CN115724928A - Transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, coding gene and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a transcription factor LrPAP1 for regulating and controlling the synthesis of lycoris plant anthocyanin, a coding gene and application thereof. The LrPAP1 gene is overexpressed in the plant, so that the synthesis and accumulation of anthocyanin in the plant are promoted, the content of anthocyanin in the plant is improved, the important function of the LrPAP1 gene in the synthesis process of anthocyanin is further explained, the LrPAP1 gene can be used for cultivating the plant with high anthocyanin content, and a theoretical basis and an application reference value are provided for germplasm creation of flower color breeding.

Description

Transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, coding gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, a coding gene and application thereof.

Background

Lycoris (Lycoris herb.) is a perennial bulbous flower plant mainly distributed in the Yangtze river basin of China. The lycoris plant leaves grow into clusters and strips, the winter leaves are dark green, the summer flowers are bright, and the lycoris plant leaves are rare ground cover plants in subtropical regions with less flowers in summer and less green in winter. The lycoris is known as the Chinese tulip because of the charm of the flower type and the flower color of the lycoris. The flower color is an important ornamental characteristic of the lycoris plants, the main means of lycoris breeding at present is breeding by interspecific hybridization, but the hybridization breeding blindness and randomness are high, and a large amount of time and energy are consumed to obtain an ideal new variety. In recent years, a targeted molecular breeding technology utilizing a transgenic technology is widely applied to horticultural flowers, and genes for regulating and controlling relevant phenotypic characters are overexpressed or knocked out in target plants mainly through the transgenic technology, so that the plants obtain or lose corresponding phenotypes, and finally ideal varieties are obtained. Therefore, obtaining genes that control the relevant phenotypic traits is a prerequisite basis and an important resource for molecular breeding.

The anthocyanin is a main chromogenic substance for enabling the plant flowers to develop pink to blue-purple, and the plant anthocyanin biosynthesis pathway is a branch of the flavonoid synthesis pathway and is a clearer secondary metabolism pathway researched at present. Transcription factors MYB and bHLH in an anthocyanin synthesis way and WD40 form an MBW protein complex, the transcription of structural genes in the anthocyanin synthesis way is regulated and activated, and the synthesis of anthocyanin is regulated and controlled. The R2R3 MYB transcription factor plays an important role in regulating anthocyanin synthesis, and can increase or reduce accumulation of anthocyanin in the flower by promoting or inhibiting expression of structural genes in an anthocyanin synthesis pathway, so that the color of the flower is finally determined. At present, MYB transcription factors for regulating anthocyanin synthesis in lycoris plants are not reported. Therefore, the identification of the MYB transcription factor participating in regulation and control of lycoris radiata anthocyanin biosynthesis has important significance for clarifying a regulation and control mechanism of lycoris radiata anthocyanin synthesis, can be applied to genetic engineering improvement of other plants, and has important significance for molecular breeding improvement of lycoris radiata plant anthocyanin in the future.

Disclosure of Invention

The invention aims to provide a transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, a coding gene and application thereof, and the transcription factor LrPAP1 can promote synthesis and accumulation of plant anthocyanin and improve the content of plant anthocyanin.

The invention provides a transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, wherein the transcription factor LrPAP1 is protein shown in any one of a) to d):

a) The method comprises the following steps A protein consisting of an amino acid sequence shown in SEQ ID No. 1;

b) The method comprises the following steps The protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO.1 and has the same function;

c) The method comprises the following steps Protein with 80% homology or more with the amino acid sequence defined by a) or b) and with the same function;

d) The method comprises the following steps A fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of a protein defined in any one of a) to C).

The invention also provides an LrPAP1 gene for coding the transcription factor LrPAP1 in the technical scheme, wherein the LrPAP1 gene is a DNA molecule shown in any one of the following I) to III):

i) a DNA molecule consisting of the nucleotide shown in SEQ ID NO. 2;

II) DNA molecules which are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to the DNA sequences defined under I) and which code for the proteins mentioned above;

III) DNA molecules which hybridize under stringent conditions with the DNA sequences defined under I) or II) and which code for the proteins mentioned.

