CN115725710A - Method for rapidly cloning tumor-reactive TCR and application thereof - Google Patents

Abstract

The invention provides a rapid, simple and low-cost method for cloning a tumor-reactive TCR, which can significantly reduce the time and cost required by obtaining the tumor-reactive TCR; lays a foundation for the development of individual TCR medicaments and the precise cellular immunotherapy.

Description

Method for rapidly cloning tumor-reactive TCR and application thereof

Technical Field

The present invention relates to the fields of molecular biology, immunology and medicine. In particular to individualized tumor specific TCR screening and cloning.

Background

TCR-T (T Cell Receptor-T Cells) Cell Therapy has recently become a research hotspot in tumor ImmunoTherapy and has shown good therapeutic efficacy in clinical trials (NY-ESO-1-specific TCR-engineered T Cells medium-specific antigen-specific antigens in muscle Cells. Nature medium. 2015; systematic and local immunological focusing assay of NY-ESO-1 SPECR T Cell synthesis vector. Journal for immunological Therapy of Cancer (2019) 7. TCR-T Cell therapy (T Cell Receptor-Gene Engineered T Cells) screens and identifies a TCR sequence capable of specifically binding a target antigen, transfers the TCR sequence into T Cells (or heterogenous T Cells) from peripheral blood of a patient by adopting a genetic engineering means, and then transfuses the modified T Cells into the body of the patient so as to ensure that the T Cells specifically identify and kill tumor Cells expressing the antigen, thereby achieving the purpose of treating tumors.

The TCR is a heterodimer formed by two peptide chains of alpha and beta, and each peptide chain is divided into a variable region (V region), a constant region (C region), a transmembrane region, a cytoplasmic region and the like; the cytoplasmic domain is short and signal transmission occurs primarily through the CD3 molecule to which it is non-covalently bound. The TCR molecule belongs to the immunoglobulin superfamily, and the antigen specificity exists in the V region; the V region has three hypervariable regions CDR1, CDR2 and CDR3, of which the largest variation in CDR3 directly determines the antigen binding specificity of the TCR. CDR3 is directly bound to an antigenic peptide when the TCR recognizes the MHC-antigenic peptide complex. The TCR screening technology is the most central part of TCR-related drug development. However, the existing TCR screening has high cost, long time consumption and low efficiency, and especially the acquisition of the full-length paired TCR gene is the rate-limiting step in the whole process, thus seriously influencing the research and development of TCR related medicaments.

It is generally believed that tumor-reactive T cells are present in solid tumors and are critical for the development of tumor immunity. Screening for tumor-reactive TCR genes is mainly performed by obtaining tumor-reactive T cells and then cloning their TCR genes. After these TCR sequences have been obtained by gene synthesis, TCR-T is prepared by transducing TCR genes into T cells by gene transfection (Prothogenic discovery of neoantigenic disorders associated with multiple-antisense targeted T Cell immunology for purifying RAS nanoparticles Synthesis | (2021) 12 6689.Identification and differentiation of T-Cell Receptors Targeting RAS hosts polysaccharides in Human CANCER for using in Cell-based immunology. CLINICAL CANCER RESERCH.2021.). Since these TCRs are derived from a particular tumor patient and are directed against the patient's own tumor, such TCR-T is also referred to as individualized TCR-T. Compared with the traditional TCR-T with a fixed target spot, the individualized TCR-T is more complex, a set of patient-specific TCR needs to be screened for each patient, and the process depends on single cell sequencing and gene synthesis, so the time is long and the cost is high.

CN114134221A relates to a method for screening tumor specific TCR, after tumor cells of a tumor patient and tumor infiltrating T cells (TILs) corresponding to autologous tumor cells are co-incubated in vitro, the cells are subjected to single cell transcriptome and TCR set sequencing to obtain a TCR sequence of each TILs cell, for all TILs expressing the same TCR, the average value of the expression values of 10T cell markers of the TILs is used as the activation score of the TCR marker, and the TCR with higher score is screened as the TCR corresponding to the tumor specific T cell according to the activation score.

In patent CN111849914A, an individualized TCR-T cell treatment technology for identifying tumor antigens is established; the rapid separation of the T cells for recognizing the tumor antigens is realized through the molecular markers; thereby rapidly obtaining a TCR recognizing a tumor antigen; this method requires RNA sequencing of each T cell isolated from tumor tissue.

The above inventions all rely on high throughput sequencing and gene synthesis, which is time consuming and costly.

Current single cell sequencing technologies are capable of identifying tumor-specific T cell clones at the single cell level, and many markers of tumor-reactive T cells have been discovered, which mainly include: CD39, PD-1, CXCL13, CD103 and Granzyme A (GZA) et al (Molecular signatures of inorganic bioactive-reactive T cells from metallic human cameras science,2022.Co-expression of CD39 and CD103 identification tumor-reactive CD 8T cells in human colloidal tissues NATURE COMMUNICATIONS | (2018) 9. The invention skillfully uses the tumor-reactive T cell markers to quickly obtain the tumor-reactive TCR, greatly shortens the production period of individualized TCR-T therapy, reduces the cost, and efficiently solves the problems of long time and high cost of individualized TCR-T.

