CN115708871A

CN115708871A - Novel synthetic biology self-assembly vaccine production system and method for producing vaccine

Info

Publication number: CN115708871A
Application number: CN202210975450.7A
Authority: CN
Inventors: 张辰宇; 陈熹; 詹守斌; 徐蕊; 周圣凯; 许烨
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2021-08-13
Filing date: 2022-08-15
Publication date: 2023-02-24

Abstract

The present invention relates to a novel synthetic biological self-assembling vaccine production system and a method for producing a vaccine, the system comprising a base sequence module capable of expressing an antigen and a base sequence segment of CD63 capable of anchoring the antigen on the surface of vesicles and self-assembling into a vesicle complex, the system being a sequence capable of enriching in an organism/host tissue organ and expressing the antigen on the surface of vesicles and self-assembling into a vesicle complex, the vesicle complex being capable of eliciting an immune response. The system has the advantages of low production cost, stable physicochemical property, efficient antigen assembly and secretion process, quick response to pathogen mutation, strong induced immune response, high safety, high protectiveness and the like, and provides a brand-new vaccine type.

Description

Novel synthetic biology self-assembly vaccine production system and method for producing vaccine

Technical Field

The invention relates to the technical field of biological medicines, in particular to a synthetic biological self-assembly vaccine generation system, a vaccine, a vector system and a method for generating the vaccine, which are used for developing a brand new vaccine.

Background

The vaccine is a biological product which is made of various pathogenic microorganisms and is used for vaccination, and for the general public and families, the vaccination is the most economical and effective way for preventing and controlling diseases, and can reduce the occurrence of the diseases and the medical expenses.

At present, the types of vaccines are many, and the vaccines mainly include inactivated vaccines, attenuated live vaccines, subunit vaccines, nucleic acid vaccines, virus vector vaccines and the like. However, these vaccines have more or less some disadvantages for different diseases. For example, inactivated vaccines have the disadvantage of not being able to respond rapidly to antigenic variations represented by RNA viruses, and once key viral immune recognition sites are mutated, antibodies generated by inactivated vaccines are prone to failure. The strain selected by the attenuated live vaccine is live, is safe and is not easy to be accepted by the public. The sequence of the nucleic acid vaccine is flexible and editable, but the nucleic acid vaccine is easy to degrade in vivo sometimes, and also puts higher requirements on the conditions of transportation and storage, and the vaccine needs to be synthesized in vitro, and the cost is relatively high. The production cost of the virus vector vaccines is high, and the effect of the virus vaccines represented by the adenovirus vector vaccines can be weakened due to the pre-immunization phenomenon existing in the body. Moreover, the vaccine has the problems of difficult development, long response and development period and high cost.

Thus, if a new vaccine type could be developed, it would be a significant revolution in the art that would bring many new advantages and new hopes.

Exosomes are vesicles with a double-layer membrane structure and the diameter of 50-200nm, almost all cells can secrete exosomes, and multiple studies show that exosomes play an important role in intercellular communication. The group of applicants and inventors has been leading in research on exosomes, and there are also many results of research. In a recent related research, it was found that in vivo delivery of editable gene modules, using self-assembly of organism tissues or organs, can display specific polypeptides/proteins on the surface of exosomes and can be transported to major tissues and organs of the whole body through the circulatory system. Based on the above information, the present inventors developed a novel vaccine type, which is expected to be a novel vaccine with excellent application prospects by using an in vivo and in vitro exosome self-assembly method of a relevant base sequence such as a gene assembly, and presenting an antigen and initiating an immune response by using exosomes to achieve in vivo immunity.