The invention also provides an expression vector which comprises the LrPAP1 gene in the technical scheme.

The invention also provides a cell line, which comprises the LrPAP1 gene in the technical scheme.

The invention also provides an engineering bacterium, which comprises the LrPAP1 gene in the technical scheme.

The invention also provides the application of the transcription factor LrPAP1 or LrPAP1 gene or expression vector or cell line or engineering bacterium in any one or more of A) to D) in the technical scheme.

A) Promoting anthocyanin synthesis in plants;

b) Promoting synthesis and/or accumulation of anthocyanin in plant leaves and/or petals;

c) The method comprises the following steps of (1) assisting in cultivating a plant variety with high anthocyanin content;

d) And (5) flower color breeding.

Preferably, the plant comprises lycoris and/or tobacco.

Preferably, the synthesis and/or accumulation of anthocyanin in the plant is promoted by increasing the content of the transcription factor LrPAP1 in the target plant or increasing the expression level of the LrPAP1 gene in the target plant.

The invention also provides a method for cultivating the plant with high anthocyanin content, which comprises the following steps: increasing the content of transcription factor LrPAP1 in the target plant or promoting the expression of the LrPAP1 gene in the target plant to obtain the plant with high anthocyanin content.

Has the advantages that:

the invention provides a transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, and particularly discloses an amino acid sequence thereof and an LrPAP1 gene for coding the transcription factor LrPAP1. The LrPAP1 gene is overexpressed in the plant, so that the synthesis and accumulation of anthocyanin in the plant are promoted, the content of anthocyanin in the plant is improved, the important function of the LrPAP1 gene in the synthesis process of anthocyanin is further explained, the LrPAP1 gene can be used for cultivating the plant with high anthocyanin content, and a theoretical basis and an application reference value are provided for germplasm creation of flower color breeding.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments will be briefly described below.

FIG. 1 is a schematic diagram of the full length of the PCR amplified LrPAP1 provided by the present invention, wherein M is 1000marker, and LrPAPP 1 is the full length of the amplified LrPAP 1;

FIG. 2 is a comparison of the amino acid sequences of LrPAP1 and other MYBs;

FIG. 3 is a diagram showing the expression pattern of LrPAP1 gene in different flower season of Lycoris radiata;

FIG. 4 is a diagram showing the expression pattern of LrPAP1 gene in different tissues of Lycoris radiata;

FIG. 5 is a plasmid map of pMDC 83;

FIG. 6 is a partial structural diagram of a plant expression vector containing LrPAP 1;

FIG. 7-1 is a comparison graph showing the phenotype identification of petals of Lycoris plants transformed with LrPAP1 gene, wherein the left graph shows the petal phenotype of pMDC83 empty vector injection, and the right graph shows the petal phenotype of pMDC83-LrPAP1 injection;

FIG. 7-2 is a graph showing the measurement of anthocyanin content in petals of Lycoris plants transformed with LrPAP1 gene;

FIG. 8 is a comparison graph showing the phenotypic identification of tobacco leaves transformed with LrPAP1 gene, wherein the left half (CK) of the graph shows the phenotype after anthocyanin staining of leaves injected with pMDC83 empty vector, and the right half (OE-LrPAP 1) shows the phenotype after anthocyanin staining of leaves injected with pMDC83-LrPAP 1; the right picture is a picture for determining the anthocyanin content of LrPAP1 gene transferred tobacco leaves;

FIG. 9 shows the results of analysis of expression patterns of anthocyanin synthesis-associated genes in LrPAP 1-transgenic lycoris radiata petals.

Detailed Description

The invention provides a transcription factor LrPAP1 (Lycoris radiata protein vaccination 1) for regulating and controlling plant Anthocyanin synthesis, wherein the transcription factor LrPAP1 is protein shown by any one of a) to d): a) The method comprises the following steps A protein consisting of an amino acid sequence shown in SEQ ID No. 1; b) The method comprises the following steps A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO.1, is related to plant anthocyanin synthesis and is derived from SEQ ID NO. 1; c) The method comprises the following steps A protein having 80% homology or more with the amino acid sequence defined in a) or b) and having the same function; d) The method comprises the following steps A fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of a protein defined in any one of a) to C).