Disclosure of Invention

The invention aims to provide a method for cloning a tumor-reactive TCR quickly, simply and at low cost, which can obviously reduce the time and cost required by acquiring the tumor-reactive TCR; lays a foundation for the development of individual TCR medicaments and precise cellular immunotherapy.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a method of screening for a tumor-reactive TCR, the method comprising the steps of:

s01, sorting a T cell group expressing a tumor reactive T cell marker by a single cell sorting technology;

s02, respectively labeling the total mRNA of each single cell in the S01 cell population with a unique barcode by using a single cell labeling technology;

s03, obtaining total cDNA of a single cell by a reverse transcription technology;

s04 amplifying a tumor reactive T cell marker gene by PCR by taking a total cDNA amplification product as a template, wherein the amplification product gene carries a unicellular specific barcode;

s05 total cDNA amplification product is used as template, PCR amplification is carried out to obtain enrichment product of TCRalpha variable region and TCRbeta variable region carrying barcode. Further connecting the enriched products of the TCRalpha variable region and the TCRbeta variable region with a carrier carrying a TCR constant region respectively, converting engineering bacteria, and further extracting plasmids which are a TCR alpha mixed plasmid library and a TCR beta mixed plasmid library.

S06 takes a TCRalpha variable region and a TCRbeta variable region enrichment product or a TCR mixed plasmid library as a template, selects a specific region design primer in a T cell marker gene sequence carrying single-cell specific barcode as an upstream forward primer for amplifying the tumor-reactive TCR, selects a specific sequence carrying a TCR alpha or TCR beta constant region sequence as a downstream reverse primer for amplifying the tumor-reactive TCR, and obtains the TCRalpha and TCRbeta variable region sequences with the same barcode by PCR amplification.

S07 purifying the TCRalpha variable region and TCRbeta variable region with the same barcode obtained by PCR amplification, and respectively connecting to a carrier carrying the full length of the TCRalpha and TCRbeta constant region to finally obtain the TCR full length sequence. And transforming the engineering bacteria by the connecting product to obtain positive clone, and sequencing to obtain a TCR gene sequence. In contrast to the barcode sequences, TCRalpha and TCRbeta with the same barcode are in a paired relationship.

Further, the T cell marker of the present invention is selected from the group consisting of CD39+, CXCL13+, PD-1high, CXCL13+ GZA + (Granzyme A, GZA), CD39+ CD103+, etc., and CXCL13 is more preferable.

Further, when the T cell marker is CXCL13, the forward primer upstream for amplifying the tumor-reactive TCR is selected from the group consisting of:

CXCL13-F1：TCAATTGTGTGTGTGGACCCTCAA

CXCL13-F2：ATCCCTAGACGCTTCATTGATCGA

CXCL13-F3：TCTCTCCAGTCCAAGGTGTTCTG

CXCL13-F4：CAAGCTTGAGGTGTAGATGTGTC

CXCL13-F5：GGTCAGCAGCCTCTCTCCAGTC

CXCL13-F6：TCTGCTTCTCATGCTGCTGG

CXCL13-F7：CAGCCTCTCTCCAGTCCAAG

CXCL13-F8：CGTGGGAATGGTTGTCCAAGA

and/or CXCL13-F9: GTCCAAGGTGTTCTGGAGGT.

In one embodiment, PCR amplification of the tumor-reactive TCRalpha variable region and TCRbeta variable region in S06 is templated on enrichment products for the TCRalpha variable region and TCRbeta variable region, respectively. The enrichment products of the TCRalpha variable region and the TCRbeta variable region are enrichment products obtained by respectively amplifying a TCR alpha variable region and a TCR beta variable region through DNA cyclization and PCR by taking purified cDNA as a template.

In another embodiment, S05 uses total cDNA amplification product as template to obtain enrichment product of TCRalpha variable region and TCRbeta variable region carrying barcode by means of DNA cyclization and PCR amplification.

In another embodiment, S05 uses total cDNA amplification product as template, and PCR amplification is directly performed to obtain enrichment product of TCRalpha variable region and TCRbeta variable region carrying barcode.

