CN115698311A - Preparation of elastomeric compounds comprising an oil with plasticizing action obtained from oleaginous microbial cells - Google Patents

Abstract

The present invention relates to a process for the preparation of elastomeric compounds comprising a plasticizing oil obtained by changing the carbon-nitrogen molar ratio to equal to or greater than 30, by culturing a natural or engineered oleaginous microorganism in a medium containing biomass, to the use of the elastomeric compounds thus obtained for the production of tyres, and to tyres comprising such compounds.

Description

Preparation of elastomeric compounds comprising an oil with plasticizing action obtained from oleaginous microbial cells

Technical Field

The present invention relates to a process for the preparation of elastomeric compounds comprising an oil with plasticizing action obtained by a natural or engineered oleaginous microorganism cultured in a medium containing biomass, the use of the elastomeric compounds thus obtained for the production of tyres, and tyres comprising such compounds.

Prior Art

Plasticizing or processing oils are used in the tire industry to improve the processability of the rubber, reduce its viscosity, ensure good distribution of the filler and reduce fuel consumption. Plasticizing oils are petrochemical derived products, as are components of other products in daily life, such as fuels, plastics, synthetic fibers, solvents, fertilizers, fine chemicals and pharmaceutical preparations.

These oils are further classified according to their content of paraffins, naphthenes and aromatics. In the tire industry, the properties required for a good plasticized product are: a) Good miscibility/compatibility with elastomers, depending on aromaticity and molecular weight and solubility of the oil; b) Stable color, depending on the chemical composition of the oil; c) Aging resistance; d) Low toxicity, currently regulated by the European directive 2005/69/EC, which since 2010 prohibits the use of oils with Polycyclic Aromatic Hydrocarbons (PAH) contents greater than or equal to 10 mg/kg.

Plasticizing oils currently used in tires include Mild Extraction Solvents (MES) mineral oil, treated Distillate Aromatic Extracts (TDAE), naphthenic oils (NAP), residual Aromatic Extracts (RAE) (adapted from SUCHIVA, krisda "Introduction to Process oils", research and Development Centre for Thai Rubber Industry, mahidol University).

The problems associated with mineral oils are related to the non-renewability of the raw materials (in a time compatible with their consumption).

New bio-economic trends are based on the development and enhancement of new synthetic biomasses by sustainable processes with reduced environmental impact.

This biomass represents a raw material for biorefinery, where the term means a production system capable of converting renewable substrates into a range of products, which may include bioenergy, biofuels and biomaterials, within a time compatible with its use, which can now start with petroleum. The core of biorefineries is usually a biological process, or transformation by living organisms, or enzymatic activity derived from them, accompanied by a sustainable chemical process. In this technique, homogeneous and easily convertible substrates can be used, such as sugars or starches in monomeric form: in this case, biorefinery is defined as the first generation. Alternatively, second generation biorefineries offer the possibility of using residual biomass as feedstock, which often has inhomogeneous properties, such as lignocellulose.

The first generation of biorefineries constituted an alternative source of plasticizing oils, as described in patents (WO 2012012133; US 8,969,454 b2 WO2012085014, WO 2013189917. As previously introduced, the starting materials or starting substrates raise practical and ethical problems: in fact, the use of edible biomass overlaps and therefore competes with the agricultural and food chain, the availability of which is affected by seasonal and climatic variability.

Microorganisms can be used to convert residual biomass into target compounds, including oils. Among the microorganisms, yeasts constitute an effective platform for the development of biological processes, since many of them are genetically processable and stable, easy to grow, safe to use (few yeasts are in fact known for their pathogenicity to humans, plants or animals, not subject to phage attack).

In particular, various yeast species are described as oleaginous, i.e. characterized by an oil content higher than 20% of dry biomass. Furthermore, by appropriate changes in the growth conditions, their accumulation capacity rises above 70% (as described in Thevenieau, F. Et al, "Microorganisms as sources of oils." Ocl 20.6 (2013): D603).

By way of non-exhaustive description, oils produced by oil microorganisms may be used in various applications such as (i) in the biodiesel industry, where microbial oils obtained from Rhodosporidium toruloides and microalgae of certain species of the genus Chlorella (Chlorella spp.) are used (e.g. X.ZHao et al, "oils of microorganism microorganisms on the growth and lipid accumulation of microorganism digestion of lipid, bioprocess biosystems Eng.,35 (Li 2012, yeast et al," oils of microorganisms of microorganism digestion of lipid metabolism and preparation of lipid ", and (2008-12) as a source of fatty oil substitute for oil produced by lipid microorganisms of the genus Biotechnology, and (2008. 12) in the biodiesel industry, biotechnology, et al," oils of microorganisms of lipid metabolism of lipid ", and oils produced by lipid metabolism of lipid, and (2008. 12) in the biodiesel industry, and similar industries, and (2008. 12) as a substitute for fatty oils of lipid-12, and oils of microorganisms of lipid metabolism of microorganisms).

Thus, in Second Generation biorefineries, residual biomass from other industrial processes and/or biomass that does not compete with the food chain is used (as described in Naik, S.N. et al, "Production of first and Second Generation biologicals: a compatible reviews." Renewable and sustainable reviews 14.2 (2010): 578-597; and Stichothie, H. et al, "Development of Second-Generation biorefineries". Development of the Global Biotechnology.2016.11-40).

Further examples of applications obtained after engineering oleaginous microorganisms are reported in the literature: the yeast Cripoccocus currants, mutated due to a partial blocking of the enzymatic activity of Δ -9 desaturase, allow oils with a composition similar to cocoa butter to be obtained (as described in Hassan, mainul et al, "Production of a cocoa butter equivalent by product and drug discovery by an unsauvated fatty acid autograph of Cryptococcus currants in batch culture." Process Biochemistry 30.7 (1995): 629-634); and wild-type and mutant strains of Rhodosporidium toruloides have been used as oil producers for producing biodiesel and oleochemical-containing oils (as described in WO2016/185073 and Koutinas, apostolis A. Et al, "Design and technical-environmental evaluation of microbial oil production as a recycled resource for microbial and oleochemical production", fuel116 (2014): 566-577).

Disclosure of Invention

With regard to what is known in the art, the use of oils produced by oleaginous yeasts as plasticizers for the preparation of compounds for tires has never been described. Furthermore, it has never been described: starting from waste products of other industrial processes, plasticizing oils for tire compounds are therefore produced from oleaginous yeast in the logic of recycling bio-economy and sustainability.

The applicant has in fact found that oils which can be used as plasticizers in the tyre industry can be produced by fermentation of biomass by oleaginous microorganisms.

The applicant has also found a preparation process which allows to obtain elastomeric compounds containing plasticised oils, by culturing oleaginous microorganisms in a culture medium containing biomass with an unbalanced carbon to nitrogen molar ratio in favour of carbon, subsequently separating the oil thus obtained from the culture medium, and finally mixing the oil with the elastomeric compounds.

The applicant has also developed an engineering method which allows to obtain oleaginous yeasts overexpressing endogenous combinations of genes coding for enzymatic activities involved in the fatty acid biosynthesis process, in particular (i) Δ -9 desaturase and (ii) Δ -12 desaturase.

The applicant has surprisingly observed that the oil obtained from the oleaginous yeast thus engineered is particularly rich in monounsaturated fatty acids, unlike what is expected to be rich in polyunsaturated fatty acids.

Finally, the applicant has surprisingly found that the crosslinked elastomeric materials obtained by crosslinking a crosslinkable elastomeric compound comprising at least one oil obtained from oleaginous yeasts have static mechanical properties comparable or even better than those obtained using conventional plasticizing oils or vegetable oils, further exhibiting improved dynamic mechanical properties, in particular hysteresis and tan δ, indicating a lower rolling resistance, and therefore a lower fuel consumption and carbon dioxide emissions, of the tires made with such elastomeric materials.

Accordingly, a first aspect of the present invention provides a process for the preparation of an elastomeric compound comprising a plasticizing oil, the process comprising the steps of:

(a) Culturing an oleaginous microorganism in a culture medium comprising biomass, the biomass containing a carbon to nitrogen molar ratio of 5 to 20;

(b) An imbalance is caused by changing the carbon nitrogen molar ratio to a value equal to or greater than 30, preferably between 30 and 100;

(c) Isolating the oleaginous microorganism from the culture medium;

(D) Extracting oil from oleaginous microorganisms, and

(e) The oil is mixed with the elastomeric compound.

Advantageously, the elastomeric compound obtained in the process according to the first aspect of the invention is used for the preparation of tyres.

According to one embodiment of the first aspect of the invention, the microorganism is an oleaginous yeast of the group comprising Cryptococcus (Cryptococcus), lipomyces (Lipomyces), rhodosporidium (Rhodosporidium), rhodotorula (Rhodotorula), trichosporon (trichosporion), yarrowia (Yarrowia).

According to an embodiment of the first aspect of the invention, the biomass comprises at least one organic carbon source selected from the group consisting of: raw glycerol, molasses, lignocellulose, beet pulp, whey, starch residues, waste water, waste oil, glucose, xylose, arabinose, fructose, galactose, mannose, acetate and/or combinations thereof.

According to a preferred embodiment of the first aspect of the invention, the microorganism belongs to a strain of the following species: cryptococcus curvatus, lipomyces stakeyi, rhodosporidium toruloides, rhodotorula glutinis, trichosporon fermentans and Yarrowia lipolytica, more preferably Rhodosporidium toruloides and Lipomyces staphylium.

According to an alternative embodiment of the first aspect of the invention, the microorganism is a microalgae of the group consisting of: chlorella ellipsoidea (Chlorella ellipsoidea), chlorella protothecoides (Chlorella protothecoides), chlorella vulgaris (Chlorella vulgaris), a species of the genus Dunaliella (Dunaliella sp.), haematococcus pluvialis, neochloris fulvescens (Neochloris oloabundans), neochloris oleabundandandans, a species of the genus Neochloris (Pseudochloris sp.), scenedesmus obliquus (Scenedesmus obliquus), tetraselmis fuscus (Tetraselmis chui), a species of the genus Tetraselmis sp., tetraselmis tetradactylum (Tetraselmis tetragonocauli), tetraselmis terrestris (Chalcospira Chalcogramma), a Chalcogramma (Chalcospira Chalcogramma), and a Chalcospira (Chalcospira), a Chalcospira (Chalcospira), haematococcus sp.), haematococcus pluvialis, haematococcus sp. Rhombohedral algae (Nitzschia cf. Pusilla) YSR02, phaeodactylum tricornutum F & M40 (Phaeodactylum tricornutum F & M40), skeletonema sp.CS 252, thalassiosira pseudostreptococcum CS 173, crypthecodinium cohnii (Crypthecodinium cohnii), isochrysis sp.sp., isochrysis sp.isoflagellata (Isochrysis sp.), isochrysis sp.Zhang (Isochrysis zhangiangensis), nannochloropsis oculata (Nanochloropsis oculata) Nanochlorens, nannochloropsis oculata (Naochloropodium oculi) NCP.3, rhodococcus sp.rhodochrous (Rhodococcus sp.sp.49).