In the prior research process, the transmembrane protein in the system mainly uses lamp2b, however, lamp2b cannot efficiently display large-volume protein/antigen at the N-terminal thereof due to the structural limitation, so that the defect of seeking other transmembrane proteins is needed. Moreover, the use of only lamp2b may sometimes have problems of poor source, high cost, etc., and in order to find a better transmembrane protein for the present technology, the present inventors have tried various transmembrane proteins and products with similar functions, and finally found that CD63 has similar effects to lamp2b in various aspects or dimensions, even better than lamp2b. The CD63 can be compatible with the display of large-volume protein through two transmembrane domains, and has good effect, so that the team also has a very surprised result, the discovery has extremely important significance for further research in the later period, and the variety selection of transmembrane protein can be increased, thereby being beneficial to subsequent research and development and commercialization.

Disclosure of Invention

The invention provides a synthetic biology self-assembly vaccine production system and a method for producing a vaccine aiming at overcoming the defects in the prior art.

The purpose of the invention is realized by the following technical scheme:

one aspect of the present invention is to provide a novel synthetic biological self-assembly vaccine production system, which is a sequence that can be enriched in the tissues and organs of an organism and express antigens on the surface of vesicles and self-assemble into vesicle complexes that can elicit immune response; the system comprises a base sequence module capable of expressing an antigen and a base sequence segment of CD63 capable of anchoring the antigen on the surface of a vesicle and self-assembling to form a vesicle complex.

Further, the base sequence module is an editable or synthesizable gene module.

The antigen includes, but is not limited to tuberculosis antigen, hepatitis A antigen, hepatitis B antigen, measles antigen, poliomyelitis antigen, pertussis antigen, diphtheria antigen, tetanus antigen, rabies antigen, influenza antigen, pneumonia antigen, varicella antigen, rotavirus antigen, hand-foot-and-mouth disease antigen, meningitis antigen, epidemic encephalitis B antigen, pneumonia antigen, new crown virus antigen, HPV antigen, mumps antigen, rubella antigen, tumor antigen or antigen of the above disease mutant, correspondingly, the base sequence assembly also includes a base sequence capable of expressing, but not limited to, the aforementioned antigens.

Further, in the vesicle complex, the antigen is linked to the outer surface of the vesicle through the CD63, preferably, the CD63 is linked to the surface of the vesicle through two transmembrane domains.

Further, the base sequence module is inserted into the base sequence fragment of the CD 63;

further, the base sequence module is inserted between any two bases of 20 th to 60 th at the nitrogen terminal of CD 63.

Further, the nucleotide sequence set is inserted between GG in 20 th to 60 th of the nitrogen terminal of CD63, and the nucleotide sequence set divides the CD63 into two parts, that is, a nitrogen terminal sequence containing the nitrogen terminal of CD63 and a carbon terminal sequence containing the carbon terminal of CD 63.

Further, the nitrogen terminal sequence includes its own sequence or a sequence 70% or more homologous to its own sequence;

the carbon terminal sequence is a sequence comprising the carbon terminal sequence or a sequence which is 70% homologous with the carbon terminal sequence;

the above-mentioned homologous sequences include those obtained by adding one or more bases to the original sequence, subtracting one or more bases, and replacing any one or more bases;

further, the nitrogen terminal sequence is connected with the base sequence module through a first connecting sequence;

preferably, the first connecting sequence is AGATCTCTAGCCACC or a sequence obtained by adding, reducing or replacing any 1-4 bases in the sequence.

Further, the base sequence module is connected with the carbon terminal sequence through a second connecting sequence;

furthermore, the second connecting sequence is ACCGGTGGAGCTCGAATCATCAGATCT or a sequence obtained by adding, reducing or replacing any 1-6 bases in the sequence.

Further, the vaccine production system further comprises a promoter located upstream; preferably, the promoter is disposed upstream of the nitrogen-terminal sequence.

Further, the vaccine production system further comprises a termination signal located downstream; preferably, the termination signal is located downstream of the carbon-terminal sequence.

Further, any one or several bases in the system are independently a modified base or an unmodified base; wherein the modification comprises thio modification, fluoro modification, amino modification and methoxy modification;

preferably, the tissue organ includes all cells, tissues and organs of an organism, including but not limited to blood, muscle, liver, spleen, lung, stomach, intestine, gallbladder, pancreas, brain, heart, kidney, etc., the vesicle is an exosome, and the vesicle complex is an exosome complex.

Further, the system also comprises a carrier capable of carrying or carrying the system. Such vectors include, but are not limited to, plasmids and viruses.

In another aspect, the invention provides a method for producing a vaccine by biological self-assembly, the method comprising constructing a system as described in any of the above paragraphs, the system being a sequence capable of enriching in cells, tissues and/or organs of an organism and expressing an antigen on the surface of vesicles and self-assembling into vesicle complexes, the vesicle complexes being vaccines capable of eliciting an immune response. Specifically, the base sequence modules are synthesized and then integrated with other sequences as described herein.

It is also an aspect of the present invention to provide a vaccine comprising a system as described in any of the preceding paragraphs.

Further, the vaccine can be administered by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection.

The vaccine types include, but are not limited to, bcg vaccine, hepatitis a vaccine, hepatitis b vaccine, measles vaccine, polio vaccine, diphtheria vaccine, tetanus vaccine, rabies vaccine, influenza vaccine, pneumonia vaccine, varicella vaccine, rotavirus vaccine, hand-foot-and-mouth disease vaccine, meningitis vaccine, epidemic encephalitis b, pneumonia vaccine, tuberculosis vaccine, new crown virus vaccine, HPV vaccine, tumor vaccine, mumps vaccine, rubella.

The invention has the following main beneficial effects:

the invention surprisingly develops the technology of taking CD63 as a transmembrane protein and applying the transmembrane protein in the vaccine production system, wherein the CD63 can excellently help the antigen to be anchored on the surface of a vesicle and self-assemble to form a vesicle complex which carries the antigen on the surface of the complex for systemic delivery, so that a specific immune response is caused and antibodies are produced. The CD63 is surprisingly used, so that the transmembrane protein of the system has more diversified selections, is favorable for subsequent productization, and has extremely important significance for further research or breakthrough in the later period of the team. More importantly, the CD63 and the exosome have two transmembrane domains, so that the combination is firmer, the display of large-volume protein can be compatible, and the effect is good.

For the CD63 gene line or gene loop protected in the application, after the CD63 gene line or gene loop is introduced into a human body or other cells, the CD63 gene line or gene loop can correctly and efficiently express the antigen of a corresponding gene component, can be anchored or enriched to the surface of a vesicle (namely an exosome), and has high antigen content on the surface of the exosome. And high titers of antibodies can be detected in blood or serum. And the antibody with a considerable titer can be generated by using few antigens, the side effect caused by the antibody is smaller, the induced antibody can exist for a long time, and the stability is high and even higher than that of some current commercial vaccines.

In the system, according to the requirements of different diseases, a corresponding base sequence component (such as a gene component) is selected and connected with related genes such as CD63 and the like, and the base sequence component is synthesized in vitro.

The system of the invention can be self-assembled into vesicle complex, is not artificially synthesized, and the vesicle complex can be transported to main tissues, organs and the like of the whole body through a circulatory system and then realize the immunity of related diseases under the original action of the base sequence components, so the antigen assembly and secretion process is efficient, the induced immune response is strong, and the safety and the protection are high. And avoids some toxic and side effects in the prior art.

The base sequence modules in the system have high editability, can quickly respond and edit to a certain disease or any mutation thereof, and can have higher or faster response and quick response even if the disease is variant or sudden. Therefore, it can avoid the shortage that the vaccine is disabled due to mutation of a certain disease and the like, and the new vaccine needs to be researched again for a long period.

The system and the method have good overall effect, are a brand-new vaccine and a vaccine synthesis method, are great breakthroughs in the biological and medical fields, and have milestone significance.

Drawings

FIG. 1 is a schematic diagram of the principle of plasmid delivery and action in vivo according to an embodiment of the present invention.

FIG. 2 is a schematic diagram of the structure of the binding of an exosome transmembrane protein to an antigen according to the example of the present invention.

FIG. 3 is a diagram showing the effect of the insertion position of the nucleotide sequence module on the antigen expression according to the embodiment of the present invention.

FIG. 4 is a diagram showing the effect of Linker sequence changes on antigen expression according to an embodiment of the present invention.

FIG. 5 is a schematic diagram of a plasmid map containing a promoter and a termination signal according to an embodiment of the present invention.

FIG. 6 is a graph showing the distribution of RBD antigen expression in different tissues according to the embodiment of the present invention.

FIG. 7 is a graph showing the effect of different vectors on antigen expression according to the present invention; wherein FIG. 7A is the result of in vitro cell assay and FIG. 7B is the result of in vivo assay in mice.

FIG. 8 is a schematic diagram of the result of detecting the antibody titer of the hepatitis B vaccine according to the embodiment of the present invention.

FIG. 9 is a schematic diagram of the detection result of the human papillomavirus vaccine antibody titer according to the embodiment of the invention.

FIG. 10 is a schematic diagram of the detection result of the antibody titer of the influenza A H1N1 vaccine according to the embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below with reference to specific embodiments of the present invention, and it is obvious that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the present invention, the upstream means a 5 'end and the downstream means a 3' end.

Example 1

A novel synthetic biological self-assembly vaccine production system, which is a sequence capable of enriching in the organism's tissue and organs and expressing antigens on the surface of exosomes and self-assembling into exosome complexes capable of eliciting immune response responses; the system comprises a gene component capable of expressing an antigen and a base sequence fragment of CD63 capable of anchoring the antigen on the surface of an exosome and self-assembling to form an exosome complex, the gene component being an editable or a synthetic gene component.

The antigens include, but are not limited to tuberculosis antigen, hepatitis A antigen, hepatitis B antigen, measles antigen, poliomyelitis antigen, diphtheria antigen, tetanus antigen, rabies antigen, influenza antigen, pneumonia antigen, varicella antigen, rotavirus antigen, hand-foot-and-mouth disease antigen, meningitis antigen, epidemic encephalitis antigen, pneumonia antigen, new crown virus antigen, HPV antigen, mumps antigen, tumor antigen, rubella antigen or antigen of mutant of the above diseases, and correspondingly, the gene module also includes base sequences capable of expressing the aforementioned antigens, and the base sequences include sequences expressing the antigens and sequences 70% or more homologous to the expressed antigen sequence, such as 70%, 75%, 80%, 85%, 90%, 95%, and the like, and then some mutants can be included.

In a further preferred embodiment, CD63 is a transmembrane protein, and the genetic module is inserted into the base sequence fragment of CD63, so that the expression can be better realized, and after the expression, the antigen can be better connected to the surface of an exosome through CD 63. There are 2 two transmembrane domains between the CD63 and the exosomes, so their binding is stronger.

In a further preferred embodiment, the gene module is inserted between any two bases of 20 th to 60 th at the nitrogen terminus of CD 63. Preferably, the gene module is inserted between GG in 20 th to 60 th of the nitrogen terminal of CD 63.

In a further preferred embodiment, the gene module divides the CD63 into two parts, namely a nitrogen terminal sequence containing the nitrogen terminal (i.e., 5 'terminal) of the CD63 and a carbon terminal sequence containing the carbon terminal (i.e., 3' terminal) of the CD63, and the gene module is located between the nitrogen terminal sequence and the carbon terminal sequence, and preferably, the gene module is inserted between any two bases in the 30 th to 45 th bases of the nitrogen terminal of the CD 63.

The effect of the position of insertion of the base sequence module on the expression of the antigen is shown in FIG. 3. As can be seen from the results of FIG. 3, within the range defined in this example, the insertion positions of the base sequence modules are within the 30 th to 45 th positions of the nitrogen terminal of CD63 (32 aa, 34aa, 36aa and 40aa are selected for detection), which can effectively generate antigen expression, and the effect is not very different, wherein the optimal expression level of the neo-corona RBD antigen is 36aa.

In a further preferred embodiment, when the gene module is inserted between 36 th to 37 th bases of the nitrogen terminal of CD63, the nitrogen terminal sequence is a sequence containing seq1 or a sequence 70% or more homologous to the seq1 sequence; the carbon terminal sequence is a sequence containing seq2 or a sequence which is 70% homologous with the seq2 sequence;

sequences more than 70% homologous to the above, such as 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, etc.; these homologous sequences include sequences obtained by adding one or more bases to the original sequence (seq 1 or seq 2), subtracting one or more bases, and replacing any one or more bases; several include numbers of 2 and 2 or more, such as 2, 3, 4, 5, 6, 7, etc. Experiments show that the seq1 or seq2 or homologous sequences thereof are matched with other gene fragments, so that the efficiency is higher, the antigen concentration and the antibody titer are better, the antibody can be equivalent to a mature vaccine in the prior art, the induced vaccine has better stability and can exist for a long time, and therefore, the sequence is preferred.

seq1 sequence is: ATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGTTTTTTTGCTCTACGTTCTCCTGCGC CTTCTGCGCCTGTGCAGTGGATTGATGCCATTGGGTGTAGCGGTTCAG.

The sequence of Seq2 is: <xnotran> GTTGTCTTGAAGCAGGCCATTACCCATGAGACTACTGCTGGCTCGCTGTTGCCTGTGGT CATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGTGGGGCCT GCAAGGAGAACTACTGTCTCATGATTACATTTGCCATCTTCCTGTCTCTTATCATGCTTGT GGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACCAGGTGAAGTCAGAGTTTA ATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATT TTGGACAAATTGCAGAAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGG AAAACATCCCCGGCATGGCCAAGGACAGAGTCCCCGATTCTTGCTGCATCAACATAACT GTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCATACCCAGGGCTGCGTGGAGAC TATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCCCTGGGCATTG CTTTTGTGGAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTG GCTATGAAGTAATGTAG. </xnotran>

In a further preferred embodiment, the nitrogen terminal sequence and the gene module are connected through a first connecting sequence, and the first connecting sequence is a linker.

Preferably, the first connecting sequence is AGATCTCTAGCCACC or a sequence obtained by adding, reducing or replacing any 1-4 bases in the sequence, such as adding, reducing or replacing 1, 2, 3 or 4 bases and the like. Through the connection of the first connection sequence or a sequence obtained by adding, reducing or replacing any 1-4 bases on the first connection sequence, the gene structure is stable, the subsequent expression and assembly in vivo are not influenced, if other connectors are replaced, the accurate and efficient assembly and high-titer antibody generation in the application can not be realized, and the connectors and the homologous sequences thereof are obtained by the applicant through specific research and development experiments.

In a further preferred embodiment, the genetic module is linked to the carbon-terminal sequence via a second linker sequence, which is also a linker.

Preferably, the second linking sequence is ACCGGTGGAGCTCGAATCATCAGATCT or a sequence obtained by adding, reducing or replacing any 1-6 bases in the sequence, such as adding, reducing or replacing 1, 2, 3, 4, 5 or 6 bases. Through the second connecting sequence or the sequence obtained by adding, reducing or replacing any 1-6 bases on the second connecting sequence, the gene structure is stable, the subsequent expression and assembly in vivo are not influenced, if other connectors are replaced, the accurate and efficient assembly and high-titer antibody generation in the application can not be realized, and the connectors and the homologous sequences thereof are obtained by the applicant through specific research and development experiments.

The effect of Linker sequence changes on antigen expression is shown in FIG. 4.

As a further preferred embodiment, in said exosome complex, said antigen is attached to the outer surface of said exosome via said CD63, i.e. the part of CD63 located at the outer surface of the exosome is attached to said antigen, thereby immobilizing the antigen on the surface of the exosome via CD 63.

As a further preferred embodiment, the vaccine production system further comprises a promoter located upstream; preferably, the promoter is located upstream of the nitrogen terminal sequence, preferably a CMV promoter.

The sequence of the promoter includes a sequence containing seq3 or a sequence which is 70% or more homologous to the seq3 sequence, such as 70%, 75%, 80%, 85%, 90%, 95% and the like; the homologous sequence comprises a sequence obtained by adding one or more bases on the basis of seq3, reducing one or more bases and replacing any one or more bases; several include numbers of 2 and 2 or more. Although other types of promoters can be selected, it is found through experiments that seq3 or its homologous sequence is matched with other gene segments in the application, so that the efficiency is higher, the antigen concentration and the antibody titer are better, and the antibody can be equivalent to the mature vaccine in the prior art, therefore, the sequence is preferred.

seq3：GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTA GTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTG GCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCC CACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATG ACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACT TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTA CATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATT GACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTA ACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATAT AAGCAGAGCT。

As a further preferred embodiment, the vaccine production system further comprises a downstream located stop signal; preferably, the termination signal is downstream of the carbon-terminal sequence, preferably the termination signal is an HSV termination signal.

The sequence of the termination signal is a sequence containing a termination sequence or a sequence which is more than 70% homologous with the termination sequence; e.g., 70%, 75%, 80%, 85%, 90%, 95%, etc., which includes a sequence obtained by adding one or more bases to, subtracting one or more bases from, or replacing any one or more bases of the termination sequence; several include numbers of 2 and 2 or more. Although other types of termination signals may be used, it has been found through experimentation that the use of a termination sequence or homologous sequence in combination with other gene fragments of the present application is more efficient, provides better antigen concentration and antibody titer, and allows for antibodies comparable to vaccines that are mature in the prior art, and therefore, is preferred.

A termination sequence: CGGCAATAAAAAGACAGAATAACGCACGGGTTGTTGGGTCGTTTGTTC.

A map of a plasmid containing the above promoter and termination signal is shown in FIG. 5.

As a further preferred embodiment, any one or several bases in the system are independently a modified base or an unmodified base; wherein, the modification comprises thio modification, fluoro modification, amino modification and methoxy modification. The stability of the base sequence can be increased by suitable modifications.

As a further preferred embodiment, the system further comprises a vector capable of loading or carrying the above gene sequences, including but not limited to plasmids and viruses.

The effect of different vectors on antigen expression is shown in FIG. 7, where FIG. 7A is the in vitro cell experiment results of pcDNA6.2 plasmid vector, pcDNA3.1 plasmid vector, psin-lenti lentiviral vector, and p-AAV adeno-associated viral vector on the expression of neo-corona RBD antigen, and FIG. 7B is the in vivo experiment results of four vectors on the expression of neo-corona RBD antigen in mice.

In the present embodiment, the tissue organ includes all cells, tissues and organs of an organism, including but not limited to blood, muscle, liver, spleen, lung, stomach, intestine, gallbladder, pancreas, brain, heart, kidney, etc., the exosome is an exosome complex, and the vesicle complex is an exosome complex.

The distribution of the new corona RBD antigen expression in different tissues (liver, lung, kidney, heart) is shown in figure 6. As can be seen from fig. 6, the self-assembled vaccine production system of the present example can be enriched in a variety of different tissue organs, wherein the expression effect is optimized with the enrichment of liver tissue.

The administration of the above system or the above vaccine includes, but is not limited to, oral administration, inhalation, subcutaneous injection, intramuscular injection, intravenous injection, and the like.

Corresponding to the above antigens, the types of vaccines include, but are not limited to, bcg vaccine, hepatitis a vaccine, hepatitis b vaccine, measles vaccine, polio vaccine, diphtheria vaccine, tetanus vaccine, rabies vaccine, influenza vaccine, pneumonia vaccine, varicella vaccine, rotavirus vaccine, hand-foot-and-mouth disease vaccine, meningitis vaccine, epidemic encephalitis b, pneumonia vaccine, tumor vaccine, tuberculosis vaccine, new crown virus vaccine, HPV vaccine, mumps vaccine, rubella.

The titer of the partial vaccine antibody is detected by an ELISA method, wherein the detection result of the hepatitis B vaccine antibody titer, the detection result of the human papilloma virus vaccine antibody titer and the detection result of the influenza A H1N1 vaccine antibody titer are shown in figures 8-10; as can be seen from the figure, the IgG titer of the three vaccine antibodies gradually increased with the time (7-45 days), while the PBS group and the Ctrl group did not change, which fully indicates that the vaccine antibodies provided in this example indeed have certain effectiveness.

Example 2

Based on example 1, a method for producing a biological self-assembly vaccine, the method comprising constructing a system as described in any one of the above paragraphs, the system being a sequence capable of being enriched in cells, tissues and/or organs of an organism and expressing an antigen on the surface of vesicles and self-assembling into vesicle complexes, the vesicle complexes being vaccines capable of eliciting an immune response. In particular, the genetic modules and other sequences are synthesized in any of the permutations described herein.

The method in the embodiment is simple and rapid, and can synthesize a large number of different sequences in a short time, so that the vaccine generating system can produce quickly and efficiently.

Example 3

On the basis of example 1 or 2, a vector system comprising the vaccine production system described in example 1 or 2 and a vector for loading or carrying the system. The vector may be a plasmid or a virus, but of course, other types of vectors are also possible.

Example 4

For the vaccine production system described in any of the above embodiments, the gene path in the system can be loaded into a plasmid to form a gene loop, and the gene loop can be synthesized by in vitro editing. Then delivering the gene loop into the body by intravenous or intramuscular injection, and taking the tissue and organ of the mammal as a natural biological basal disc, as shown in figure 1, wherein figure 1 is a schematic diagram of the principle of plasmid in-vivo delivery and action; the gene components express corresponding antigens, and express an exosome surface protein CD63 as a framework, the CD63 helps the antigen assembly and is displayed on the surface of the exosome, as shown in figure 2, figure 2 is a structural schematic diagram of the exosome transmembrane protein lamp2b (left)/CD 63 (right) combined with the antigen, the CD63 is combined with the exosome more firmly, and the antigen is transported to main tissues and organs of the whole body by utilizing the in-vivo circulation characteristic of the exosome, so that the immune response reaction is triggered, as shown in figure 1.

The antigen types listed can be used to construct vaccines, and after injection into the body, the exosome complex can be produced, and obvious antigens and high titers and concentrations of antibodies can be detected.

It should be noted that the antigen in the present application is not limited, and theoretically any antigen can be used, and the list is only a few types of antigens that have been studied by the present inventors for the system of the present application, and in fact many antigens that are not listed may be used, only because of the time relationship, there is no experiment.

In the present invention, some structures related to the present invention all give explicit sequences. However, it will be understood by those skilled in the art that minor variations on the above sequences are within the scope of the present invention. That is, all sequences in this application include additions, deletions or substitutions of one or more bases or amino acids, where a plurality means 2 or more than 2.

Finally, it should be noted that: the above-mentioned embodiments are only used for illustrating the technical solution of the present invention, and not for limiting the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A novel synthetic biology self-assembly vaccine production system is characterized in that: the system is a base sequence which can be enriched in the organism tissue and organ and express antigen on the surface of vesicle and self-assemble into vesicle complex, the vesicle complex can trigger immune response reaction;

the system comprises a base sequence module capable of expressing an antigen and a base sequence segment of CD63 capable of anchoring the antigen on the surface of a vesicle and self-assembling to form a vesicle complex.

2. The novel synthetic biological self-assembled vaccine production system according to claim 1, wherein the base sequence module is an editable or synthesizable gene module;

3. A novel synthetic biological self-assembling vaccine production system according to claim 1, characterized in that in said vesicular complex said antigen is attached to the outer surface of said vesicle through said CD63, preferably said CD63 is attached to the surface of said vesicle through two transmembrane domains.

4. The novel synthetic biological self-assembled vaccine production system according to claim 1, wherein the base sequence module is inserted into the base sequence fragment of CD 63;

preferably, the base sequence module is inserted between any two bases of 20 th to 60 th at the nitrogen terminal of CD 63.

5. The novel synthetic biology self-assembly vaccine production system according to claim 4, wherein the base sequence module is inserted between GG in 20 th to 60 th of the nitrogen terminal of CD63, and the base sequence module divides the CD63 into two parts, namely, a nitrogen terminal sequence containing the nitrogen terminal of CD63 and a carbon terminal sequence containing the carbon terminal of CD 63.

6. A novel synthetic biological self-assembled vaccine production system according to claim 5, wherein the nitrogen-terminal sequence comprises its own sequence or a sequence that is more than 70% homologous to its own sequence;

the carbon terminal sequence is a sequence comprising the carbon terminal sequence or a sequence which is more than 70% homologous with the carbon terminal sequence;

the above-mentioned homologous sequences include those obtained by adding one or more bases to the original sequence, subtracting one or more bases, and replacing any one or more bases.

7. The novel synthetic biological self-assembled vaccine production system according to claim 5, wherein the nitrogen terminal sequence and the base sequence module are connected by a first connecting sequence;

8. The novel synthetic biological self-assembled vaccine production system according to claim 5, wherein the base sequence module is connected to the carbon terminal sequence via a second connecting sequence;

preferably, the second connecting sequence is ACCGGTGGAGCTCGAATCATCAGATCT or a sequence obtained by adding, reducing or replacing any 1-6 bases in the sequence.

9. A novel synthetic biological self-assembled vaccine production system according to claim 5, characterized in that it further comprises a promoter located upstream;

preferably, the promoter is disposed upstream of the nitrogen-terminal sequence.

10. A novel synthetic biological self-assembled vaccine production system according to claim 5, characterized in that it further comprises a downstream located stop signal;

preferably, the termination signal is located downstream of the carbon-terminal sequence.

11. A novel synthetic biological self-assembled vaccine production system according to claim 1, wherein any one or several bases in the system are independently modified or unmodified bases; wherein the modification comprises thio modification, fluoro modification, amino modification and methoxy modification;

preferably, the tissue organ includes all cells, tissues and organs of an organism, the vesicles are exosomes, and the vesicle complexes are exosome complexes.

12. A method of producing a vaccine by synthetic biological self-assembly, comprising: the method comprises constructing a system according to any one of claims 1 to 10, which is a sequence that is capable of being enriched in cells, tissues and/or organs of an organism and expressing antigens on the surface of vesicles and self-assembling into vesicular complexes that are capable of eliciting an immune response.

13. A vaccine, characterized by: comprising the system of any one of claims 1-11;

the vaccine is administered by any means including, but not limited to, oral, inhalation, subcutaneous, intramuscular, intravenous;

the vaccine types include, but are not limited to, bcg vaccine, hepatitis a vaccine, hepatitis b vaccine, measles vaccine, polio vaccine, diphtheria vaccine, tetanus vaccine, rabies vaccine, influenza vaccine, pneumonia vaccine, varicella vaccine, rotavirus vaccine, hand-foot-and-mouth disease vaccine, meningitis vaccine, epidemic encephalitis b, pneumonia vaccine, tuberculosis vaccine, new crown virus vaccine, tumor vaccine, HPV vaccine, mumps vaccine, rubella.