In a second aspect, the invention provides a primer for detecting a TCR of an individualized tumor-reactive T cell, the primer having the sequence:

CXCL13-F1：TCAATTGTGTGTGTGGACCCTCAA

CXCL13-F2：ATCCCTAGACGCTTCATTGATCGA

CXCL13-F3：TCTCTCCAGTCCAAGGTGTTCTG

CXCL13-F4：CAAGCTTGAGGTGTAGATGTGTC

CXCL13-F5：GGTCAGCAGCCTCTCTCCAGTC

CXCL13-F6：TCTGCTTCTCATGCTGCTGG

CXCL13-F7：CAGCCTCTCTCCAGTCCAAG

CXCL13-F8：CGTGGGAATGGTTGTCCAAGA

CXCL13-F9：GTCCAAGGTGTTCTGGAGGT

the primer is used for PCR amplification of a CXCL13 gene of a tumor reactive T cell marker, and further the PCR amplification takes cDNA of a single T cell expressing the tumor reactive T cell marker as a template, and further the primer contains unique barcode of the single T cell.

The primer is further preferably:

CXCL13-F6：TCTGCTTCTCATGCTGCTGG

CXCL13-F8：CGTGGGAATGGTTGTCCAAGA

and/or CXCL13-F9: GTCCAAGGTGTTCTGGAGGT.

In a third aspect, the invention provides an apparatus for screening for a tumor-reactive TCR, the apparatus comprising:

component 1: a single cell sorter for sorting the T cell population expressing the tumor reactive T cell marker by the single cell sorter;

and (3) assembly 2: a single cell marking device or experimental apparatus, which marks the total mRNA of each single cell in the T cell group with a unique barcode respectively;

and (3) the component: a reverse transcription system for obtaining total cDNA of each single cell from total mRNA of each single cell in the T cell population by a reverse transcription technique;

and (4) assembly: a PCR system, which takes the total cDNA amplification product as a template and amplifies a tumor reactive T cell marker gene through PCR, wherein the amplification product gene carries single cell specific barcode; selecting a specific region design primer in a T cell marker gene sequence carrying single cell specific barcode as an upstream forward primer for amplifying the tumor reactive TCR, selecting a specific sequence carrying a TCR alpha or TCR beta constant region sequence as a downstream reverse primer for amplifying the tumor reactive TCR, and carrying out PCR amplification to obtain a TCRalpha variable region and a TCRbeta variable region with the same barcode.

And (5) the components: the cloning system and the sequencer purify the TCRalpha full length and the TCRbeta full length which are amplified by PCR and have the same barcode, then connect to a plasmid vector carrying the TCR constant region full length, connect products to transform engineering bacteria to obtain positive clone, and obtain a TCR gene sequence after sequencing (figure 1).

Further, the single cell sorter may be a flow cytometer.

Further, the single cell labeling device may select a cell chip and a barcode-loaded magnetic bead or micro-droplet forming device.

Compared with the prior art, the method for screening tumor-reactive TCR provided by the present invention has the advantages of:

(1) Fast, simple, significantly reducing the time and cost required for tumor-reactive TCR acquisition;

(2) The invention lays a foundation for the development of individual TCR medicaments;

(3) The present invention develops a rapid, simple, low-cost strategy for cloning tumor-reactive TCRs by rapidly screening and cloning tumor-reactive TCRs through tumor-reactive T cell markers in a gene-independent manner.

Drawings

FIG. 1 is a flow chart of a rapid low-cost cloning tumor-reactive TCR technology;

FIG. 2. Display of tumor-reactive T cell sorting;

FIG. 3 electrophoretic detection of PCR-amplified CXCL13 gene; FIG. 3A shows the total primer sequences detected, and FIG. 3B shows the 3 most prominent primer sequences detected.

FIG. 4 electrophoretic detection of PCR amplification of TCR alpha and beta full-length sequences from a mixed plasmid library;

FIG. 5 electrophoretic detection of PCR amplification of TCR alpha and beta variable region sequences from TCR enrichment products;

Detailed Description

The invention relates to a method for screening tumor-reactive TCR, which rapidly obtains a tumor-reactive TCR sequence with the assistance of a tumor-reactive T cell marker, and the simple and rapid process accelerates the treatment progress of individualized TCR-T cells and lays a foundation for the development of individualized TCR medicines.

Definition of

In order that the invention may be more readily understood, we shall set forth additional definitions of certain terms throughout this specification.

As used in this specification and the claims, the singular and plural referents unless the context clearly dictates otherwise.

Where the context clearly dictates or is obvious otherwise, the term "or" in this specification or the claims is to be understood as being inclusive and encompasses both "or" and ". "and/or" should be understood as a specific disclosure of each of the two specific features or components with or without the other, e.g., "a and/or B" includes a and B, a or B, a (alone); and B (alone); the same "A, B and/or C" includes A, B and C; A. b or C; a or B; a or C; b or C; a and C; a and B; b and C; a (alone); b (alone); c (alone).

The terms "for example" and "such as" are used as examples, and are not intended to be limiting, and should not be construed to refer only to those items explicitly recited in the specification.

Throughout this specification the word "comprising" or "comprises" will be understood to include the stated elements or steps, but not to exclude any other elements or steps, including the meaning "consisting of 8230; \8230; composition" and/or "consisting essentially of 8230; \8230;" 823030 ";" composition ".

"tumor-reactivity" as used herein refers to a biological effect that can manifest as a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, a decrease in the number of metastases, an increase in overall or progression-free survival, an increase in life expectancy, or an improvement in various physiological symptoms associated with the tumor.

Sorting a T cell population expressing a tumor-reactive T cell marker by a single cell sorting technique; by T cells is meant the collection of patient-autologous and/or allogeneic patient T cells, which are obtained from a donor subject, in some embodiments a human or mammalian patient having a cancer or tumor, in some embodiments a human or mammalian patient not having a cancer or tumor. In the present invention, the terms "subject" and "patient" are used interchangeably.

Example 1 tumor reactive T cell acquisition

1.1 tumor tissue digestion: tumor tissue was harvested by surgery and normal tissue, which was visually distinguishable, was removed. After the tumor tissue is cut into pieces by using a surgical scissors, the tissue digestion solution (1 mg/mL collagenase IV (Merck) + DNAse (Merck)) is used for resuspending the tissue blocks, the tissue blocks are placed in a tissue dissociator for dissociation for 15-30min, then the digestion tube is taken out, the single cell suspension is filtered by using a filter screen, and the filter screen is washed by PBS, so that the single cell suspension which is completely dissociated is obtained. Single tumor cells were harvested by centrifugation and resuspended in 5mL PBS.

1.2T cell sorting: t cell populations carrying tumor reactive T cell markers were sorted out from the single cell suspensions of tumors. As tumor-reactive T cell marker CD39+ case sorting of tumor-reactive T cells was performed. Cells were stained with fluorescent-tagged antibodies. The basic steps are as follows:

1) Taking 10 mu L of the cell suspension obtained in the step 1.1 for cell counting, and centrifugally collecting cells;

2) By 1X 10 ⁷ Adding PBS buffer solution at the density of cells/mL, and fully suspending the cells;

3) Adding APC-CD3, FITC-CD8 and PE-CD39 fluorescent label antibodies according to the proportion of 10 mu L/mL, fully and uniformly mixing the antibodies and cells, and placing at 4 ℃ for dyeing for 30min;

4) Washing the cells twice by using PBS buffer solution, and centrifugally collecting the cells;

5) Flow-type on-machine separation CD39+ positive cell population, sort protocol is shown in figure 2. The results show that: a part of T cells in the interior of the tumor is CD39+, this fraction of cells can be sorted out as candidate tumor-reactive T cells.

Example 2 construction of TCR Mixed clone library

The construction steps of the TCR mixed plasmid library are as follows:

1) Single cell sorting: separating single T cells by using a microfluidic method and marking the 5 'end or the 3' end of mRNA of the single T cells;

2) Reverse transcription: reverse transcribing the labeled mRNA into cDNA;

3) Amplification and purification of cDNA: after PCR amplification and enrichment are carried out on the reverse transcription cDNA, the cDNA is purified by a magnetic bead method;

4) Circularizing the purified cDNA product;

5) TCR enrichment: the cyclized cDNA is linearized by utilizing a PCR technology, then TCR alpha and TCR beta variable regions are respectively amplified by utilizing the PCR technology, and enriched TCR is purified by utilizing a magnetic bead method;

6) TCR connection: connecting the amplified TCR alpha variable region to a carrier carrying a TCR alpha constant region, and connecting the TCR beta variable region to a carrier carrying a TCR beta constant region sequence;

7) And (3) transformation: and respectively transforming the TCR alpha vector and the TCR beta vector which are connected with the TCR variable region into escherichia coli, and culturing the transformed bacterial liquid overnight.

8) Respectively preparing plasmid libraries: and (3) cracking the bacteria liquid after overnight culture to respectively extract plasmids, wherein the extracted plasmids are a TCR alpha mixed plasmid library and a TCR beta mixed plasmid library respectively. ( Application No. 202210306873.X and application No.: 202210332403.0 the methods relating to the construction of TCR mixed plasmid libraries are incorporated herein in their entirety. )

Example 3 determination of tumor-reactive T cells and TCR cloning

3.1 tumor-reactive T cell marker CXCL13 Gene amplification

PCR amplification reactions were carried out using the cDNA amplification products obtained in example 2 as templates, and CXCL 13-specific gene fragments carrying the barcode sequence were amplified respectively. The tumor-reactive T cell marker CXCL13+ (mRNA level) is taken as an example to perform the amplification of the tumor-reactive T cell marker gene.

Designing a primer sequence: the mRNA sequence for human CXCL13 (NM-006419.3) was retrieved in the NCBI (https:// www.ncbi.nlm.nih.gov. /) database (SEQ ID No: 1):

gagaagatgtttgaaaaaactgactctgctaatgagcctggactcagagctcaagtctgaactctacctccagacagaatgaagttcatctcgacatctctgcttctcatgctgctggtcagcagcctctctccagtccaaggtgttctggaggtctattacacaagcttgaggtgtagatgtgtccaagagagctcagtctttatccctagacgcttcattgatcgaattcaaatcttgccccgtgggaatggttgtccaagaaaagaaatcatagtctggaagaagaacaagtcaattgtgtgtgtggaccctcaagctgaatggatacaaagaatgatggaagtattgagaaaaagaagttcttcaactctaccagttccagtgtttaagagaaagattccctgatgctgatatttccactaagaacacctgcattcttcccttatccctgctctggattttagttttgtgcttagttaaatcttttccaggaaaaagaacttccccatacaaataagcatgagactatgtaaaaataaccttgcagaagctgatggggcaaactcaagcttcttcactcacagcaccctatatacacttggagtttgcattcttattcatcagggaggaaagtttctttgaaaatagttattcagttataagtaatacaggattattttgattatatacttgttgtttaatgtttaaaatttcttagaaaacaatggaatgagaatttaagcctcaaatttgaacatgtggcttgaattaagaagaaaattatggcatatattaaaagcaggcttctatgaaagactcaaaaagctgcctgggaggcagatggaacttgagcctgtcaagaggcaaaggaatccatgtagtagatatcctctgcttaaaaactcactacggaggagaattaagtcctacttttaaagaatttctttataaaatttactgtctaagattaatagcattcgaagatccccagacttcatagaatactcagggaaagcatttaaagggtgatgtacacatgtatcctttcacacatttgccttgacaaacttctttcactcacatctttttcactgactttttttgtggggggcggggccggggggactctggtatctaattctttaatgattcctataaatctaatgacattcaataaagttgagcaaacattttacttaa

upstream forward primers were designed based on the mRNA sequence of CXCL13, and 9 in total were designed. Wherein the following are respectively:

CXCL13-F1：TCAATTGTGTGTGTGGACCCTCAA

CXCL13-F2：ATCCCTAGACGCTTCATTGATCGA

CXCL13-F3：TCTCTCCAGTCCAAGGTGTTCTG

CXCL13-F4：CAAGCTTGAGGTGTAGATGTGTC

CXCL13-F5：GGTCAGCAGCCTCTCTCCAGTC

CXCL13-F6：TCTGCTTCTCATGCTGCTGG

CXCL13-F7：CAGCCTCTCTCCAGTCCAAG

CXCL13-F8：CGTGGGAATGGTTGTCCAAGA

CXCL13-F9：GTCCAAGGTGTTCTGGAGGT。

wherein the downstream reverse primer binding region has the sequence of

CXCL13-R：CCTACACGACGCTCTTCCGATCT

PCR reaction system and procedure for amplification of CXCL13 gene:

reaction system:

components	Volume of
		2XHieff PCR master mix	25μl
CXCL13 forward primer	2μl
		CXCL13 reverse primer	2μl
cDNA	100ng
		ddH2O	Variable
Total	To 50μl

Reaction procedure:

the amplified PCR product was detected by agarose gel electrophoresis. The results showed that all primers were detected by agarose gel electrophoresis, and the size of the product was about 1kb, but the amount obtained by detection was different, for example, the bands amplified by the PCR method for CXCL13-F1 and CXCL13-F3 were not clear enough, and the expression amount was small. The other primers are expressed in a relatively large amount, wherein CXCL13-F6, CXCL13-F8 and CXCL13-F9 have the brightest bands and have the most expression. The PCR band results are shown in FIGS. 3A and 3B.

3.2 determination of the expression of CXCL13 Gene barcode

The obtained PCR product of CXCL13 gene was ligated to a plasmid vector. And selecting monoclonal bacteria to detect positive clones. And carrying out sanger sequencing on the positive clone to determine a specific barcode sequence carried by the CXCL13 gene. The specific process is as follows: after the CXCL13 gene fragment obtained by PCR amplification is purified, a plasmid Vector (Takara 6013pMD19-T Vector Cloning kit) is ligated by the technical process provided by the reference kit, the ligation product is transformed into E.coli DH5 alpha, and the transformed product is spread on a resistant plate for overnight culture. And selecting the monoclone from the plate on the next day to identify the positive clone, and sending the positive clone to the corresponding bacterial liquid sanger for sequencing. The specific sequence of barcode carried by the CXCL13 gene is obtained by analyzing the sequencing result. The specific sequence table of barcode is as follows

Table 1.

Cells carrying these barcodes are considered tumor-reactive T cells. TCRs carrying these barcodes are considered tumor-reactive TCRs.

3.3 amplification of tumor-reactive TCR by CXCL13 barcode

3.3.1 primers designed to amplify tumor-reactive TCRs: the genes having the same barcode are all derived from the same cell, and therefore the TCR gene having the same barcode sequence as CXCL13 is also derived from the same T cell. A specific region in the barcode sequence carried by the CXCL13 gene is selected to design a primer as an upstream forward primer for amplifying the tumor-reactive TCR, and a primer binding region can be positioned near the 3 'end or the 5' end in the middle of the cell-specific barcode. Selecting a specific sequence on a carrier carrying a TCR alpha or TCR beta constant region sequence as a downstream reverse primer for amplifying the tumor reactive TCR. The primers designed to amplify the TCR of the present invention are listed below:

TABLE 2

3.3.2 The tumor-reactive TCR was PCR amplified.

PCR amplification of tumor-reactive TCRs was performed using the TCRalpha mixed plasmid library and the TCRbeta mixed plasmid library obtained in example 2 as templates, respectively. All designed upstream forward primers for amplifying the full length of the TCR are diluted to 20uM respectively and mixed in equal volume to mix to obtain mix serving as the forward primers for amplifying the full length of the TCR. The same forward and reverse primers were used for TCRalpha and TCRbeta full-length amplifications, and the TCRalpha mixed plasmid library and the TCRbeta mixed plasmid library were used for the template, respectively. The PCR reaction system and procedure were:

reaction system:

components	Volume of
		2XHieff PCR master mix	25μl
TCR Forward primer mix	2μl
		TCR reverse primer	2μl
TCRalpha/TCRbeta plasmid library	200ng
		ddH2O	Variable
Total	To 50μl

Reaction procedure:

PCR amplification to obtain TCRalpha full length and TCRbeta full length was performed using agarose gel electrophoresis, and the results are shown in FIG. 4. From FIG. 4, it can be seen that both TCRalpha full-length and TCRbeta full-length were successfully amplified, and the size of the product fragment was about 1kb.

3.3.3 tumor-reactive TCR sequencing: purifying the TCRalpha full length and TCRbeta full length obtained by PCR amplification, connecting with a plasmid vector, and transforming the connecting product into escherichia coli DH5 alpha. The transformed product was plated on a resistant plate for overnight culture. And (3) selecting a monoclonal from the plate to identify a positive clone, sequencing the positive clone by using a corresponding bacterium liquid sanger, and sequencing and analyzing a cell specific barcode sequence and a TCR variable region in a sequencing result by using gene analysis software. The present invention has found 10 TCR-reactive against candidate tumors. These TCRs, which have the same cell-specific barcode as CXCL13, are candidate tumor-reactive TCRs. The nucleotide sequence of the variable region of the obtained tumor-reactive TCR is shown in Table 3 and the amino acid sequence is shown in Table 4. The variable region types corresponding to the different TCR-alpha and TCR-beta variable regions were further analyzed using the IMGT database (https:// www.imgt. Org), information is shown in Table 4.

TABLE 3

TABLE 4

Example 4 direct acquisition of tumor-reactive TCR genes by establishment of a tumor-reactive TCR plasmid library

The above procedure performed mixed plasmid pooling of all TCRs after TCR enrichment. However, most TCRs are not tumor-reactive TCRs, and only T cells expressing CXCL13 are considered tumor-reactive. Therefore, after TCR enrichment, the invention uses the barcode carried by the CXCL13 gene as a primer to amplify the TCR enrichment product, and then directly establishes the tumor-reactive TCR to construct a plasmid library. The method greatly reduces the capacity of the plasmid library and reduces the subsequent cost.

4.1 design of tumor-reactive TCR library building primers: the barcode sequence carried by the CXCL13 gene obtained in example 3.3 was designed as a tumor-reactive TCR library primer. The tumor reactive TCR library establishing primer comprises a homologous arm used for recombining with a vector and a barcode sequence carried by a CXCL13 gene. The homology arm portion may be recombinantly linked to a vector carrying the TCR constant region. TCR library building primer sequences are shown in table 5:

primer name	Sequence of
		TCR-C13B-F1	CTTTGCCTTTCTCTCCACAGGGGTACCCGCATGCTGATGTTCTCC
TCR-C13B-F2	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGTTGACTCT
		TCR-C13B-F3	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGTGCGATCT
TCR-C13B-F4	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGTATGTGGC
		TCR-C13B-F5	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGGTCGCTAT
TCR-C13B-F6	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGATCACGTT
		TCR-C13B-F7	CTTTGCCTTTCTCTCCACAGGGGTACCGACACAGCAATGTTCCCT
TCR-C13B-F8	CTTTGCCTTTCTCTCCACAGGGGTACCGAGTCAGCATTACCACCA
		TCR-C13B-F9	CTTTGCCTTTCTCTCCACAGGGGTACCGAGTCAGCATTAACGCTG
TCR-C13B-F11	CTTTGCCTTTCTCTCCACAGGGGTACCGAGTCAGCATTAACACTG
		TCR-C13B-F12	CTTTGCCTTTCTCTCCACAGGGGTACCGAGTCAGCATGTGTGTCG
TCR-C13B-F13	CTTTGCCTTTCTCTCCACAGGGGTACCGAGTCAGCATGTGTCCTT
		TCR-C13B-F15	CTTTGCCTTTCTCTCCACAGGGGTACCCGCATGCTGATCCGTCTT
TCR-C13B-F16	CTTTGCCTTTCTCTCCACAGGGGTACCATACGTAGTCTTCAGCTC
		TCR-C13B-F17	CTTTGCCTTTCTCTCCACAGGGGTACCATACGTAGTCGCACTGTC
TCR-C13B-F18	CTTTGCCTTTCTCTCCACAGGGGTACCTTCTGACTACGGAATCTG
		TCR-C13B-F19	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGTCGAGCGT
TCR-C13B-F20	CTTTGCCTTTCTCTCCACAGGGGTACCTCTGACTACGTAGCTTGT

4.2 PCR amplification of tumor reactive TCR: using the TCR-enriched products obtained in the step of example 1 as templates, diluting the forward primers designed in the above table to 20uM respectively, mixing the diluted forward primers in equal volumes to mix to obtain mix as the forward primers for TCR library construction amplification, and amplifying tumor-reactive TCR alpha and TCR beta variable regions respectively; the downstream primer sequences for amplifying TCR alpha and TCR beta variable regions are respectively as follows:

TRAC-R：GGCAGGGTCAGGGTTCTGG

TRBC-R：GTGGGAACACCTTGTTCAGG

the PCR reaction system and procedure were:

and (3) PCR reaction system:

reaction procedure:

the TCRalpha variable region and TCRbeta variable region obtained by PCR amplification were detected by agarose gel electrophoresis, and the results are shown in FIG. 5. From FIG. 5, it can be seen that both the TCRalpha variable region and the TCRbeta variable region were successfully amplified, and the product fragment size was about 600bp.

4.3 tumor reactive TCR cloning and sequencing: connecting the amplified tumor-reactive TCR alpha and TCR beta variable regions with vectors carrying TCR alpha and TCR beta constant region sequences respectively; then, referring to example 3, the ligated products were transformed into E.coli DH 5. Alpha. Respectively, and the transformed products were plated on resistant plates overnight. And selecting a monoclonal from the plate to identify positive clones in the next day, sending the positive clones to corresponding bacterial liquid to extract plasmids, sequencing by sanger, and performing sequencing analysis on cell specific barcode sequences and TCR variable regions in sequencing results by using gene analysis software. TCRs having the same barcode as CXCL13 are candidate tumor-reactive TCRs. The present invention finds 10 pairs of candidate tumor-reactive TCRs from a library of tumor-reactive TCR plasmids. The nucleotide sequence of the variable region of the obtained tumor-reactive TCR is shown in Table 6, and the amino acid sequence is shown in Table 7. The IMGT database (https:// www.imgt.org) was further used to analyze the variable region clonotypes for the different TCR-alpha and TCR-beta variable regions, respectively, for summary information as shown in Table 7. The above paired TCR sequences can be applied to the production of personalized TCR-ts and patient treatment.

TABLE 6

TABLE 7

The consistency of the number of paired TCRs obtained by the TCR amplification method of the invention and the number of paired TCRs obtained by NGS sequencing reaches more than 80%, preferably more than 90%, and more preferably 95-100%.

The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the details of the above embodiments, and various modifications may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are within the scope of the present invention.

It should be noted that, in the foregoing embodiments, various specific technical features and steps described in the above embodiments can be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations of the features and steps are not described separately.

In addition, any combination of the various embodiments of the present invention can be made, and the same should be considered as the disclosure of the present invention as long as the idea of the present invention is not violated.

Claims (10)

1. A method of screening for a tumor-reactive TCR, comprising the steps of:

s01, sorting a T cell population expressing a tumor-reactive T cell marker by a single cell sorting technology;

s02, respectively labeling the total mRNA of each single cell in the S01 cell population with a unique barcode by using a single cell labeling technology;

s03, obtaining total cDNA of a single cell by a reverse transcription technology;

s04, amplifying a tumor reactive T cell marker gene by using a total cDNA amplification product as a template through PCR, wherein the amplification product gene carries single-cell specific barcode;

s05, taking the total cDNA amplification product as a template, obtaining a TCRalpha variable region carrying barcode and a TCRbeta variable region enrichment product through PCR amplification, further connecting the TCRalpha variable region and the TCRbeta variable region enrichment product with a carrier carrying a TCR constant region respectively, converting engineering bacteria, and further extracting plasmids which are a TCR alpha mixed plasmid library and a TCR beta mixed plasmid library;