According to an alternative embodiment of the first aspect of the invention, the microorganism is selected from the group consisting of: fungi and protists such as Aspergillus terreus (Aspergillus terreus), claviceps purpurea (Claviceps purpurea), ustilago subgenera (Tolypospora), mortierella alpina (Mortierella alpina), mortierella pusilla (Mortierella isabellina), and Schizochytrium limacinum (Schizochytrium limacinum).

According to a preferred embodiment of the first aspect of the present invention, the oleaginous microorganism is an engineered oleaginous microorganism obtained by an engineering method of oleaginous microorganisms comprising the steps of:

(a) Providing an oleaginous microorganism;

(b) Inserting a gene encoding a delta-9 desaturase into an oleaginous microorganism;

(c) Inserting a gene encoding delta-12 desaturase into an oleaginous microorganism;

(D) The resulting engineered microorganism is selected.

According to a preferred embodiment, the gene encoding a.DELTA.9 desaturase which is overexpressed in yeast is OLE1 of Lipomyces starkeyi having the sequence (SEQ ID NO: 1).

According to a preferred embodiment, the gene encoding a.DELTA.12 desaturase which is overexpressed in yeast is FAD2 from Lipomyces starkeyi having the sequence (SEQ ID NO: 2).

According to a preferred embodiment, the oleaginous microorganism is a lipomyces starchy.

In its second aspect, the present invention relates to an oil for use as plasticizer in a crosslinkable elastomeric compound, characterized by the following composition, expressed in weight percentages (w/w) with respect to the total weight of fatty acids in the oil:

total saturated fatty acids: 30-50% w/w, wherein palmitic acid 25-40% w/w, stearic acid 3-15% w/w,

total monounsaturated fatty acids: 30-70% w/w, wherein palmitoleic acid 1-10% w/w and oleic acid 30-65% w/w, and

total polyunsaturated fatty acids: 1-25% w/w, wherein linoleic acid 1-20% w/w.

According to a preferred embodiment of the second aspect of the invention, the total saturated fatty acids represent 30-45% w/w, preferably 30-40% w/w.

According to a preferred embodiment of the second aspect of the invention, palmitic acid accounts for 25-35% w/w, preferably 27-32% w/w.

According to a preferred embodiment of the second aspect of the invention, stearic acid accounts for 4-11% w/w, preferably 4-9% w/w.

According to a preferred embodiment of the second aspect of the invention, the total monounsaturated fatty acids is 35-65% w/w, preferably 45-65% w/w, more preferably 55-65% w/w.

According to a preferred embodiment of the second aspect of the invention, palmitoleic acid comprises 2-9% w/w, preferably 3-8% w/w, more preferably 4-7% w/w.

According to a preferred embodiment of the second aspect of the invention, oleic acid comprises 35-60% w/w, preferably 45-60% w/w, more preferably 50-60% w/w.

According to a preferred embodiment of the second aspect of the invention, the total polyunsaturated fatty acids constitutes 2-20% w/w, preferably 3-15% w/w, more preferably 3-10% w/w.

According to a preferred embodiment of the second aspect of the invention, linoleic acid represents 2-15% w/w, preferably 2-10% w/w, more preferably 2-5% w/w.

Finally, in a third aspect thereof, the present invention relates to a tyre for vehicle wheels comprising at least one component of said tyre, said component comprising a crosslinked elastomeric material obtained by crosslinking a crosslinkable elastomeric compound comprising at least one oil obtained from oleaginous microorganisms derived from biomass.

According to an embodiment of the third aspect of the invention, the biomass comprises at least one organic carbon source selected from the group consisting of: raw glycerol, molasses, lignocellulose, beet pulp, whey, starch residues, waste water, waste oil, glucose, xylose, arabinose, fructose, galactose, mannose, acetate and/or combinations thereof.

According to a preferred embodiment of the third aspect of the present invention, said crosslinkable elastomeric compound comprises the elastomeric compound obtained by the process according to the first aspect of the present invention.

According to a preferred embodiment of the third aspect of the present invention, said crosslinkable elastomeric compound comprises at least one oil obtained from an engineered oleaginous microorganism.

According to another preferred embodiment of the third aspect of the invention, said crosslinkable elastomeric compound comprises an oil having the composition defined in the second aspect of the invention.

Detailed Description

For non-limiting illustrative purposes, the invention will now be described according to its preferred embodiments, with particular reference to the accompanying drawings, in which:

FIG. 1 shows the fermentation curve of Rhodosporidium toruloides in a bioreactor, wherein the main parameters are related to obtaining microbial OIL 1 (OIL 1);

FIG. 2 shows the fermentation curve of Lipomyces starkeyi in a bioreactor, wherein the main parameters are related to obtaining microbial OIL 2 (OIL 2);

FIG. 3 shows a map of a recombinant vector pLS01 carrying a plasmid pZ derived therefrom ₅ The expression cassette of the nurseoticin resistance (NrsR) gene of (Branduardi et al, "Biosynthesis of vitamin C by last leaves to involved stress resistance" -PLoS One,2, e1092, 2007);

FIG. 4 shows a map of a recombinant vector pLS02, which is derived from pLS01 and carries a Multiple Cloning Site (MCS);

FIG. 5 shows a map of the recombinant vector pLS02-OLE1, which is derived from pLS02 and carries (in MCS) the expression cassette of a putative endogenous gene encoding the delta-9 desaturase of the yeast Lipomyces starkeyi DSM 70295;

FIG. 6 shows a fragment derived from pLS02-OLE1 comprising the expression cassettes carrying the putative gene encoding Δ -9 desaturase (OLE 1) and the nurseoticin resistance (NrsR) gene: such expression cassettes are preferably integrated at the homologous ends;

FIG. 7 shows a map of recombinant vector pLS03 carrying a plasmid pZ derived from plasmid pZ ₄ The expression cassette of The hygromycin B resistance gene (HygR) of (Branduardi et al, "The yeast Zygosaccharomyces bailii: a new host for heterologous)s protein production,secretion and for metabolic engineering applications.”FEMS yeast research 4.4-5(2004):493-504)；

FIG. 8 shows a map of a recombinant vector pLS04, which is derived from pLS03 and carries a Multiple Cloning Site (MCS);

FIG. 9 shows a map of recombinant vector pLS04-FAD2 derived from pLS03 and carrying (in MCS) an expression cassette of an endogenous gene encoding a.DELTA.12 desaturase derived from Lipomyces starkeyi DSM 70295;

figure 10 shows a fragment derived from pLS04-FAD2 comprising an expression cassette carrying a gene encoding delta-12 desaturase (FAD 2) and a hygromycin B resistance (HygR) gene: such expression cassettes are preferably integrated at the homologous ends;

FIG. 11 shows images associated with electrophoretic runs performed to confirm the successful integration of expression cassettes carrying the putative gene encoding Δ -9 desaturase (OLE 1) and the nurseotiricin resistance gene (NrsR) (panel A) and to confirm the successful integration of expression cassettes carrying the gene encoding Δ -12 desaturase (FAD 2) and the hygromycin B resistance gene (HygR) (panel B), wherein 1 represents a PCR negative control (water), 2 represents an integration negative control (DNA Lipomyces starkeyi), 3 represents an integration positive control pLS04-OLE1 (panel A) or pLS04-FAD2 (panel B), and 4 represents the engineered strain Lipomyces starii-OLE 1-FAD2;

FIG. 12 shows plots of OLE1 gene copy number (panel A) and FAD2 gene copy number (panel B) per cell in engineered strains and wild type control strains conferring unit values;

FIG. 13 shows graphs of the expression levels of the putative gene encoding Δ -9 desaturase activity (OLE 1-panel A) and the gene encoding Δ -12 desaturase activity (FAD 2-panel B) in engineered strains and wild-type control strains conferring unit values;

figure 14 shows a graph representing the trend over time of growth and production of oily biomass for engineered strains for OIL3 production compared to consumption of the provided substrate (glycerol 100 g/L);

FIG. 15 shows the fermentation curve of engineered S.starchy in a bioreactor, where the main parameters are related to obtaining microbial OIL (OIL 3), where the period of imbalance is shown in the figure with a dashed line;

fig. 16 shows a histogram showing the fatty acid composition associated with OIL3 compared to the composition of OIL 2. In fig. 16, asterisks indicate the statistical significance of the differences in lipid composition between OIL 2and OIL3 according to student's t-test (p <0.05, p <0.005 and p < 0.0005);

FIG. 17 shows graphs representing the OLE1 gene copy number (panel A) and FAD2 gene copy number (panel B) in corresponding engineered strains compared to a wild-type control strain conferring unit values;

FIG. 18 shows a representative graph of the expression levels of the putative gene encoding delta-9 desaturase activity (OLE 1-panel A) and the expression level of the gene encoding delta-12 desaturase activity (FAD 2-panel B) in the corresponding engineered strains relative to a wild-type control strain conferring unit values;

fig. 19 shows a histogram showing the fatty acid composition associated with OIL 8 compared to the composition of OIL 3. In fig. 19, asterisks indicate the statistical significance of the differences in lipid composition between OIL 8 and OIL3 according to student's t-test ([ p <0.05, [ p <0.005 and ] p < 0.0005);

fig. 20 shows a histogram showing the fatty acid composition associated with OIL 9 compared to the composition of OIL 3. In fig. 20, asterisks indicate the statistical significance of the differences in lipid composition between OIL 9 and OIL3 according to student's t-test ([ p <0.05, [ p <0.005 and ] p < 0.0005);

figure 21 shows a cross-section of a tyre for motor vehicle wheels, according to an embodiment of the fifth aspect of the present invention.

In fig. 21, "a" denotes an axial direction, "X" denotes a radial direction, and in particular, X-X denotes a profile of an equatorial plane. For simplicity, fig. 21 shows only a portion of the tyre, the remaining portions not shown being identical and symmetrically arranged with respect to the equatorial plane "X-X". Tyre 100 for four-wheeled vehicles comprises at least one carcass structure comprising at least one carcass layer 101 made of elastomeric compound having opposite end flaps (end flaps) respectively engaged with respective annular anchoring structures 102, known as bead cores, possibly associated with bead fillers 104. The tyre region comprising the bead core 102 and the filler 104 forms a bead structure 103, which bead structure 103 is intended for anchoring the tyre to a respective mounting rim (not shown). A wear-resistant strip 105 made of elastomeric compound is arranged in an outer position with respect to each bead structure 103. A reinforcing layer 120 may be added between at least one carcass layer 101 and the bead structure 103, consisting of a plurality of textile cords (commonly known as "flippers") incorporated within a layer of elastomeric compound. A protective layer 121 consisting of a plurality of cords incorporated within a layer of elastomer compound rubber (commonly referred to as a "chafer") may be added between at least one carcass layer 101 and the wear strip 105. The carcass structure is associated with a belt structure 106, the belt structure 106 comprising one or more belt layers 106a, 106b, the belt layers 106a, 106b being placed radially superposed with respect to each other and to the carcass layer, typically with textile and/or metallic reinforcing cords incorporated in an elastomeric compound layer. At the radially outermost position of the belt layers 106a, 106b, at least one zero-degree reinforcing layer 106c, commonly known as "0 ° belt", can be applied, usually incorporating textile and/or metallic reinforcing cords incorporated within an elastomeric compound. A tread band 109 of elastomeric compound is applied at a radially external position to the belt structure 106. Moreover, respective sidewalls 108 of elastomeric compound are applied at an axially external position on the side surfaces of the carcass structure, each extending from one of the lateral edges of the tread 109 at the respective bead structure 103. An under-layer 111 of elastomeric compound may be arranged between the belt structure 106 and the tread band 109. A strip 110 consisting of an elastomeric compound, commonly referred to as "mini-sidewall", may be present in the connection region between the sidewall 108 and the tread band 109. In the case of tubeless tyres, a rubber layer 112, usually called "liner", may also be provided in a radially internal position with respect to the carcass layer 101, this rubber layer 112 providing the necessary impermeability to the air of the tyre.

The elastomeric compound comprising at least one oil obtained from oleaginous microorganisms derived from biomass according to the first aspect of the present invention may advantageously be incorporated into one or more components of a tyre selected from the group consisting of belt structures, carcass structures, tread bands, under-layers, sidewalls, mini-sidewalls, sidewall inserts (sidewall inserts), beads, flippers, chafers, sheets and hardbands, preferably at least in the tread band 109, sidewalls 108, mini-sidewalls 110 and/or under-layer 111.

For the purposes of this specification and the appended claims, unless otherwise indicated, all numbers expressing quantities, values, percentages, and so forth, are to be construed as being modified in all instances by the term "about". Moreover, all ranges include any combination of the maximum and minimum points described, and include any intermediate ranges, which may or may not have been specifically listed herein.

The term "rubber", "elastomeric polymer" or "elastomer" means a natural or synthetic polymer that, after vulcanization, is repeatedly stretchable to at least twice its original length at room temperature and returns to approximately its original length substantially immediately upon application of force after the tensile load is removed (as defined in terms of rubber according to ASTM D1566-11 standard terminology).

The elastomeric polymers which can be used in the present invention can be chosen from those commonly used in sulfur-crosslinkable elastomeric materials, which are particularly suitable for the production of tires, i.e. from elastomeric polymers or copolymers with unsaturated chains having a glass transition temperature (Tg) generally lower than 20 ℃, preferably in the range from 0 ℃ to-110 ℃. These polymers or copolymers may be of natural origin or may be obtained by solution, emulsion or gas-phase polymerization of one or more conjugated dienes, optionally mixed with at least one comonomer selected from monovinylarenes and/or polar comonomers in an amount of not more than 60% by weight.

Preferably, the diene elastomeric polymers useful in the present invention can be chosen, for example, from: cis-1, 4-polyisoprene (natural or synthetic rubber, preferably natural rubber), 3, 4-polyisoprene, polybutadiene (especially polybutadiene having a high content of 1, 4-cis), optionally halogenated isoprene/isobutylene copolymers, 1, 3-butadiene/acrylonitrile copolymers, styrene/1, 3-butadiene copolymers, styrene/isoprene/1, 3-butadiene copolymers, styrene/1, 3-butadiene/acrylonitrile copolymers and mixtures thereof.

In the present description, the term "elastomeric compound" refers to the product obtained by mixing at least one elastomeric polymer with at least one additive commonly used in the preparation of tyre compounds, optionally with heating.

Examples of additives commonly used in the preparation of tire compounds are (a) reinforcing fillers such as carbon black and/or silica, (b) coupling agents, typically containing silane groups, (c) curing agents such as sulfur or sulfur derivatives, (d) accelerators such as dithiocarbamates, guanidines, thioureas, thiazoles, sulfenamides, thiurams, amines, xanthates and mixtures thereof, (e) activators, typically zinc and/or zinc compounds, (f) flame retardants, (g) antioxidants, (h) anti-aging agents, (i) binders, (l) antiozonants, (m) modifying resins or mixtures thereof.

The term "biomass" defines any substance of an organic nature which can be regenerated in a time compatible with its consumption, useful for the production of bioenergy, biofuels and biomaterials. This is in contrast to fossil biomass, which has a regeneration time that exceeds the consumption time by many orders of magnitude.

The term "expression vector" defines a DNA construct comprising a DNA sequence linked to control sequences capable of causing expression of the DNA in a suitable host. In the present invention, a typical plasmid expression vector is used which has: a) An origin of replication permitting the actual replication of the plasmid, such that there are 1-2 or tens of copies of the plasmid vector in each cell of the selected host, or a DNA sequence permitting integration of the plasmid vector into the chromosome of each cell of the selected host; b) A selectable marker that allows selection of cells correctly transformed with the plasmid vector; c) A DNA sequence comprising a restriction enzyme cleavage site so that foreign DNA can be introduced into a plasmid vector by a process called ligation. As is generally reported in the art, to achieve high levels of expression of a gene inserted into a host cell, the coding sequence must be properly and functionally linked to transcriptional regulatory elements to function in the expression host of choice.

The term "transformation" as used herein means that DNA, once introduced into a cell, can replicate extrachromosomally or as part of a chromosome.

The term "liposome" refers to an intracellular compartment present in animals, plants, fungi and even bacteria, dedicated to the accumulation of energy in the form of neutral lipids such as triglycerides and sterol esters.

The term "oleaginous microorganism" refers to a microorganism capable of accumulating at least 20% of lipids relative to its dry weight.

The term "Δ -9 desaturase" refers to a polypeptide belonging to the EC 1.14.19.1 family of enzymes, which catalyzes the introduction of a double bond at the Δ -9 position of the fatty acid chain. This reaction uses palmitic and/or stearic acid as its primary substrate, producing palmitoleic and/or oleic acids, respectively.

The term "Δ -12 desaturase" refers to a polypeptide belonging to the enzyme EC 1.14.19.6 family, which catalyzes the introduction of a double bond at the Δ -12 position of the fatty acid chain. This reaction uses oleic acid as its primary substrate, producing linoleic acid.

As non-limiting examples of the present invention, the following examples are reported to support and demonstrate the production of oils from wild-type yeast, the metabolic pathways developed by the inventors of the present invention for the production of modified oils, and the behavior of these oils in compounds and the characteristics imparted to the resulting compounds themselves as compared to reference compounds.

Example 1

Microbial OILs (OIL 1 and OIL 2) having a plasticizing effect were produced according to the following procedure.

Table 1 below shows the fatty acid composition associated with OIL 1 and OIL 2, expressed as a final weight percent (% w/w).

TABLE 1

	OIL 1	OIL 2
			C16:0 palmitic acid	30	30.6
C16:1 palmitoleic acid	1	4.2
			C18:0 stearic acid	10	6.6
C18:1 oleic acid	37	53.7
			C18:2 linoleic acid	16	2.9
SFAs saturated fatty acids	42	38.9
			MUFAs monounsaturated fatty acids	38	57.9
PUFAs polyunsaturated fatty acids	20	3.1

A) Production of a microbial OIL with plasticizing action (OIL 1) by a fermentation process in Rhodosporidium toruloides DSM4444

Cells of the oleaginous yeast strain rhodosporidium toruloides DSM4444 were pre-inoculated into a medium with the following composition: glycerol (15 g/L) as an energy and carbon source was present, containing 1g yeast extract, 1.31g (NH) per liter ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, 100-fold concentrated stock solution rich in minerals (containing 4g CaCl per liter of solution) ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g citric acid, 0.10g ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l H ₂ SO ₄ 18M). This concentration allows a C: N ratio of 10. The pre-inoculation was performed in 200mL of medium in a 1L flask placed on an orbital shaker at 25 ℃ and 220 rpm. After 72 hours of growth, cells were seeded in a 2L bioreactor with initial DO ₆₆₀ Is about 1. The working volume of the same medium used for the preculture corresponds to 1000mL in the presence of about 40g/L of glycerol.

After a fermentation time suitable for the development of the exponential growth phase, an unbalanced phase begins, in which crude glycerol is added to the medium to reach a final concentration of about 50 g/L. Thus, the C: N molar ratio shifts to a value of about 30.

Fermentation parameters require the bioreactor to be kept at a constant temperature of 25 ℃; at an air flow rate of 1vvm (volume of air per volume of medium), the amount of dissolved oxygen is greater than 25%; the pH was maintained at 5.5 and 4M NaOH and 25% (v/v) H were added if necessary ₃ PO ₄ (ii) a Agitation depends on the percentage of dissolved oxygen in the culture.

After 264 hours of seeding, the cells were recovered by centrifugation and subjected to acid lysis (2M HCl) to disrupt the cells themselves, and treated with 2. The chemical extraction of the oil was carried out according to the following protocol: dissolving the cells in 2M hydrochloric acid solution; the formulation was heated in a thermostatic bath at 95 ℃ for 60 minutes with constant stirring. To the suspension was added an equal volume (1; the lower phase was recovered, and 10mL of 100% chloroform was added to the suspension to recover the remaining lipid. The microbial oil obtained from the chemical extraction was subjected to transesterification and subsequently analyzed by gas chromatography [ SAVI LABORATORI & SERVICE s.r.l., roncoferraro (MN), italy ].

FIG. 1 shows the fermentation curves of Rhodosporidium toruloides with respect to the trend of the biomass over time (symbol \9679;) and the corresponding consumption of substrate (symbol a), wherein the imbalance phase is shown in the graph by a dashed line, the line with the symbol a represents the trend of the glycerol concentration and the line with the symbol \9679;, represents the trend of the biomass.

B) Microbial OILs (OIL 2) with plasticizing effect are produced in the oleaginous yeast lipomyces stargardt 70295 by a fermentation process.

Cells of the oleaginous yeast strain saccharomyces cerevisiae DSM70295 were pre-inoculated into a culture medium with the following composition: glycerol (15 g/L) as an energy and carbon source was present, containing 1g yeast extract, 1.31g (NH) per liter ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O,100 fold concentrated stock solution of minerals (containing 4g CaCl per liter of solution) ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g of citric acid, 0.10g of ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l H ₂ SO ₄ 18M). This concentration allows a C: N molar ratio of 10. The pre-inoculation was performed in 200mL of medium in a 1L flask placed on an orbital shaker at 25 ℃ and 220 rpm. Cells were seeded in 2L organismsIn the reactor, initial DO ₆₆₀ Is 3. The working volume of the same medium as used for the preculture corresponds to 1000mL in the presence of about 60g/L of glycerol.

After a fermentation time suitable for the development of the exponential growth phase, an unbalanced phase begins in which crude glycerol is added to the medium to reach a final concentration of 60 g/L. Thus, the C: N molar ratio shifts to a value of about 40.

Fermentation parameters require the bioreactor to be kept at a constant temperature of 25 ℃; at an air flow rate of 1vvm (air volume per volume of medium), the amount of dissolved oxygen is greater than 25%; the pH was maintained at 5.5 and 4M NaOH and 25% (v/v) H were added if necessary ₃ PO ₄ (ii) a Agitation depends on the percentage of dissolved oxygen in the medium.

About 160 hours after seeding, cells were recovered by centrifugation and subjected to acid lysis (HCl 2M) to disrupt the cells themselves, and treated with 2. The chemical extraction of the oil was carried out according to the following protocol: dissolving the cells in 2M hydrochloric acid solution; the formulation was heated in a thermostatic bath at 95 ℃ for 60 minutes with constant stirring. To the suspension was added an equal volume (1; the lower chloroform phase was recovered, and 10mL of 100% chloroform was added to the suspension to recover the remaining lipids. The microbial oils obtained from chemical extraction were subjected to transesterification and subsequently analyzed by gas chromatography [ SAVI LABORATORI & SERVICE s.r.l., roncoferraro (MN), italy ].

FIG. 2 shows the fermentation curves of the biomass trend of the S.starchy yeast over time (symbol \9679;) and the corresponding substrate consumption (symbol a-solidup.), where the imbalance phase is shown in the graph by a dashed line, the line with the symbol a-solidup representing the trend of the glycerol concentration and the line with the symbol \9679;, representing the trend of the biomass.

Example 2

This example describes methods for making expression cassettes containing a putative sequence encoding delta-9 desaturase activity under the control of the pTDH3 promoter and tPGK1 terminator, and a resistance cassette to nurseoticin NsrR.

A)Construction of a recombinant expression vector pLS01 encoding a polypeptide capable of targeting antibiotics The sequence of the resistant nurseotiricin N-acetyltransferase (NrsR) is generated by nurseotiricin.

The sequences of the pURA3 promoter and the tGAL1 terminator of S.starchy were amplified by PCR using genomic DNA of S.starchy DSM70295 as a template and specific oligonucleotides (SEQ ID NO: 3. Using plasmid pZ ₅ (as a template) and a specific oligonucleotide (SEQ ID NO: 7: SEQ ID NO. The procedure for both amplifications was as follows: after 30 seconds of denaturation at 98 ℃,35 cycles (10 seconds of denaturation at 98 ℃,30 seconds of pairing at 64 ℃,30 seconds of extension at 72 ℃) followed by a final extension at 72 ℃ for 2 minutes. The PCR product was loaded on 0.8% agarose gel, the target fragment was recovered by excision and purified using NucleoSpin gel and PCR clean-up kit (MACHEREY-NAGEL GmbH)&Kg) was purified. Cloning was performed by using the Gibson assay cloning kit (New England Biolab, NEB) from plasmid pZ ₅ The amplified NrsR gene and pURA3 and tGAL1 amplified from genomic DNA of S.stutzeri were inserted into pStblue-1 vector, and the product was amplified by transformation of E.coli (Escherichia coli). Once the plasmid was extracted from E.coli, it was visualized by running it on a 0.8% agarose gel, and the correct insertion of the pURA3, NAT, tGAL1 fragment in the pSTBlue plasmid was confirmed by analytical digestion tests with the restriction enzymes HheI and SphI. Using the NucleoSpin Gel and PCR clean-up kit (MACHEREY-NAGEL GmbH)&Kg) the vector designated pLS01-NrsR was purified on a column and purified using specific oligonucleotides (SEQ ID NO:9; SEQ ID NO: 10) was sequenced.

FIG. 3 shows the recombinant vector pLS01-NrsR.

B)Construction of a recombinant vector pLS02 carrying a Multiple Cloning Site (MCS).

The pLS01 vector was subjected to preparative digestion with the restriction enzyme EcoRV for linearization. The vector was recovered by taking out from the agarose Gel, then purified with NucleoSpin Gel and PCR clean-up, and quantified with Nanodrop [ Euroclone (Spa) ]. The constitutive strong promoter of the endogenous gene of the oleaginous yeast sdh 3 and the terminator of the endogenous gene of oleaginous yeast PGK1 were inserted into the linearized pLS01 plasmid: these sequences were amplified by PCR using genomic DNA of Saccharomyces cerevisiae DSM70295 (as template) and specific oligonucleotides (SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO: 14) interspersed with specific sites for five different restriction enzymes (BglII, speI, ecoRV, blpI, fseI) to generate MCS between promoter and terminator. This was done again using the Gibson assembly cloning kit (New England Biolab, NEB). Once the pLS02 plasmid was extracted from E.coli, it was verified by 0.8% agarose analysis gel. The correct insertion of the pTDH3, tPGK1 fragment in the pLS01-NrsR plasmid was confirmed by analytical digestion with PstI and PmlI. The vector pLS02 was purified on a column using the NucleoSpin Gel and PCR clean-up kit (MACHEREY-NAGEL GmbH & Co. KG) and sequenced using specific oligonucleotides (SEQ ID NO:9, SEQ ID NO.

FIG. 4 shows vector pLS02.

C)Construction of a recombinant vector pLS02-OLE1 carrying a putative gene encoding delta-9 desaturase activity.

The sequence encoding a.DELTA.9 desaturase was obtained by comparing the sequence of the yeast Protein of Saccharomyces cerevisiae with the deduced amino acid sequence of the coding sequence present in the entire genome of S.stargardt using the BlastP program (https:// blastwww.genome.jgi.doe.gov/Lipst1_1/Lipst1_1Html) are compared.

The sequence encoding the enzyme Δ -9 desaturase was amplified by PCR using genomic DNA of Saccharomyces cerevisiae DSM70295 as template and specially designed oligonucleotides (SEQ ID NO: 16. The procedure for amplification was as follows: after 30 seconds of denaturation at 98 ℃,30 cycles (denaturation at 98 ℃ for 10 seconds, pairing at 72 ℃ for 30 seconds, extension at 72 ℃ for 60 seconds) followed by a final extension at 72 ℃ for 2 minutes. The PCR product and the target vector pLS02-MCS were digested with the restriction enzyme SpeI, and ligation thereof resulted in the acquisition of the recombinant expression vector pLS02-OLE1. The vector pLS02-OLE1 was removed from the agarose Gel and purified on a column using the NucleoSpin Gel and PCR clean-up kit (MACHEREY-NAGEL GmbH & Co. KG), quantified and sequenced using specific oligonucleotides (SEQ ID NO: 15.

FIG. 5 shows vector pLS02-OLE1.

D)Separate encodingΔ-9Expression cassettes for putative genes of desaturase activity and resistance to nurseoticin.

The pLS02 vector was digested with EcoRI-HF restriction enzyme. The fragment corresponding to the expression cassette (4556 bp) was recovered by removal from a 0.8% agarose Gel and purified using a NucleoSpin Gel and PCR clean-up.

FIG. 6 shows an expression cassette encoding a sequence for Δ -9 desaturase activity (OLE 1).

Example 3

This example describes the procedure for the preparation of an expression cassette containing the sequence encoding delta-12 desaturase activity under the control of the pTDH3 promoter and tPGK1 terminator, and the hygromycin resistance cassette HygR.

A)Construction of a recombinant vector pLS03 carrying a vector encoding a polypeptide capable of conferring resistance to the antibiotic hygromycin The sequence of hygromycin-B4-O-kinase (HygR).

Use of plasmid pZ ₄ (as template) and specific oligonucleotides (SEQ ID NO:18 SEQ ID NO 19), the HygR gene encoding resistance to hygromycin B (4-O-kinase) was amplified by PCR. The procedure for amplification was as follows: after denaturation at 98 ℃ for 30 seconds, 35 cycles (denaturation at 98 ℃ for 10 seconds, pairing at 68 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds) followed by a final extension at 72 ℃ for 2 minutes. The PCR product was loaded on a 0.8% agarose Gel, the target fragment was recovered by excision and purified using a NucleoSpin Gel and PCR clean-up kit (MACHEREY-NAGEL GmbH)&Co. Kg) was purified. By using the Gibson assembly closing kit (New England B)iolab, NEB) will be cloned from plasmid pZ ₄ The amplified hph gene was inserted into the pStblue-1 vector. Once the extraction of the plasmid from E.coli was performed, the plasmid was visualized by running on a 0.8% agarose gel, and the correct insertion of the hph fragment in the pSTBlue plasmid was confirmed by analytical digestion tests with the restriction enzymes HheI and Hincll. The vector designated pLS03-HygR was purified on a column using the above-described kit and sequenced using specific oligonucleotides (SEQ ID NO:9, SEQ ID NO.

FIG. 7 shows recombinant vector pLS03.

B)Construction of a recombinant vector pLS04 carrying a Multiple Cloning Site (MCS).

The target vector pLS02 was digested with the restriction enzyme NheI to obtain a linearized pLS02 vector, and the nurseoticin resistance gene (NrsR) was removed. Similarly, using the same restriction enzyme NheI, the pLS03 vector was digested to obtain the HygR gene, which confers resistance to the hygromycin-B antibiotic.

The HygR gene and pLS02 vector were recovered by extraction from agarose gels, purified with NucleoSpin Gel and PCR clean-up, and quantified with Nanodrop [ Euroclone (Spa) ]. Ligation was then carried out, which resulted in the obtainment of the recombinant expression vector pLS04 which was resistant to the antibiotic hygromycin B. Correct insertion of the HygR fragment within the pLS02 plasmid was verified by analytical digestion with SacII.

FIG. 8 shows recombinant vector pLS04.

C)Construction of a recombinant vector pLS04-FAD2 carrying a gene encoding Δ -12 desaturase activity.

The sequence encoding the Δ -12 desaturase was obtained from the Identification and characterization work described in Matsuzawa, tomohiko et al, "Identification and characterization of Δ 12and Δ 12/Δ 15 biochemical fatty acids assays in the ocean biology Lipomyces stankeyi," Applied microbiology and biotechnology 102.20 (2018): 8817-8826.

The sequence encoding delta-12 desaturase was amplified by PCR using genomic DNA of Saccharomyces cerevisiae DSM70295 as template and specific oligonucleotides (SEQ ID NO:20 SEQ ID NO. The procedure for amplification was as follows: after denaturation at 98 ℃ for 30 seconds, 10 cycles (denaturation at 98 ℃ for 10 seconds, pairing at 59 ℃ for 30 seconds, extension at 72 ℃ for 40 seconds), 25 cycles (denaturation at 98 ℃ for 10 seconds, pairing at 64 ℃ for 30 seconds, extension at 72 ℃ for 40 seconds), followed by final extension at 72 ℃ for 2 minutes. The target vector pLS04-MCS was digested with the restriction enzyme EcoRV-HF and ligated to the PCR product to obtain the recombinant expression vector pLS04-FAD2. The vector pLS04-FAD2 was purified on a column using the NucleoSpin Gel and PCR clean-up kit (MACHEREY-NAGEL GmbH & Co. KG) and sequenced using specific oligonucleotides (SEQ ID NO: 15.

FIG. 9 shows vector pLS04-FAD2.

D)Isolation of expression cassettes encoding genes for desaturase delta-12 Activity and resistance to hygromycin B

The pLS04-FAD2 vector was digested with the restriction enzyme XhoI. The fragment corresponding to the expression cassette (4765 bp) was recovered by extraction from a 0.8% agarose Gel and purified using NucleoSpin Gel and PCR clean-up.

Figure 10 shows an expression cassette encoding the sequence for delta-12 desaturase activity (FAD 2).

Example 4

Lipomyces starkeyi for altering lipid profile and for obtaining microbial OIL (OIL 3) (DSM 70295) construction of recombinant Strain Lipomyces starkeyi-OLE 1-FAD 2.

A laboratory strain of s.cerevisiae DSM70295 was transformed with two expression cassettes in which (i) one contains the putative sequence encoding Δ -9 desaturase activity under the control of pTDH3 promoter and tPGK1 terminator and the resistance cassette NsrR described in example 2 for nurseoticin, (ii) one contains the sequence encoding Δ -12 desaturase activity under the control of pTDH3 promoter and tPGK1 terminator and the hygromycin resistance cassette HygR described in example 3. The integration of the two expression cassettes was verified by PCR using oligonucleotides (SEQ ID NO: 15.

Example 5

By relative quantification in real timePCREvaluation of a copy of a Gene inserted into the genome of Lipomyces starkeyi-OLE 1-FAD2 The number of shellfish.

The number of copies of the gene inserted into the genome of Lipomyces starkeyi-OLE 1-FAD2 was evaluated by relatively quantitative real-time PCR. Starting from genomic DNA extracted from the parental and engineered strains, the copy number of OLE1 and FAD2 in each cell was quantified. Real-time PCR was performed using specific oligonucleotides (SEQ ID NO:24, SEQ ID NO.

Example 6

Assessment of the Delta-9 gene overexpressed in Lipomyces starkeyi-OLE 1-FAD2 by relative quantitative real-time PCR Expression levels of sequences of saturase and Δ -12 desaturase.

Expression levels of putative sequences encoding Δ -9 desaturase and Δ -12 desaturase were assessed by relative quantitative real-time PCR.

The messenger of Δ -9 desaturase and Δ -12 desaturase in the recombinant strain, lipomyces starkeyi-OLE 1-FAD 2and the wild strain was quantified from cDNA obtained by reverse transcription of total RNA (fig. 13).

Cells were pre-seeded in 5ml of medium containing per liter: 25% glucose, 25% xylose, 1g yeast extract, 1.31g (NH) ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, 100-fold concentrated stock solution rich in minerals (4 g CaCl/liter solution) ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g of citric acid, 0.10g of ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l H ₂ SO ₄ 18M). Use of ZR Fungal/Bacterial RRNA extraction was performed on a cell sample at exponential phase using The NA Miniprep kit (Zymoresearch/The epigenetics Co.). Extraction was then controlled by electrophoresis on a 1.5% agarose gel. The cDNA was obtained using the iScript cDNA synthesis (BIORAD) kit. Real-time PCR was performed using specific oligonucleotides (SEQ ID NO:24 SEQ ID NO.

Example 7

Oleaginous yeast sda oil engineered to alter the lipid profile of microbial oils obtained from wild strains Flask production kinetics of lipomyces-OLE 1-FAD 2.

Cells of the oleaginous yeast strain, lipomyces starkeyi-OLE 1-FAD2, engineered for the production of modified lipid OIL (OIL 3) were pre-inoculated into a medium with the following composition: glycerol (15 g/L) as an energy and carbon source was present, containing 1g yeast extract, 1.31g (NH) per liter ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, 100-fold concentrated stock solution rich in minerals (4 g CaCl/L solution) ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g of citric acid, 0.10g of ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l of H ₂ SO ₄ 18M). This concentration allows a C: N ratio of 10. The pre-inoculation was performed in 100mL of medium in 500L flasks placed on an orbital shaker at 25 ℃ and 220 rpm. After 72 hours of growth, the cells were seeded at an optical density of 3 (OD 660 nm) in 50mL of medium identical to that used for the pre-inoculation in the presence of about 100g/L glycerol in 250mL flasks placed on an orbital shaker at 25 ℃, 220 rpm. Cell growth was monitored by periodically measuring the OD at 660 nm. Using H ₂ SO ₄ The extracellular concentration of glycerol was determined by HPLC using 0.01M (as mobile phase) and a Rezex ROA-Organic (Phenomenex) column.

After 240 hours of seeding, the cells were recovered by centrifugation and subjected to acid lysis (HCl 2M) to disrupt the cells themselves, and treated with 2.

The chemical extraction of the oil was carried out according to the following protocol: lysing cells in 2M hydrochloric acid solution; the formulation was heated in a thermostatic bath at 95 ℃ for 60 minutes with constant stirring. To the suspension was added an equal volume (1; the lower phase was recovered, and 10mL of 100% chloroform was added to the suspension to recover the remaining lipid. The microbial oils obtained from chemical extraction were subjected to transesterification and subsequently analyzed by gas chromatography [ SAVI LABORATORI & SERVICE s.r.l., roncoferraro (MN), italy ].

FIG. 14 shows fermentation curves of Lipomyces starkeyi-OLE 1-FAD2 strain with respect to biomass trend over time and corresponding substrate consumption. Table 2 below shows the results of the comparison with OIL 1 and 2and some vegetable OILs, in particular castor OIL (OIL 4), sunflower OIL AP-75 (Cargill) (OIL 5), sunflower OIL

(Cargill) (OIL 6), fatty acid composition associated with OIL 3:

TABLE 2

Table 3 below summarizes the characterization of the OILs of Table 2and the mineral OIL MES (TUDALEN 4226, H and R Group) (OIL 7) as a functional reference using Differential Scanning Calorimetry (DSC) from a temperature of-140 ℃ to +60 ℃ to determine the melting temperature and glass transition temperature. The iodine value was determined using the ISO 3961 method, which involves treating the oil with an excess of Wijs solution. The Wijs solution contains iodine monochloride dissolved in acetic acid. The iodine monochloride reacts with the unsaturated part of the oil and unreacted iodine is released as iodine by the addition of potassium iodide. The iodine released was determined by titration with sodium thiosulfate.

TABLE 3

	Iodine number gI 2 /100g	Melting temperature (. Degree. C.)	Glass transition temperature (. Degree. C.)
				OIL1	65.3	10	-88.7
OIL2	55.5	8	-80.7
				OIL3	56	8	-74.4
OIL4	81-90	-	-58
				OIL5	89.8	-7	-
OIL6	84.6	-5	-
				OIL7	-	.	-60

Example 8

By fermentation in a 10 liter bioreactor, in the oleaginous yeast Lipomyces starkeyi- The OLE1-FAD2 produces a microbial OIL (OIL 3) with plasticizing effect.

Cells of the oleaginous yeast strain oleaginous yeast Saccharomyces cerevisiae-OLE 1-FAD2 engineered for the production of modified lipid OIL (OIL 3) were pre-inoculated into a culture medium having the following composition: glycerol (15 g/L) as an energy and carbon source was present, containing 1g yeast extract, 1.31g (NH) per liter ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, stock solution rich in minerals, 100 times concentrated, 4g CaCl/l solution ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g citric acid, 0.10g ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l H ₂ SO ₄ 18M). This concentration allows a C: N ratio of 10. The pre-inoculation was performed in 200mL of medium in a 1000L flask placed on an orbital shaker at 25 ℃ and 220 rpm. After approximately 48 hours of growth, cells were seeded in a 10L bioreactor with initial DO ₆₆₀ Is 0.2. Working volume phase of the same medium as used for precultureAt 5000mL, about 25g/L glycerol was present. The operating volume of the medium used in the bioreactor was 5000mL.

After a fermentation time suitable for the development of the exponential growth phase, an unbalanced phase begins, in which crude glycerol is added to the medium to reach a final concentration of about 80 g/L. Thus, the C: N molar ratio shifts to a value of about 50.

Fermentation parameters require the bioreactor to be kept at a constant temperature of 25 ℃; at an air flow rate of 1vvm (volume of air per volume of medium), the amount of dissolved oxygen is greater than 25%; the pH was maintained at 5.5 and 4M NaOH and 25% (v/v) H were added if necessary ₃ PO ₄ (ii) a Agitation depends on the percentage of dissolved oxygen in the medium.

After 150 hours of seeding, the cells were recovered by centrifugation and subjected to acid lysis (HCl 2M) to disrupt the cells themselves, and treated with 2. The chemical extraction of the oil was carried out according to the following protocol: lysing cells in 2M hydrochloric acid solution; the formulation was heated in a thermostatic bath at 95 ℃ for 60 minutes with constant stirring. To the suspension was added an equal volume (1; the lower chloroform phase was recovered and 10mL of 100% chloroform was added to the suspension to recover the remaining lipids. The microbial oil obtained from the chemical extraction was subjected to transesterification and subsequently analyzed by gas chromatography [ SAVI LABORATORI & SERVICE s.r.l., roncoferraro (MN), italy ].

FIG. 15 shows the fermentation profile of Lipomyces starkeyi-OLE 1-FAD2 with respect to the trend of biomass over time and the corresponding substrate consumption.

Example 9

With oils engineered to alter the lipid profile of the oil obtained relative to the wild-type strain Kinetics of oil production in flasks by the yeast Lipomyces starkeyi-OLE 1-FAD 2.

Will be passed throughCells of the oleaginous yeast strain lipomyces nodorum-OLE 1-FAD2 engineered for production of modified lipid OIL (OIL 3) were pre-inoculated into a medium with the following composition: 1g yeast extract, 1.31g (NH) per liter in the presence of glycerol (15 g/L) as energy and carbon source ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, stock solution rich in minerals, 100-fold concentrated, containing 4g CaCl per liter of solution ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g citric acid, 0.10g ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l of H ₂ SO ₄ 18M. This concentration allows a C: N ratio of 10. The pre-inoculation was performed in 100mL of medium in 500L flasks placed on an orbital shaker at 25 ℃ and 220 rpm. After 72 hours of growth, the cells were seeded at an optical density of 3 (OD 660 nm) in 50mL of medium in 250mL flasks, identical to the medium used for the pre-seeding, in the presence of about 100g/L glycerol, the flasks being placed on an orbital shaker at 25 ℃ and 220 rpm. Cell growth was monitored by periodically measuring the OD at 660 nm. Using H ₂ SO4 0.01M (as mobile phase) and a Rezex ROA-Organic (Phenomenex) column, the extracellular concentration of glycerol was determined by HPLC. After 240 hours of seeding, the cells were recovered by centrifugation and subjected to acid lysis (HCl 2M) to disrupt the cells themselves, and treated with 2. The chemical extraction of the oil was carried out according to the following protocol: lysing cells in 2M hydrochloric acid solution; the formulation was heated in a thermostatic bath at 95 ℃ for 60 minutes with constant stirring. To the suspension was added an equal volume (1; the lower phase was recovered, and 10mL of 100% chloroform was added to the suspension to recover the remaining lipids. Subjecting the microbial oil obtained from the chemical extraction to transesterification reaction, and then subjecting to gas chromatography [ SAVI LABORATORI&SERVICE S.r.l.,Roncoferraro(MN),Italy]And (6) carrying out analysis.

Figure 16 shows the fatty acid composition associated with OIL3 compared to the composition of OIL 2.

Example 10

Construction of recombinant Strain Lipomyces starkeyi-OLE 1 from Lipomyces starkeyi (DSM 70295) for lipid modification Mass distribution and for obtaining microbial OIL (OIL 8).

The laboratory strain of lipomyces starkeyi DSM70295 was transformed with the expression cassette containing the putative sequence encoding delta-9 desaturase activity under the control of pTDH3 promoter and tPGK1 terminator and the nurseoticin NsrR resistance cassette as described in example 2.

Example 11

Construction of recombinant Strain Lipomyces starkeyi-FAD 2 from Lipomyces starkeyi (DSM 70295) for modification of lipids Mass distribution and for obtaining microbial OIL (OIL 9).

A laboratory strain of lipomyces starkeyi DSM70295 was transformed with an expression cassette containing sequences encoding delta-12 desaturase activity under the control of pTDH3 promoter and tPGK1 terminator as described in example 3, together with a hygromycin HygR resistance cassette.

Example 12

Evaluation of insertions into Lipomyces starkeyi-OLE 1 and Lipomyces starkeyi-FAD 2 by relative quantitative real-time PCR Gene copy number in the genome.

The number of gene copies inserted into the genomes of Lipomyces starkeyi-OLE 1 and Lipomyces starkeyi-FAD 2 was assessed by relatively quantitative real-time PCR as described in example 5. Starting from genomic DNA extracted from the parental and engineered strains, OLE1 and FAD2 copy numbers per cell were quantified. Real-time PCR was performed using specific oligonucleotides (SEQ ID NO:24 SEQ ID NO.

Example 13

Evaluation by relative quantitative real-time PCRIn the strains of Lipomyces starkeyi-OLE 1 and Lipomyces starkeyi-FAD 2 (ii) expression levels of overexpressed sequences encoding a delta-9 desaturase and a delta-12 desaturase.

The expression levels of putative sequences encoding the enzymes Δ -9 desaturase and Δ -12 desaturase were assessed by relative quantitative real-time PCR as described in example 5.

The messenger of Δ -9 desaturase and Δ -12 desaturase in recombinant strains lipomyces starkeyi-OLE 1, lipomyces starkeyi-FAD 2, and wild-type strains was quantified from cDNA obtained by reverse transcription of total RNA (fig. 18).

Cells were pre-seeded in 5ml of medium containing per liter: 25% glucose, 25% xylose, 1g yeast extract, 1.31g (NH) ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, stock solution rich in minerals, containing 4g of CaCl per liter of solution ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g of citric acid, 0.10g of ZnSO ₄ *7H2O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l H ₂ SO ₄ 18M. RNA extraction was performed on cell samples at exponential phase using The ZR Fungal/Bacterial RNA Miniprep kit (Zymoresearch/The epigenetics). Extraction was then controlled by electrophoresis on a 1.5% agarose gel. The cDNA was obtained using the iScript cDNA synthesis (BIORAD) kit. Real-time PCR was performed using specific oligonucleotides (SEQ ID NO:24 SEQ ID NO.

Example 14

Oil production power of oleaginous yeasts lipomyces starkeyi-OLE 1 and lipomyces starkeyi-FAD 2 in flasks In science, the yeast is engineered to alter the lipid profile of the oil relative to the wild-type strain.

Oleaginous yeast strains, lipomyces staphylis, engineered for the production of OILs with altered lipid profiles (OIL 8 and OIL 9)-cells of OLE1 and lipomyces starkeyi-FAD 2 were pre-inoculated in a medium with the following composition: glycerol (15 g/L) as an energy and carbon source was present, containing 1g yeast extract, 1.31g (NH) per liter ₄ ) ₂ SO ₄ 、0.95Na ₂ HPO ₄ 、2.7g KH ₂ PO ₄ 、0.2g MgSO ₄ *7H ₂ O, stock solution rich in minerals, concentrated 100 times, containing 4g CaCl per liter of solution ₂ *2H ₂ O、0.55g FeSO ₄ *7H ₂ O, 0.52g citric acid, 0.10g ZnSO ₄ *7H ₂ O、0.076g MnSO ₄ *H ₂ O, 100. Mu.l H ₂ SO ₄ 18M. This concentration allows a C: N ratio of 10. The pre-inoculation was performed in 100mL of medium in 500L flasks placed on an orbital shaker at 25 ℃ and 220 rpm. After 72 hours of growth, the cells were seeded at an optical density of 3 (OD 660 nm) in 50mL of medium in a 250mL flask, the same as that used for the pre-seeding, in the presence of about 100g/L glycerol, the flask being placed on an orbital shaker at 220rpm and 25 ℃. Cell growth was monitored by periodically measuring the OD at 660 nm. Using H ₂ SO4 0.01M (as mobile phase) and a Rezex ROA-Organic (Phenomenex) column, the extracellular concentration of glycerol was determined by HPLC. After 240 hours of seeding, the cells were recovered by centrifugation and subjected to acid lysis (HCl 2M) to disrupt the cells themselves, and treated with 2. The chemical extraction of the oil was carried out according to the following protocol: dissolving the cells in 2M hydrochloric acid solution; the formulation was heated in a thermostatic bath at 95 ℃ for 60 minutes with constant stirring. To the suspension was added an equal volume (1; the lower phase was recovered, and 10mL of 100% chloroform was added to the suspension to recover the remaining lipids. Subjecting the microbial oil obtained from the chemical extraction to transesterification reaction, and then subjecting to gas chromatography [ SAVI LABORATORI&SERVICE S.r.l.,Roncoferraro(MN),Italy]And (4) carrying out analysis.

Fig. 19 and 20 show the fatty acid composition associated with OIL 8 and OIL 9 compared to the composition of OIL 3.

Example 15

Crosslinkable elastomeric compounds (1-2 and 4-7) were prepared in the laboratory using OIL 1 (compound 1) and OIL 2 (compound 2) in a 0.05 liter Brabender. Characterization results were compared with the use of castor oil (Compound 4), sunflower oil AP-75

(Compound 5) sunflower oil AP-88

(Compound 6) and MES mineral oil (Compound 7) variants were compared.

The following table 4 shows the formulations of the compounds used.

TABLE 4

STR 20: natural rubber

BR 60Mooney 63: polybutadiene prepared from Versalis

Silica Ultrasil 7000: silica prepared by Evonik

TESPT + N-234: bis (triethoxysilylpropyl) tetrasulfide (TESPT 50%) supported on carbon black (N-234%)

OIL 1: oil obtained from Rhodosporidium toruloides DSM4444 (example 1A)

And the OIL 2: oil from Lipomyces starkeyi DSM70295 (example 1B)

OIL 4: castor oil

OIL 5: sunflower oil

(Cargill)

OIL 6: sunflower oil

(Cargill)

OIL 7: MES mineral oil

TMQ:2, 4-trimethyl-1, 2-dihydroquinoline;

6PPD: n- (1, 3-dimethylbutyl) -N' -phenyl-p-phenylenediamine;

TBZTD: tetrabenzylthiuram disulfide

TBBS N-tert-butyl-benzothiazole sulfonamide;

table 5 below shows a comparison of the static and dynamic performance results for the compounds in table 4.

TABLE 5

The results in Table 5 show that the static properties, in particular the breaking load, of compounds 1 and 2 containing OIL 1 and 2 are in good agreement with the static properties of reference compound 7 containing MES OIL, whereas the static properties of compounds 4-6 containing commercial vegetable OILs are systematically lower than the static properties of reference compound 7.

For example, it was observed in particular that the loading of compounds 4 to 6 at 300% (M300) reached a maximum of only 80% of the reference value.

The results in Table 5 show that the dynamic properties of compounds 1 and 2 containing OIL 1 and 2 are also in good agreement with the dynamic properties of reference compound 7 containing MES OIL, whereas the dynamic properties of compounds 4-6 containing commercial vegetable OILs are systematically lower than the dynamic properties of reference compound 7.

For example, it can be observed that the E' values at 10 ℃ and 70 ℃ for compounds 1 and 2 are similar to those of compound 7, while the Tan δ value is slightly lower.

It should be emphasized that compounds 1 and 2 containing the OILs according to the invention (OIL 1 and 2) show much lower tan delta values at 70 ℃ than the values obtained for compounds 4-6 containing the reference vegetable OIL (OIL 4-6).

These results indicate a lower rolling resistance of the tire, resulting in lower fuel consumption and thus reduced CO ₂ And (5) discharging.

Example 16

Crosslinkable elastomeric compounds (13 and 6bis-7 bis) were prepared in the laboratory using OIL3 (Compound 3) in a 0.05 liter Brabender. Characterization results were compared with OIL 6[ sunflower OIL ]

(Cargill) -Compound 6bis]And OIL 7 (mineral OIL MES-Compound 7 bis).

The following table 6 shows the formulations of the compounds used.

TABLE 6

Step (ii) of	Compound (I)	7bis	6bis	3
					1-0	SIR 20	15	15	15
1-0	SLR 3402	85	85	85
					1-1	Silica Ultrasil 7000	60	60	60
1-1	Silane JH75S	9.6	9.6	9.6
					1-2	Stearic acid	2	2	2
1-2	OIL 7	20	-	-
					2-0	OIL 6	-	20	-
2-0	OIL 3	-	-	20
					2-0	Zinc oxide	2	2	2
2-0	TMQ	2	2	2
					2-0	6-PPD	2	2	2
3-0	TBZTD	2.3	2.3	2.3
					3-0	TBBS	0.6	0.6	0.6
3-0	Soluble sulfur	1.3	1.3	1.3

STR 20: natural rubber

SLR3402: styrene-butadiene rubber (15% styrene, 30% vinyl)

Silica Ultrasil 7000: silica prepared by Evonik

Silane JH75S: mixture of bis (triethoxysilylpropyl) tetrasulfide (TESPT 50%) supported on carbon black (50%)

And (7) OIL: MES mineral oil

OIL 6: sunflower oil AP-88

And the OIL 3: oil obtained from Lipomyces starkeyi-OLE 1-FAD2 (example 7)

TMQ:2, 4-trimethyl-1, 2-dihydroquinoline;

6PPD: n- (1, 3-dimethylbutyl) -N' -phenyl-p-phenylenediamine;

TBZTD: tetrabenzylthiuram disulfide

TBBS: n-tert-butyl-benzothiazole sulfonamide;

table 7 below shows a comparison of the static and dynamic performance results for the compounds in table 6.

TABLE 7

The results in Table 7 show that the static performance of compound 3 containing OIL3 is closer to that of compound 7bis containing commercial OIL MES than compound 6bis containing AP 88. Furthermore, the breaking load of compound 3 containing OIL3 is significantly higher than that of compounds 7bis and 6bis containing commodity OILs MES and AP88, respectively. This behavior is unexpected and can indicate longer tire life.

The results in table 7 also show that the E' and Tan delta values at 23 ℃ and 70 ℃ for compound 3 containing OIL3 are very similar to those for compound 7bis containing commercial OIL MES.

The E' value for compound 3 was also greater than that of compound 6bis with AP88 vegetable oil at both 23 ℃ and 70 ℃, while exhibiting a lower Tan δ value at 70 ℃.

Consequently, OIL3 is able to provide low hysteresis at high temperatures, maintaining high modulus at high temperatures, which is the best condition to obtain low rolling resistance of the tire, thus resulting in lower fuel consumption, thus reducing CO ₂ And (5) discharging.

List of oligonucleotide sequences

SEQ ID NO:1OLE1

ATGACTGCCAGTGCTGAGACAACGTCCGCGCAGCCTGTCGTCGAGTCGGCTCGCGCAAGGCCACCCAGATCAAGCTCAACGTCGCCTTCTCGTTCGGTTGGTAGTGCTGCGTCGACTGCGAAGCAAGCGTCTCCTACATTCGTCCACATCTCCGAGCAACCGTTCACTCTCCAGAACTGGTACAAGCACATCAGCTGGCTCAATGTCACGCTGATCATCTTCATCCCTGTCATTGGCTGCACTACCGCGGTTTTCACTCCTCTGCAATCTAAGACTGCCATCCTTGCCTTTGTCTACTACGCCCTGACGGGCCTCGGTATCACTGCGGGTTATCACCGCCTCTGGTCGCACCGTGCTTACAGTGCCCGTCTTCCTCTCCGTATTCTACTCGCTGCTTTCGGCGGCGGTGCTGTTGAGGGTTCCATTCGCTGGTGGTCCGCTGGTCACCGTGTCCATCACAGATTCACCGATACTGAGAAGGACCCTTACTCTGTCCGCAAGGGTCTGCTCTATTCTCACATGGGCTGGATGGTGTTTCTCCACAACCCCAAGAAGTCCGGCCGGGTCGATATCACCGACTTGAACGCTGACCCTGTCGTCAGATGGCAGCACAAGAACTACATTCTCGTCCTTCTCTTTATGGGTTTCATCTTCCCCATGGTAGTTGCCGGCCTCGGATGGGGTGACTGGAAGGGTGGTCTCATCTGGGCTGGCATTGTCCGTTTGACAGTTGTCCACCATGCCACTTTTTGTGTCAACTCGCTCGCTCACTGGCTCGGTGACCAGCCTTTCGACGACCGCCGCTCTCCGCGTGACCACTTCTTGACTGCCATCGTTACGTTCGGCGAGGGCTATCACAACTTCCACCATGAGTTCCCCTCTGACTACCGTAACGCCATAAGATGGTATCAGTATGATCCCACTAAGTGGCTCATCTGGTTCCTCAAGAAGATCGGCTTTGCTTATGACCTTAAGACCTTCTCTCACAATGCCATCCAGCAAGGCCTCGTCCAGCAGAGGCAGAAAAAGCTCGACAAGTGGCGCGCACGTCTTAACTGGGGTGTTCCTCTCGAGCAGCTCCCGGTCATGGAATTTGAAGAGTACCAGGAGCAGGCCAAGACGCGTGCGCTCGTCCTCATTGCTGGTGTTGTCCACGATGTCACCAACTTTATTGAGCAGCATCCTGGTGGAAAGGCTCTGATCCAGTCAGGTATTGGCAAGGATGCCACCGCTGTCTTCAATGGCGGTGTCTACGACCACTCCAATGCTGCCCACAACCTGCTCGGTACCATGCGTGTTGGTGTCATTCGCGGCGGCATGGAAGTCGAGGTCTGGAAGATGGCTCAGCGAGAGAATAAGGAGTCAACGATCAAGTCCGATTCGAATAATGCCAATATCGTCCGTGCAGGTTCTCAGGCAACCCGGATACAAGCTCCCATCCAGGGCGCTGGTGCCGCTTAG

SEQ ID NO:2 FAD2

ATGTCCACAATAACATACACACAGCGCAGGCCGTCAGTGTCGCTGACTTCGAAGCCCGTCTACAAGGATGCCTTCGGCCACGACTTCGAACCGCCGGAGTACACAATCAAAGATATCCTTGATGCCATCCCCAAGCACTGCTTCGACCGCTCTCTTAGCCACTCTCTCGCCTATGTCGCCCGCGACCTCTTCTACGCCTCCTGCTTGTTCGGCCTAGCGACACAGATCCATAGCATCCCCTATCTACCTGCCCGCGTCGTCGCCTGGGTTCTCTACGGCTTTTGCCAAGGCCTTGTCGGCACAGGCTTGTGGGTCCTCGCCCACGAGTGCGGCCATGGAGCCTTCTCCCCCTACAAGCTCGCCAACGACGTCGTCGGGTGGCTCCTCCACTCCGCCCTCTTTGTGCCGTACCACTCATGGCGGATCACTCACTCCAAGCACCACAAAGCCACCGGCCACCTCACCCGCGATATGGTCTTCGTCCCGCGCGACGTGACCCGTTACAAGCTCTCCCGAAACCTGACTGAGCTCACCGAGGAGGCGCCGATCGCGACCCTCTATTTCCTATTTATCCAGCAGGTCTTTGGTTGGCCCGCGTACCTCGCCTACAATGTCACCGGCCAGAAATACCCTGGTGTGTCCAGCTTCAGACGGTCACATTTTGCGCCGTCCGCGCCCATGTTCGATGTAAAGGACTTCTGGGATATTATAATCTCCGATGTCGGTATACTTGTCGCCGGCACTCTTACCTATCTCGGCATCCAGAAATGGGGTTGGGCTAACTTCGCTCTCTACTACTTTATCCCTTATCTCTGGGTCAACAACTGGTTGGTTTGCATCACGTATCTACAGCACACTGACCCAACTCTACCCCATTACGACGCGAGCGAGTGGAACTTTGCCCGCGGCGCCGCGGCAACAGTAGATCGCGACTTTGGCTTCATCGGCCGCCACCTCTTCCACGAGATCATCGAGACGCATGTCGCGCACCACTACTCGTCGCGAATTCCATTCTACCACGCCGAGGAGGCCACGCAAGCCATCCGCAAGGTCATGGGCAAGCATTACCGTCAGGACAAGACAAACCTCATTCTCGCACTCTGGAAGACCGCGCGGACATGCCATTTTGTGGAGGGCGACGGCGTCAAGATGTACAGAAATGCCAACGGAATCGGTATTCCGCCAAAGGAGGGAAGAAGGGCTCAGTAA

SEQ ID NO:3；pURA3 fw

TCG ATC CAG AAT TCG TGA TTC TAG ACT CGA GAT ATC ATG ATC ACT GAG CGA TAG TTC

SEQ ID NO:4；pURA3 rev

TCG TCA AGA GTG GTA CCC ATG TTG AAT TTA GGG ATA TAC TGT AGA AGA C

SEQ ID NO:5；tGAL1 fw

TGA GCA TGC CCT GCC CCT AAA GTT TAG AGA TGT ACA AGG GGT

SEQ ID NO:6；tGAL1 rev

GCT TGT CGA CGA ATT CAG ATT GCC ACG ATA ACT TTG TGC

SEQ ID NO:7；NsrR fw

ATG GGT ACC ACT CTT GAC GAC

SEQ ID NO:8；NsrR rev

TTA GGG GCA GGG CAT GCT CA

SEQ ID NO:9；T7

ATT TAG GTG ACA CTA TAG

SEQ ID NO:10；SP6

TAA TAC GAC TCA CTA TAG GG

SEQ ID NO:11；pTDH3 fw

CGT GAT TCT AGA CTC GAG ATT TAA TTT GCT GAA GCG GTT TGC

SEQ ID NO:12；pTDH3 rev

CGC TTA GCG ATA TCA CTA GTA GAT CTT GCG AAT GTG GAT TAG AGT AAG A

SEQ ID NO:13；p PGK1 fw

ACT AGT GAT ATC GCT AAG CGG CCG GCC CTC CCG TTA ATG TTG GGA TTC

SEQ ID NO:14；t PGK1 rev

TAT CGC TCA GTG ATC ATG ATC CTG TCA ATT ATG CTA CCA CTT G

SEQ ID NO:15；LsTDH3 fw

ATA ATA ATC CGA ACT GCC GC

SEQ ID NO:16；OLE1 fw

TCA GAT ACT AGT ATG ACT GCC AGT GCT GAG ACA ACG TCC

SEQ ID NO:17；OLE1 rev

AGA TAC ACT AGT CTA AGC GGC ACC AGC GCC CT

SEQ ID NO:18；HygR fw

ATG GGT AAAAAG CCT GAA CTC ACC

SEQ ID NO:19；HygR rev

TTA TTC CTT TGC CCT CGG ACG

SEQ ID NO:20；FAD2 fw

CTA GTA AAC TAG TAT GTC CAC AAT AAC ATA CAC AC

SEQ ID NO:21；FAD2 rev

TAT TCT ACT AGT TTA CTG AGC CCT TCT TCC

SEQ ID NO:22；OLE1 CNT rev

CAA CTA CCA TGG GGA AGA TG

SEQ ID NO:23 FAD2 CNT rev

CAA GTA TAC CGA CAT CGG AGA TTA

SEQ ID NO:24 OLE1 RT fw

CCA CTT CTT GAC TGC CAT GC

SEQ ID NO:25 OLE1 RT rev

GAG GAA CCA GAT GAG CCA CT

SEQ ID NO:26 FAD2 RT fw

GAT CGC GAC TTT GGC TTC AT

SEQ ID NO:27 FAD2 RT rev

GAA TTC GCG ACG AGT AGT GG

SEQ ID NO:28 ACT fw

CAT TGC CGA CAG AAT GCA GA

SEQ ID NO:29 ACT rev

ACG GAG TAC TTA CGC TCA GG

Sequence listing

<110> Pirelli Tyre S.p.A.

<120> production of elastomer compound comprising oil having plasticizing action obtained from oil-containing microbial cell

<130> PIR1P82WO

<160> 29

<170> BiSSAP 1.3.6

<210> 1

<211> 1461

<212> DNA

<213> Lipomyces starkeyi)

<220>

<223> Gene encoding delta-9 desaturase

<400> 1

atgactgcca gtgctgagac aacgtccgcg cagcctgtcg tcgagtcggc tcgcgcaagg 60

ccacccagat caagctcaac gtcgccttct cgttcggttg gtagtgctgc gtcgactgcg 120

aagcaagcgt ctcctacatt cgtccacatc tccgagcaac cgttcactct ccagaactgg 180

tacaagcaca tcagctggct caatgtcacg ctgatcatct tcatccctgt cattggctgc 240

actaccgcgg ttttcactcc tctgcaatct aagactgcca tccttgcctt tgtctactac 300

gccctgacgg gcctcggtat cactgcgggt tatcaccgcc tctggtcgca ccgtgcttac 360

agtgcccgtc ttcctctccg tattctactc gctgctttcg gcggcggtgc tgttgagggt 420

tccattcgct ggtggtccgc tggtcaccgt gtccatcaca gattcaccga tactgagaag 480

gacccttact ctgtccgcaa gggtctgctc tattctcaca tgggctggat ggtgtttctc 540

cacaacccca agaagtccgg ccgggtcgat atcaccgact tgaacgctga ccctgtcgtc 600

agatggcagc acaagaacta cattctcgtc cttctcttta tgggtttcat cttccccatg 660

gtagttgccg gcctcggatg gggtgactgg aagggtggtc tcatctgggc tggcattgtc 720

cgtttgacag ttgtccacca tgccactttt tgtgtcaact cgctcgctca ctggctcggt 780

gaccagcctt tcgacgaccg ccgctctccg cgtgaccact tcttgactgc catcgttacg 840

ttcggcgagg gctatcacaa cttccaccat gagttcccct ctgactaccg taacgccata 900

agatggtatc agtatgatcc cactaagtgg ctcatctggt tcctcaagaa gatcggcttt 960

gcttatgacc ttaagacctt ctctcacaat gccatccagc aaggcctcgt ccagcagagg 1020

cagaaaaagc tcgacaagtg gcgcgcacgt cttaactggg gtgttcctct cgagcagctc 1080

ccggtcatgg aatttgaaga gtaccaggag caggccaaga cgcgtgcgct cgtcctcatt 1140

gctggtgttg tccacgatgt caccaacttt attgagcagc atcctggtgg aaaggctctg 1200

atccagtcag gtattggcaa ggatgccacc gctgtcttca atggcggtgt ctacgaccac 1260

tccaatgctg cccacaacct gctcggtacc atgcgtgttg gtgtcattcg cggcggcatg 1320

gaagtcgagg tctggaagat ggctcagcga gagaataagg agtcaacgat caagtccgat 1380

tcgaataatg ccaatatcgt ccgtgcaggt tctcaggcaa cccggataca agctcccatc 1440

cagggcgctg gtgccgctta g 1461

<210> 2

<211> 1209

<212> DNA

<213> Lipomyces starkeyi

<220>

<223> Gene encoding delta-12 desaturase

<400> 2

atgtccacaa taacatacac acagcgcagg ccgtcagtgt cgctgacttc gaagcccgtc 60

tacaaggatg ccttcggcca cgacttcgaa ccgccggagt acacaatcaa agatatcctt 120

gatgccatcc ccaagcactg cttcgaccgc tctcttagcc actctctcgc ctatgtcgcc 180

cgcgacctct tctacgcctc ctgcttgttc ggcctagcga cacagatcca tagcatcccc 240

tatctacctg cccgcgtcgt cgcctgggtt ctctacggct tttgccaagg ccttgtcggc 300

acaggcttgt gggtcctcgc ccacgagtgc ggccatggag ccttctcccc ctacaagctc 360

gccaacgacg tcgtcgggtg gctcctccac tccgccctct ttgtgccgta ccactcatgg 420

cggatcactc actccaagca ccacaaagcc accggccacc tcacccgcga tatggtcttc 480

gtcccgcgcg acgtgacccg ttacaagctc tcccgaaacc tgactgagct caccgaggag 540

gcgccgatcg cgaccctcta tttcctattt atccagcagg tctttggttg gcccgcgtac 600

ctcgcctaca atgtcaccgg ccagaaatac cctggtgtgt ccagcttcag acggtcacat 660

tttgcgccgt ccgcgcccat gttcgatgta aaggacttct gggatattat aatctccgat 720

gtcggtatac ttgtcgccgg cactcttacc tatctcggca tccagaaatg gggttgggct 780

aacttcgctc tctactactt tatcccttat ctctgggtca acaactggtt ggtttgcatc 840

acgtatctac agcacactga cccaactcta ccccattacg acgcgagcga gtggaacttt 900

gcccgcggcg ccgcggcaac agtagatcgc gactttggct tcatcggccg ccacctcttc 960

cacgagatca tcgagacgca tgtcgcgcac cactactcgt cgcgaattcc attctaccac 1020

gccgaggagg ccacgcaagc catccgcaag gtcatgggca agcattaccg tcaggacaag 1080

acaaacctca ttctcgcact ctggaagacc gcgcggacat gccattttgt ggagggcgac 1140

ggcgtcaaga tgtacagaaa tgccaacgga atcggtattc cgccaaagga gggaagaagg 1200

gctcagtaa 1209

<210> 3

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide URA3 fw

<400> 3

tcgatccaga attcgtgatt ctagactcga gatatcatga tcactgagcg atagttc 57

<210> 4

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide URA3 rev

<400> 4

tcgtcaagag tggtacccat gttgaattta gggatatact gtagaagac 49

<210> 5

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide tGAL1 fw

<400> 5

tgagcatgcc ctgcccctaa agtttagaga tgtacaaggg gt 42

<210> 6

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide tGAL1 rev

<400> 6

gcttgtcgac gaattcagat tgccacgata actttgtgc 39

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide NsrR fw

<400> 7

atgggtacca ctcttgacga c 21

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide NsrR rev

<400> 8

ttaggggcag ggcatgctca 20

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Anchor primer T7

<400> 9

atttaggtga cactatag 18

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> promoter sequencing primer SP6

<400> 10

taatacgact cactataggg 20

<210> 11

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> promoter TDH3 fw

<400> 11

cgtgattcta gactcgagat ttaatttgct gaagcggttt gc 42

<210> 12

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> promoter TDH3 rev

<400> 12

cgcttagcga tatcactagt agatcttgcg aatgtggatt agagtaaga 49

<210> 13

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> terminator PGK1 fw

<400> 13

actagtgata tcgctaagcg gccggccctc ccgttaatgt tgggattc 48

<210> 14

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> terminator PGK1 rev

<400> 14

tatcgctcag tgatcatgat cctgtcaatt atgctaccac ttg 43

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide LsTDH3 fw

<400> 15

ataataatcc gaactgccgc 20

<210> 16

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide OLE1 fw

<400> 16

tcagatacta gtatgactgc cagtgctgag acaacgtcc 39

<210> 17

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide OLE1 rev

<400> 17

agatacacta gtctaagcgg caccagcgcc ct 32

<210> 18

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide HygR fw

<400> 18

atgggtaaaa agcctgaact cacc 24

<210> 19

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide HygR rev

<400> 19

ttattccttt gccctcggac g 21

<210> 20

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide FA2 fw

<400> 20

ctagtaaact agtatgtcca caataacata cacac 35

<210> 21

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide FAD2 rev

<400> 21

tattctacta gtttactgag cccttcttcc 30

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide OLE1 CNT rev

<400> 22

caactaccat ggggaagatg 20

<210> 23

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide FAD2 CNT rev

<400> 23

caagtatacc gacatcggag atta 24

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide OLE1 RT fw

<400> 24

ccacttcttg actgccatgc 20

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide OLE1 RT rev

<400> 25

gaggaaccag atgagccact 20

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide FAD2 RT fw

<400> 26

gatcgcgact ttggcttcat 20

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide FAD2 RT rev

<400> 27

gaattcgcga cgagtagtgg 20

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide ACT fw

<400> 28

cattgccgac agaatgcaga 20

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide ACTrev

<400> 29

acggagtact tacgctcagg 20

Claims (20)

1. A process for the preparation of an elastomeric compound comprising a plasticizing oil, comprising the steps of:

(a) Culturing an oleaginous microorganism in a culture medium comprising biomass, the biomass containing a carbon to nitrogen molar ratio of 5 to 20;

(b) An imbalance is caused by changing the carbon nitrogen molar ratio to a value equal to or greater than 30, preferably 30 to 100;

(c) Separating the oleaginous microorganism from the culture medium;

(d) Extracting oil from oleaginous microorganisms, and

(e) The oil is mixed with the elastomeric compound.

2. The method according to claim 1, wherein the microorganism is an oleaginous yeast of the group comprising Cryptococcus (Cryptococcus), lipomyces (Lipomyces), rhodosporidium (Rhodosporidium), rhodotorula (Rhodotorula), trichosporon (trichosporin), yarrowia (Yarrowia).

3. The method of claim 1, wherein the biomass comprises at least one organic carbon source selected from the group consisting of: raw glycerol, molasses, lignocellulose, beet pulp, whey, starch residues, waste water, waste oil, glucose, xylose, arabinose, fructose, galactose, mannose, acetate and/or combinations thereof.

4. The method of claim 1, wherein the microorganism is a strain of a species selected from the group consisting of: cryptococcus curvatus, lipomyces stakeyi, rhodosporidium toruloides, rhodotorula glutinis, trichosporon fermentans and Yarrowia lipolytica, more preferably Rhodosporidium toruloides and Lipomyces staphylium.

5. The method of claim 1, wherein the oleaginous microorganism is an engineered oleaginous microorganism obtained by an engineering method of oleaginous microorganisms comprising the steps of:

(a) Providing an oleaginous microorganism;

(b) Inserting a gene encoding a delta-9 desaturase into an oleaginous microorganism;

(c) Inserting a gene encoding a delta-12 desaturase into an oleaginous microorganism;

(d) The resulting engineered microorganism is selected.

6. The method of claim 5, wherein the gene that encodes Δ -9 desaturase that is overexpressed in yeast is OLE1 of Lipomyces starkeyi having the sequence (SEQ ID N: 1).

7. The method of claim 5, wherein the gene that encodes Δ -12 desaturase that is overexpressed in yeast is FAD2 from Lipomyces starkeyi having the sequence (SEQ ID N: 2).

8. The method of claim 5, wherein the oleaginous microorganism is oleaginous yeast Saccharomyces stardarkii.

9. An oil for use as a plasticizer in a crosslinkable elastomeric compound, characterized by the following composition, expressed in weight percentage (w/w) with respect to the total weight of fatty acids in the oil:

total saturated fatty acids: 30-50% w/w, wherein palmitic acid 25-40% w/w, stearic acid 3-15% w/w,

total monounsaturated fatty acids: 30-70% w/w, wherein palmitoleic acid 1-10% w/w and oleic acid 30-65% w/w, and

total polyunsaturated fatty acids: 1-25% w/w, wherein linoleic acid 1-20% w/w.

10. The oil according to claim 9, wherein the total saturated fatty acids comprise 30-45% w/w, preferably 30-40% w/w.

11. The oil according to claim 9, wherein the palmitic acid accounts for 25-35% w/w, preferably 27-32% w/w.

12. The oil according to claim 9, wherein the stearic acid accounts for 4-11%w/w, preferably 4-9%.

13. The oil according to claim 9, wherein the total monounsaturated fatty acids comprise 35-65% w/w, preferably 45-65% w/w, more preferably 55-65% w/w.

14. The oil according to claim 9, wherein the palmitoleic acid constitutes 2-9% w/w, preferably 3-8%.

15. The oil of claim 10, wherein said oleic acid comprises 35-60% w/w, preferably 45-60% w/w, more preferably 50-60% w/w.

16. The oil according to claim 9, wherein the total polyunsaturated fatty acids constitutes 2-20% w/w, preferably 3-15% w/w, more preferably 3-10% w/w.

17. The oil according to claim 9, wherein the linoleic acid comprises 2-15% w/w, preferably 2-10% w/w, more preferably 2-5% w/w.

18. Tyre for vehicle wheels comprising at least one component of said tyre, said component comprising a crosslinked elastomeric material obtained by crosslinking a crosslinkable elastomeric compound comprising at least one oil obtained starting from an oleaginous microorganism from biomass.

19. Tyre according to claim 18, wherein said elastomeric compound is obtained by a process according to any one of claims 1 to 8.

20. Tyre according to claim 18, wherein said oil has a composition as defined in any one of claims 9 to 17.

Images