The sequence shown in SEQ ID NO.1 of the invention is specifically as follows: <xnotran> MGFLSATKIKSSDVRRGAWSKEEDELLRKCIEKYGEGKWSSVPKRAGLKRCRKSCRLRWLNYLSPAIHRGSFNDDEIDLIIRLHKLLGNRWSLIAGRIPGRTANDIKNFWNSHLSKKKLNAKDEKKEIKAGIVKPQPRRVCKSWRWSENESSLQHQGPIDQATKLPNMDNVEHGEEWLSDLIAPHELNPQSENIIRSLDFHFNYEMEEIMDEAMFMGGIKEWEKLLQGSVCLD. </xnotran> The transcription factor LrPAP1 belongs to an R2R3-MYB transcription factor, and is preferably separated and identified from Lycoris radiata (L' her.) Herb. The transcription factor LrPAP1 has an R2R3 binding domain, is a MYB transcription factor of an R2R3-MYB class, and has an essential motif which is combined with a bHLH transcription factor, and the essential motif is preferably [ D/E ]]LX ₂ [R/K]X ₃ LX ₆ LX ₃ And R is shown in the specification. The transcription factor LrPAP1 and the bHLH transcription factor are combined to form an MBW protein complex, so that the transcription of structural genes of an anthocyanin synthesis pathway is regulated and activated, and the synthesis of anthocyanin is promoted.

The invention also provides an LrPAP1 gene for coding the transcription factor LrPAP1 in the technical scheme, wherein the LrPAP1 gene is a DNA molecule shown in any one of the following I) to III): i) a DNA molecule consisting of the nucleotide shown in SEQ ID NO. 2; II) DNA molecules which are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to the DNA sequences defined under I) and which code for the proteins mentioned above; III) DNA molecules which hybridize under stringent conditions with the DNA sequences defined under I) or II) and which code for the proteins mentioned.

The nucleotide sequence shown in SEQ ID NO.2 of the invention is specifically as follows: <xnotran> 5'-ATGGGGTTCCTTTCGGCCACCAAAATAAAATCTTCGGATGTTCGAAGAGGGGCTTGGAGTAAAGAAGAAGATGAGCTTCTTCGAAAGTGCATTGAGAAGTATGGCGAAGGAAAGTGGAGCTCGGTACCCAAGAGAGCAGGCCTCAAAAGATGCCGAAAGAGTTGTCGCCTCCGGTGGTTGAACTATCTTTCCCCTGCCATACATCGCGGCAGTTTCAACGACGATGAAATCGACCTCATCATTAGGCTTCACAAGCTCTTAGGTAACAGGTGGTCGCTAATTGCAGGCAGAATTCCAGGCAGGACGGCAAATGACATTAAGAACTTTTGGAACTCTCACTTGAGTAAGAAAAAATTGAATGCGAAAGATGAGAAAAAAGAAATCAAAGCCGGAATTGTTAAGCCACAACCTCGGAGAGTTTGCAAGAGTTGGAGGTGGTCAGAAAATGAAAGCAGTTTGCAGCACCAAGGACCGATAGACCAAGCGACAAAACTACCGAATATGGACAATGTTGAGCATGGAGAGGAATGGTTGAGTGATTTAATTGCTCCTCATGAATTAAACCCTCAAAGTGAGAATATTATTAGATCTTTGGATTTCCATTTTAATTATGAAATGGAGGAAATCATGGATGAGGCAATGTTTATGGGAGGGATTAAAGAATGGGAGAAACTACTACAAGGCTCTGTTTGTTTAGATTGA-3'. </xnotran>

In the present invention, the DNA molecule which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the nucleotide sequence shown in SEQ ID NO.2 and encodes the transcription factor LrPAP1 is identical to the sequence of the LrPAP1 gene in the present invention by means of conventional techniques in the art, such as point mutation, directed evolution or artificial modification.

The invention also provides an expression vector which comprises the LrPAP1 gene in the technical scheme. The initial vector for preparing the expression vector is preferably any one plant expression vector, more preferably a Gateway system vector or a binary agrobacterium vector, more preferably a Gateway system vector, particularly preferably pMDC83, pMDC32, pMDC99 or pMDC107, more preferably pMDC83. pMDC83 described in the present invention is preferably used for overexpression, forming the pMDC83-LrPAP1 expression vector. The pMDC83-LrPAP1 expression vector can express the LrPAP1 transcription factor shown in SEQ ID NO. 1. When the expression vector is constructed, any one of an enhanced promoter, a constitutive promoter, a tissue-specific promoter or an inducible promoter is preferably added in front of the transcription initiation nucleotide of the plant expression vector. In order to facilitate the identification and screening of transgenic plant cells or plants, the present invention preferably further comprises adding a selectable marker gene, an antibiotic marker or an anti-chemical agent marker gene that can be expressed in plants when constructing the expression vector; the selectable marker gene preferably comprises a GUS gene or a luciferase gene; the antibiotic marker preferably comprises a gentamicin marker, a kanamycin marker, or a hygromycin marker; the chemical marker resistance gene preferably comprises an herbicide resistance gene. The present invention preferably also includes direct stress screening of transformed plants to circumvent the safety problems of transgenic plants with selectable marker genes. The present invention has no special limitation on the specific construction process of constructing the expression vector, and can be constructed by adopting the construction process of the conventional expression vector in the field.

The invention also provides a cell line, which comprises the LrPAP1 gene in the technical scheme. The cell line of the present invention is preferably a transgenic plant cell line, and the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

The invention also provides an engineering bacterium, which comprises the LrPAP1 gene in the technical scheme. The engineering bacteria are preferably obtained by transferring the expression vector in the technical scheme into a strain; the strain preferably comprises a fungus or a bacterium, further comprising a bacterium, more preferably comprising agrobacterium tumefaciens, most preferably agrobacterium tumefaciens EHA105.

The invention also provides application of the transcription factor LrPAP1 or LrPAP1 gene or expression vector or cell line or engineering bacterium in any one or more of A) -D) in the technical scheme. A) Promoting anthocyanin synthesis in plants; b) Promoting synthesis and/or accumulation of anthocyanin in plant leaves and/or petals; c) Auxiliary cultivation of plant varieties with high anthocyanin content; d) And (5) flower color breeding. The plant of the present invention preferably comprises lycoris radiata and/or tobacco, and more preferably lycoris radiata and tobacco. The invention preferably promotes the synthesis and/or accumulation of anthocyanin in plants by increasing the content of the transcription factor LrPAP1 in target plants or increasing the expression level of the LrPAP1 gene in target plants.

The invention also provides a method for cultivating the plant with high anthocyanin content, which comprises the following steps: increasing the content of a transcription factor LrPAP1 in a target plant or promoting the expression of the LrPAP1 gene in the target plant to obtain the plant with high anthocyanin content. The invention preferably obtains the plant with high anthocyanin content by introducing the LrPAP1 gene into a target plant. The LrPAP1 gene is preferably transferred into a target plant in the form of an expression vector. The present invention preferably transforms plant cells or tissues by using Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation or agrobacterium-mediated biological methods to transform expression vectors carrying the LrPAP1 gene.

In order to further illustrate the present invention, the following detailed description of the technical solutions provided by the present invention is made with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

In the following examples of the present invention, if not particularly limited, all the test methods used are conventional in the art, and all the reagents used are available from conventional commercial sources.

Example 1

Cloning of LrPAP1 Gene

The early flowering stage of lycoris radiata is light red (FB stage), the color of lycoris radiata begins to deepen into bright red (accumulation of a large amount of anthocyanin, FL-1 stage) when lycoris radiata is half-opened, the anthocyanin is reduced to some extent when lycoris radiata is fully opened, but the flower color is still red (FL-2 stage), and the flower color begins to turn into light red when lycoris radiata is fully opened to the late stage, and the anthocyanin is reduced (R stage). And respectively carrying out reference-free transcriptome sequencing on the lycoris radiate at four stages (the reference-free transcriptome sequencing is carried out by Shanghai Europe and Yi biomedicine science and technology limited company) to obtain the differential expression gene LrPAP1, wherein the sequence is shown as SEQ ID NO. 2.

Bulbus Lycoridis Radiatae petals are taken and put in liquid nitrogen for grinding, and RNA Extraction is carried out according to RNA Plant Extraction kit DP417 of TIANGEN total RNA Extraction kit. First strand cDNA Synthesis was performed according to TaKaRa reagent Kit TaKaRa PrimeScript TM 1st strand cDNA Synthesis Kit D6110A, as described in detail in the description.

The obtained cDNA fragment was used as a template, and PCR amplification reaction was carried out using the LrPAP1 gene ORF primer set. Wherein the sequences of the primer pairs of the ORF of the LrPAP1 gene are as follows:

ORF forward primer of LrPAP1 gene: 5 'ATGAAAATAATCTTCGGATGTTC-3' (SEQ ID NO. 3), the reverse primer of ORF of LrPAP1 gene: 5 'TCAATCTAAACAAACAGAGCC-3' (SEQ ID NO. 4);

the 50 μ LPCR reaction system was: mu.L of first strand cDNA (0.05. Mu.g), 1.6. Mu.L of primers (SEQ ID NO.3 and SEQ ID NO.4 mixed in equal amounts, 5. Mu.M), 5. Mu.L of 10 XPCR buffer, 4. Mu.L of Mg ²⁺ mu.L dNTP and 1.25U ExTaq DNA polymerase, and make up to 50. Mu.L with ultrapure water. The reaction was carried out on a BIO-RAD PTC-200 type PCR instrument programmed for denaturation at 95 ℃ for 5min; then denaturation at 94 ℃ for 30sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 2min for 35 cycles; then extending for 10min at 72 ℃; storing at 4 ℃. After the PCR product is recovered, the PCR product is connected with a pMD19-T vector (TaKaRa), transformed escherichia coli DH5 alpha, screened with blue white spots, shaken, sequenced and analyzed in sequence, and the PCR product has a nucleotide sequence of SEQ ID NO.2 in a sequence table and is named as LrPAP1. An Open Reading Frame (ORF) is predicted to be 702bp (figure 1) through NCBI, 233 amino acids are coded, the amino acid sequence is shown as SEQ ID NO.1, the theoretical molecular weight is 27.07kD, and the theoretical isoelectric point is 9.02.

The 233 amino acids (marked as transcription factor LrPAP 1) coded by the cDNA sequence of the LrPAP1 gene obtained by amplification are compared with the amino acid sequences of other R2R3-MYB transcription factors by DNAMAN software, and the amino acid sequences have an R2R3 binding structural domain (figure 2), which indicates that the transcription factor LrPAP1 is a MYB transcription factor of an R2R3-MYB class, and the transcription factor LrPAP1 has an essential motif combined with a bHLH transcription factor: [ D/E ]]LX ₂ [R/K]X ₃ LX ₆ LX ₃ R。

Example 2

Expression analysis of LrPAP1 Gene

The method comprises the steps of taking 4 lycoris petal materials in different flowering stages, namely a FB stage, an FL-1 stage, an FL-2 stage and an R stage, and simultaneously selecting different tissues of lycoris as samples, wherein the tissues comprise roots, bulbs, stems, stamens, pistils, pedicels, petals and leaves. And (3) performing Real-time PCR expression analysis on the LrPAP1 gene by using the above 4 Lycoris radiata petal samples in different flowering periods and cDNA of different Lycoris radiata tissues as templates. Real-time PCR was performed according to the SYBR Premix Ex TMTaq II kit from TAKARA.

The reaction system is as follows: SYBR Mix 12.5. Mu.L, forward and reverse primers 1. Mu.L each, template 1. Mu.L, sterile distilled water to make up to 25. Mu.L. The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and 40 cycles; extension at 72 ℃ for 5min. The forward primer of the LrPAP1 gene is 5. TIP41 is used as an internal reference gene, the TIP41 forward primer of the internal reference gene is 5-. The PCR reaction was performed on an iCycler iQ5 Real-time PCR instrument from Bio-Rad. By 2 ^-△△Ct The method normalizes the relative expression of the LrPAP1 gene in different samples.

The expression patterns of the LrPAP1 gene in the lycoris radiata petals in 4 different flowering periods are detected, and the result shows that the expression level of the gene in the petals in the FL-1 period is obviously higher than that in other periods (figure 3). Further detecting the expression patterns of the LrPAP1 gene in different tissues of the lycoris radiata, the LrPAP1 gene has the highest expression in the lycoris radiata petals (figure 4), which shows that the content of the anthocyanin in the lycoris radiata petals can be improved by the high expression of the LrPAP1 gene in the lycoris radiata petals.

Example 3

Construction of LrPAP1 Gene expression vector

Using the Technology with clone TM II kit from Invitrogen, the LrPAP1 gene was inserted forward between the enzyme cleavage sites attR1 and attR2 of the expression vector pMDC83 (FIG. 5), E.coli DH 5. Alpha. Was transformed, and the transformation solution was plated on LB solid medium containing 50mg/L kanamycin to screen for positive clones. After sequencing verification, plasmids were extracted to obtain pMDC83-LrPAP1 plant overexpression vector (FIG. 6). pMDC83-LrPAP1 was transferred into Agrobacterium tumefaciens strain EHA105 (Biovector Co., LTD) by heat shock method.

Example 4

Overexpression of the LrPAP1 Gene in tobacco and Lycoris longitaba petals

The agrobacterium containing the recombinant plant expression vector pMDC83-LrPAP1 is streaked and cultured on a YEB plate (containing 50mg/L Kan and 50mg/L Rif) and is placed at the temperature of 28 ℃ for 48 hours; selecting a single clone, and culturing in 5mLYEB liquid culture medium (added with 50mg/L Kan and 50 mg/Rif antibiotics) at 28 deg.C and 220rpm/min for 24h; transferring 5mL of the bacterial liquid to 50mL of fresh YEB liquid culture medium, and continuously culturing at 28 ℃ and 220rpm/min until the bacterial liquid OD ₆₀₀ Reaching about 0.6. Transferring 50mL of the bacterial solution into a centrifuge tube, centrifuging at 6000r/min for 10min at room temperature, collecting the precipitate, and resuspending in a buffer (10mM MES,10mM MgCl) ₂ 20 μ MAS), adjusting OD ₆₀₀ Standing at room temperature for 2h to 0.5 to obtain a re-suspension. The resuspension solution was injected with 0.5ml into tobacco leaves (grown for about 4 weeks) and lycoris petals, and cultured in a dark room for 12h with pMDC83 empty vector as negative Control (CK), and then transferred to 24 ℃,16h light and 8h dark photoperiod for culture.

Identifying the content and phenotype of anthocyanin in the tobacco leaves over-expressing the LrPAP1 gene, wherein the identification time of anthocyanin content and phenotype is 5 days after the tobacco leaves are injected, the result is shown in figure 8, the left half part of the left graph in figure 8 is the phenotype after the leaves are injected with pMDC83 empty vector, and the right half part of the left graph is the phenotype after the leaves are injected with pMDC83-LrPAP1 and are anthocyanin stained; the right panel shows the anthocyanin content in tobacco leaves overexpressing the LrPAP1 gene.

As can be seen from figure 8, after the LrPAP1 gene is over-expressed in tobacco leaves, the content of anthocyanin in the leaves can be increased, and the accumulation of anthocyanin in the leaves can be promoted, thereby indicating that the LrPAP1 can promote the synthesis of tobacco anthocyanin.

Collecting lycoris radiata petal samples after overexpression of LrPAP1 gene, and performing phenotype and anthocyanin content on lycoris radiata petalsAnd identifying, wherein the identification time is 5 days after the lycoris radiata petal is injected. Measuring the content of anthocyanin by spectrophotometry: about 0.5g of sample is mixed with 10mL of methanol hydrochloric acid solution (methanol and 0.05mol/L hydrochloric acid are mixed according to the proportion of 85. Transferring the extract to another 15mL centrifuge tube, adding 5mL methanol hydrochloric acid solution into the filter residue, carrying out water bath at 50 ℃ for 2h, and combining the extract for 2 times. Centrifuging the extracting solution at 7000r/min for 10 minutes, collecting supernatant, and fixing the volume to 25mL. The supernatant was filtered through a syringe filter (0.45 μm) and used as an experimental sample. 1mL of each sample was diluted with 3mL of a 0.025mol/L KCl-HCl solution (pH 1.0) and 3mL of a 0.4mol/L sodium acetate solution (pH 4.5), respectively, and then subjected to a color reaction for 30min. Respectively measuring absorbance of KCl-HCl solution diluted sample at 530nm and absorbance of sodium acetate solution diluted sample at 657nm, and calculating anthocyanin content Q _Anthocyanins ＝(A ₅₃₀ –0.25A ₆₅₇ )FW ^-1 The phenotype result of the lycoris radiata petals is shown in figure 7-1, and the result of the anthocyanin content in the lycoris radiata petals is shown in figure 7-2, wherein the CK group petals are empty vector transferring petals, and the OE-LrPAP1 is petals which excessively express the LrPAP1 gene. As can be seen from the figure 7-1, the overexpression of the LrPAP1 gene can change the color of the lycoris plant petals from white to red, and as can be seen from the figure 7-2, the LrPAP1 gene can be excessively expressed in the lycoris petals to improve the content of anthocyanin in the petals and promote the accumulation of anthocyanin in the petals, so that the LrPAP1 can promote the synthesis of lycoris anthocyanin.

When the lycoris radiata petals are injected for 5 days, the expression pattern of the anthocyanin synthesis related gene in the lycoris radiata petals which excessively express the LrPAP1 gene is analyzed, and a sample is collected. Extracting total RNA of lycoris petal by using petals injected with pMDC83 empty vector as a control, and detecting the expression of anthocyanin synthesis related genes by using Real-time PCR technology. The related genes comprise structural genes CHS, CHI, F3H-1, F3H-2, F3' H, DFR1, ANS, UFGT and 3RT in the lycoris radiata petals, corresponding primer pairs for expression pattern analysis are as follows, the primer pairs are designed according to the sequencing data of the lycoris radiata transcriptome, and the log-in website of the transcriptome data is as follows: national genome science Data center CRA004779 (the National Genomics Data Center (NGDC) database CRA004779 (b:)https://ngdc.cncb.ac.cn/)。

CHS forward primer 5 'ACCAAGCGAATACCCCCGAT-3' (SEQ ID NO. 9);

CHS reverse primer 5 'CGCTCATGTTGGGTTCTCT-3' (SEQ ID NO. 10);

CHI forward primer 5 'TCCCCGTTCCTCCTCCATTCTCTCTCT-3' (SEQ ID NO. 11);

CHI reverse primer 5 'TTAGCAGCAGGCGATACACC-3' (SEQ ID NO. 12);

F3H-1 forward primer 5 'TGATCCCACTCGGTCTGA-3' (SEQ ID NO. 13);

F3H-1 reverse primer 5 'TCTTTCCACCGTCCTTGGTGGTG-3' (SEQ ID NO. 14);

F3H-2 forward primer 5-;

F3H-2 reverse primer 5 'CCATGTCCAACTTCCGCT-3' (SEQ ID NO. 16);

f3' H forward primer 5-;

f3' H reverse primer 5-;

DFR1 forward primer 5;

DFR1 reverse primer 5 'TTCCCATGCAGGCCTTCTTCTG-3' (SEQ ID NO. 20);

ANS forward primer 5;

ANS reverse primer 5 'ATGCTGTGCAAAAGTGCGAG-3' (SEQ ID NO. 22);

UFGT forward primer 5 'TTATGGCGGACCAGACGATG-3' (SEQ ID NO. 23);

UFGT reverse primer 5 'TCCTCGTCCTTCATCACCCT-3' (SEQ ID NO. 24);

3RT forward primer 5 'AAAGGATGGGTCCCGCAAAT-3' (SEQ ID NO. 25);

3RT reverse primer 5 'ACTGCAGGCTCTCAATGACC-3' (SEQ ID NO. 26).

The PCR reaction was performed on an iCycler iQ5 Real-time PCR instrument from Bio-Rad. By 2 ^-△△Ct The relative expression of genes in different samples was normalized by the method, and the results are shown in FIG. 9.

As can be seen from FIG. 7, the expression level of the gene in the lycoris radiata petals injected with the LrPAP1 gene is higher than that of the petals injected with only the pMDC83 empty vector. The expression level of structural genes CHS, CHI, F3H-1, F3H-2, F3' H, DFR1, ANS, UFGT and 3RT in lycoris radiata petals injected with LrPAP1 gene is obviously higher than that of petals injected with pMDC83 empty vector (CK, the relative expression level value is 1) alone (figure 9).

The results show that the LrPAP1 gene enhances the expression level of the lycoris radiata petal structural genes CHS, CHI, F3H-1, F3' H, DFR1, ANS, UFGT and 3RT, thereby promoting the synthesis and accumulation of the lycoris radiata petal anthocyanin.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Claims (9)

1. A transcription factor LrPAP1 for regulating and controlling plant anthocyanin synthesis, wherein the transcription factor LrPAP1 is a protein shown in any one of a) to d):

a) The method comprises the following steps A protein consisting of an amino acid sequence shown in SEQ ID No. 1;

b) The method comprises the following steps A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO.1 and has the same function;

c) The method comprises the following steps Protein with 80% homology or more with the amino acid sequence defined by a) or b) and with the same function;

d) The method comprises the following steps A fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of a protein defined in any one of a) to C).

2. An LrPAP1 gene encoding the transcription factor LrPAP1 according to claim 1, wherein the LrPAP1 gene is a DNA molecule represented by any one of the following I) to III):

i) a DNA molecule consisting of the nucleotide shown in SEQ ID NO. 2;

II) DNA molecules which are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to the DNA sequences defined under I) and which code for the proteins mentioned above;

III) DNA molecules which hybridize under stringent conditions with the DNA sequences defined under I) or II) and which code for the proteins mentioned.

3. An expression vector comprising the LrPAP1 gene according to claim 2.

4. A cell line comprising the LrPAP1 gene of claim 2.

5. An engineered bacterium comprising the LrPAP1 gene according to claim 2.

6. Use of the transcription factor LrPAP1 according to claim 1, or the LrPAP1 gene according to claim 2, or the expression vector according to claim 3, or the cell line according to claim 4, or the engineered bacterium according to claim 5 in any one or more of the following A) to D):

a) Promoting anthocyanin synthesis in plants;

b) Promoting synthesis and/or accumulation of anthocyanin in plant leaves and/or petals;

c) The method comprises the following steps of (1) assisting in cultivating a plant variety with high anthocyanin content;

d) And (5) flower color breeding.

7. Use according to claim 6, wherein the plant comprises lycoris radiata and/or tobacco.

8. The use according to claim 6 or 7, wherein the synthesis and/or accumulation of anthocyanin in plants is promoted by increasing the content of the transcription factor LrPAP1 in target plants or increasing the expression level of the LrPAP1 gene in target plants.

9. A method of growing plants with high anthocyanin content, comprising: increasing the content of transcription factor LrPAP1 in the target plant or promoting the expression of the LrPAP1 gene in the target plant to obtain the plant with high anthocyanin content.

Images