s06, taking a TCRalpha variable region and a TCRbeta variable region enrichment product or a TCR mixed plasmid library as a template, selecting a specific region design primer in a T cell marker gene sequence carrying single-cell specific barcode as an upstream forward primer for amplifying the tumor-reactive TCR, selecting a specific sequence carrying a TCR alpha or TCR beta constant region sequence as a downstream reverse primer for amplifying the tumor-reactive TCR, and obtaining the TCRalpha and TCRbeta variable region sequences with the same barcode by PCR amplification;

s07 purifying the TCRalpha variable region and the TCRbeta variable region which are amplified by PCR and have the same barcode, respectively connecting the purified TCRalpha variable region and the TCRbeta variable region to a carrier carrying the full length of the TCRalpha and the TCRbeta constant region, finally obtaining a TCR full length sequence, connecting a product to transform engineering bacteria, obtaining positive clone, and obtaining the TCR gene sequence after sequencing.

2. A method of screening for a tumor reactive TCR according to claim 1 wherein the T cell marker is selected from the group consisting of CD39+, CXCL13+, PD-1high, CXCL13+ GZA + (Granzyme a, GZA) and CD39+ CD103+.

3. A method of screening for a tumor reactive TCR according to claim 1 or claim 2 which is selected from the group consisting of:

CXCL13-F1：TCAATTGTGTGTGTGGACCCTCAA

CXCL13-F2：ATCCCTAGACGCTTCATTGATCGA

CXCL13-F3：TCTCTCCAGTCCAAGGTGTTCTG

CXCL13-F4：CAAGCTTGAGGTGTAGATGTGTC

CXCL13-F5：GGTCAGCAGCCTCTCTCCAGTC

CXCL13-F6：TCTGCTTCTCATGCTGCTGG

CXCL13-F7：CAGCCTCTCTCCAGTCCAAG

CXCL13-F8：CGTGGGAATGGTTGTCCAAGA

and/or CXCL13-F9: GTCCAAGGTGTTCTGGAGGT.

4. A primer for detecting individualized tumor-reactive T cell TCR, which primer has the following sequence:

CXCL13-F1：TCAATTGTGTGTGTGGACCCTCAA

CXCL13-F2：ATCCCTAGACGCTTCATTGATCGA

CXCL13-F3：TCTCTCCAGTCCAAGGTGTTCTG

CXCL13-F4：CAAGCTTGAGGTGTAGATGTGTC

CXCL13-F5：GGTCAGCAGCCTCTCTCCAGTC

CXCL13-F6：TCTGCTTCTCATGCTGCTGG

CXCL13-F7：CAGCCTCTCTCCAGTCCAAG

CXCL13-F8：CGTGGGAATGGTTGTCCAAGA

and/or CXCL13-F9: GTCCAAGGTGTTCTGGAGGT.

5. The primer for detecting individualized tumor-reactive T cell TCR according to claim 4 for PCR amplification of the tumor-reactive T cell marker CXCL13 gene.

6. A primer for detecting TCR on individualized tumor-reactive T cells according to claim 4 or 5, wherein the PCR amplification is templated by cDNA from a single T cell expressing a tumor-reactive T cell marker.

7. A primer for the detection of a TCR in a personalized tumor-reactive T cell according to claim 6, which primer contains barcode unique to a single cell.

8. A device for screening for a tumor-reactive TCR, comprising the following components:

component 1: a single cell sorter for sorting the T cell population expressing the tumor reactive T cell marker by the single cell sorter;

and (3) the component 2: a single cell marking device or experimental apparatus, which marks the total mRNA of each single cell in the T cell group with a unique barcode respectively;

and (3) the component: a reverse transcription system for obtaining total cDNA of each single cell from total mRNA of each single cell in the T cell population by a reverse transcription technique;

and (4) the components: a PCR system, which takes the total cDNA amplification product as a template and amplifies a tumor reactive T cell marker gene through PCR, wherein the amplification product gene carries single cell specific barcode; selecting a specific region design primer in a T cell marker gene sequence carrying single cell specific barcode as an upstream forward primer for amplifying the tumor-reactive TCR, selecting a specific sequence carrying a TCR alpha or TCR beta constant region sequence as a downstream reverse primer for amplifying the tumor-reactive TCR, and carrying out PCR amplification to obtain a TCRalpha variable region and a TCRbeta variable region with the same barcode;

and (5) assembly: the cloning system and the sequencer purify the TCRalpha full length and the TCRbeta full length which are amplified by PCR and have the same barcode, then connect to a plasmid vector carrying the TCR constant region full length, connect the product to transform engineering bacteria, obtain positive clone, and obtain a TCR gene sequence after sequencing.

9. The apparatus for screening tumor reactive TCRs of claim 8, wherein said single cell sorter is flow cytometer capable.

10. An apparatus for screening tumor reactive TCRs as claimed in claim 8 or 9 wherein said single cell labelling device is selected from the group consisting of a cell chip and a barcode loaded magnetic bead or microdroplet forming device.

Images