Mu.l
(4)RNase-free water 2.2μl
The PCR procedure was:
(1)95 ℃ 10 min
(2) 95 ℃ for 15 s,55 ℃ for 30s for 72 ℃ for 30s,42 cycles
(3)4℃ 10min
Examples of the experiments
The results of the tests of the examples and comparative examples are shown in FIG. 1. Wherein A is the detection result of the RT-qPCR kit for 0-1000 copies of the target gene in the reaction system respectively, and the data come from nine repeated experiments; b is the detection result of the Blago-mediated nucleic acid detection method on 0-1000 copies of the target gene in the reaction system respectively, and the data come from nine repeated experiments.
As can be seen from FIG. 1, both methods are effective for detecting a target nucleic acid when the concentration of the nucleic acid in the reaction system is 100 copies or more.
When the concentration of the nucleic acid in the reaction system is 10 copies, the Ct value of the experimental result of only three times in nine times of the RT-qPCR kit is less than 37, and when the concentration of the nucleic acid in the reaction system is 8 copies or 4 copies, the Ct value is 0 or more than 38 correspondingly, which indicates that the nucleic acid sample with the concentration cannot be accurately detected at the moment.
The BlAgo-mediated nucleic acid detection method can accurately detect a nucleic acid sample containing 8 copies or 4 copies in a reaction system, the intensity of a fluorescence signal is higher than that of a negative control, and when the reaction system only contains 1 copy of the nucleic acid sample, the fluorescence signal higher than that of the negative control is detected in four experiments in nine times of repetition, which indicates that the lower limit of detection of the BlAgo-mediated nucleic acid detection method can reach 1 copy per reaction.
Thus, the BlAgo-mediated nucleic acid detection method has higher sensitivity and stability in detecting nucleic acids at very low concentrations than RT-qPCR.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (10)
1. A detection method of nucleic acid molecules of Shigella is characterized in that the characteristics of Argonaute protein are utilized, primary guided ssDNAs mediate Argonaute protein to shear target DNA, and secondary guided ssDNA generated by fragmentation is utilized by the Argonaute protein to shear fluorescent reporter nucleic acid complementary with the secondary guided ssDNA;
the sequence of the target DNA is shown as SEQ ID NO. 1.
2. The detection method according to claim 1, wherein the Argonaute protein is a medium temperature Argonaute protein that directs cleavage of a target DNA with DNA as a guide;
preferably, the medium temperature Argonaute protein comprises a BlAgo enzyme;
preferably, the operating temperature of the Blago enzyme is 36-38 ℃.
3. The detection method according to claim 1, wherein the concentration of the target DNA in the detection system is not less than 1 copy/microliter;
preferably, the concentration of the target DNA in the detection system is more than or equal to 4 copies/microliter.
4. The detection method of claim 1, wherein said primary guide ssDNAs are complementarily paired to a target DNA comprising a primary guide ssDNA a strand and a primary guide ssDNA b strand;
the nucleotide sequence of the primary-guided ssDNAA chain is shown in SEQ ID NO. 2;
the nucleotide sequence of the primary guide ssDNA B chain is shown as SEQ ID NO. 3.
5. The detection method of claim 4, wherein the primary guided ssDNAs are 5' -phosphorylated single-stranded DNA molecules;
preferably, the length of the primary guide ssDNAs is 16-40nt.
6. The detection method according to any one of claims 1 to 5, wherein the molar ratio of the target DNA and the Argonaute protein to the primary guide ssDNAs in the detection system is from 8.
7. The detection method of claim 1, wherein the secondary guide ssDNA is 10-25nt in length.
8. The detection method according to claim 1, wherein the fluorescent reporter nucleic acid is 25 to 50nt in length;
preferably, the concentration of the fluorescent reporter nucleic acid in the detection system is 200-1000nM.
9. The method of claim 8, wherein the molar ratio of the target DNA to the fluorescent reporter nucleic acid is: 1*10 2 :1 to 2 x 10 5 :1, preferably 1 x 10 2 :1 to 2 x 10 3 ：1。
10. A kit for detecting a shigella nucleic acid molecule, comprising the Argonaute protein, primary wizardssdnas and fluorescent reporter nucleic acid employed in the method of any one of claims 1 to 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211549907.4A CN115747317A (en) | 2022-12-05 | 2022-12-05 | Detection method and kit for shigella nucleic acid molecules |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211549907.4A CN115747317A (en) | 2022-12-05 | 2022-12-05 | Detection method and kit for shigella nucleic acid molecules |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115747317A true CN115747317A (en) | 2023-03-07 |
Family
ID=85343291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211549907.4A Pending CN115747317A (en) | 2022-12-05 | 2022-12-05 | Detection method and kit for shigella nucleic acid molecules |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115747317A (en) |
-
2022
- 2022-12-05 CN CN202211549907.4A patent/CN115747317A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2609218C (en) | Isothermal strand displacement amplification using primers containing a non-regular base | |
| CN101641452B (en) | Restriction endonuclease enhanced polymorphic sequence detection | |
| JP5844522B2 (en) | Identification method using CpG methylation | |
| US20230056763A1 (en) | Methods of targeted sequencing | |
| CN108796036A (en) | Nucleic acid detection method based on protokaryon Argonaute albumen and its application | |
| CN102177250A (en) | Method for direct amplification from crude nucleic acid samples | |
| US20160168630A1 (en) | Endonuclease-enhanced helicase-dependent amplification | |
| US11519026B2 (en) | Methods for removal of adaptor dimers from nucleic acid sequencing preparations | |
| CN110592215A (en) | Composition for detecting nucleic acid sequence and detection method | |
| US20230063705A1 (en) | Methods and kits for amplification and detection of nucleic acids | |
| CN112481363B (en) | Application of mutation Aerolysin monomer in detecting RNA base sequence and RNA modification | |
| US20210102237A1 (en) | Means and methods for nucleic acid target detection | |
| EP1525328A1 (en) | Method for amplification of nucleic acids of low complexity | |
| CN113215224A (en) | Method and kit for amplifying and detecting nucleic acid | |
| CN115747317A (en) | Detection method and kit for shigella nucleic acid molecules | |
| WO2022144003A1 (en) | Method for constructing multiplex pcr library for high-throughput targeted sequencing | |
| CN102985560A (en) | A method of regulating oligonucleotide functionality | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| CN114277109A (en) | Nucleic acid detection method based on normal-temperature prokaryotic Argonaute protein and application thereof | |
| WO1990001068A1 (en) | Sequence specific assay for the detection of a nucleic acid molecule | |
| US20220380755A1 (en) | De-novo k-mer associations between molecular states | |
| US20230122979A1 (en) | Methods of sample normalization | |
| CN116254327A (en) | Argonaute-mediated strand displacement exponential amplification method and application | |
| EP4435117A1 (en) | Novel method for isothermal amplification of padlock probes for nucleic acid detection and phi29 dna polymerase variants | |
| US20230272462A1 (en) | Kits, methods, polypeptides, systems, and non-transitory, machine-readable storage media for detecting a nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |