CN115677859A - Bispecific antibodies targeting PD-L1 and 4-1BB - Google Patents
Bispecific antibodies targeting PD-L1 and 4-1BB Download PDFInfo
- Publication number
- CN115677859A CN115677859A CN202110838282.2A CN202110838282A CN115677859A CN 115677859 A CN115677859 A CN 115677859A CN 202110838282 A CN202110838282 A CN 202110838282A CN 115677859 A CN115677859 A CN 115677859A
- Authority
- CN
- China
- Prior art keywords
- seq
- ser
- gly
- thr
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention discloses bispecific antibodies targeting PD-L1 and 4-1BB. The bispecific antibody of the invention contains a PD-L1 antigen-binding domain (HCDR 1, HCDR2 and HCDR3 are sequentially shown as 26-32 th, 52-56 th and 98-107 th positions of SEQ ID No.1, and LCDR1, LCDR2 and LCDR3 are sequentially shown as 24-36 th, 52-58 th and 93-100 th positions of SEQ ID No. 2), and a 4-1BB antigen-binding domain (HCDR 1, HCDR2 and HCDR3 are sequentially shown as 31-35 th, 50-65 th and 98-106 th positions of SEQ ID No.3, and LCDR1, LCDR2 and LCDR3 are sequentially shown as 24-34 th, 50-56 th and 89-97 th positions of SEQ ID No. 4). The bispecific antibody has good stability and high safety, can block the combination of PD-1 and PD-L1, can activate a human 4-1BB signal channel, can stimulate the activation of T cells, and can be applied to immune enhancers or immune modulators of T cell-mediated autoimmune diseases.
Description
Technical Field
The invention relates to the technical field of tumor treatment and immunology, in particular to a bispecific antibody targeting PD-L1 and 4-1BB.
Background
Bispecific antibodies (BsAb), also known as bifunctional antibodies, refer to antibodies that can recognize and bind to two different targets or two different epitopes of the same target simultaneously, and can perform some special biological functions, even better than the synergistic effect of combining two monoclonal antibodies. For example, effector cells are directly targeted to tumor cells, cytotoxicity of the tumor cells is enhanced, selectivity and functionality of antibodies are improved, receptors are co-stimulated or inhibited, an immune escape mechanism is avoided, and therefore the treatment effect is improved.
Bispecific antibodies do not exist in nature, and the technical platforms can be structurally divided into three classes: non-IgG-like, symmetric IgG-like, asymmetric IgG-like. The bispecific antibody is a popular new drug development direction in the current biopharmaceutical industry and is also an important branch of antibody drug development, about 20 percent of the antibody drugs in the preclinical stage in the world currently belong to the bispecific antibody, and in China, the bispecific antibody project is mainly focused in the preclinical stage II and no double-antibody drug is approved. From the distribution of diseases, the Chinese double-antibody project mainly focuses on the direction of tumor, and most of the cancer is breast cancer and gastric cancer.
In recent years, new targets and new ways of immune activation for immunotherapy are continuously discovered, and the tumor immunotherapy has made great progress. Programmed death factor 1 (PD-1) is a member of the CD28 superfamily. As a T cell inhibitory receptor, the T cell inhibitory receptor can limit the functions of T cell effectors in tumor cells and has an important role in tumor immune escape. The interaction of PD-1 and PD-L1 is blocked, so that the killing function of T cells to tumors can be effectively recovered; can promote the proliferation of tumor antigen specific T cells, play a role in killing tumor cells and further inhibit the growth of local tumors; PD-L1 monoclonal antibody can up-regulate infiltration CD8 + Secretion of IFN-. Gamma.by T cells, suggests that blockade of the PD-1/PD-L1 signaling pathway plays a role in tumor immune responses with the aim of inducing immune responses. In addition, PD-L1 can also bind to B7-1 in vivo. The PD-L1/B7-1 complex is also shown as a negative signal for T cell activation, and the combination of the two signals can lead to the reduction of the expression of a T cell surface activation marker, the inhibition of T cell proliferation and the like. Currently, it is widely accepted in the industry that antibodies directed to the PD-L1 pathway will bring breakthrough progress in the treatment of a variety of tumors: can be used for treating non-small cell lung cancer, renal cell carcinoma, ovarian cancer, and melanoma. PD-1/PD-L1 immunotherapy is a new class of anticancer immunotherapy that is currently receiving attention worldwide, bringing new hopes for patients. However, there are certain drawbacks to the therapy for PD-1/PDL 1: some patients experience rapid and persistent tumor regression, but most patients achieve little or no significant effect. To increase the response rate to immunotherapy in patients, studies were performedOne has tried to develop new immunomodulatory targets and therapeutic strategies. One promising strategy is to stimulate immunostimulatory receptors to induce immune cell activation. This "co-stimulatory" strategy provides a mechanistic basis for a variety of agents in clinical development, including antibodies that target OX40, CD27, CD40, GITR, and 4-1BB.
4-1BB (CD 137/TNFRSF 9) is a costimulatory molecule, type I membrane glycoprotein, a member of the tumor necrosis factor receptor (TNFRSF 9) superfamily, expressed predominantly in activated T cells, and signaling through the trimeric form following binding to its ligand, 4-1BBL (CD 137L). The 4-1BB signaling pathway can enhance tumor-specific CD8 + The T cell function can achieve anti-tumor effect, and can also enhance NK cell, DC and CD4 + Immune function enhancement of T cells CD8 + T cell mediated anti-tumor immune responses have unique potential as therapeutic targets. In preclinical trials, the anti-tumor activity of anti-4-1BB monoclonal antibodies was demonstrated in multiple models of mouse colon cancer (MC 38, CT 26), lung cancer (M109), breast cancer (EMT 6), and B lymphoma (A20). In addition, the polypeptide has synergistic effect with PD1/PDL1, CTLA4 antibody, chemotherapy and other targeting drugs. The first anti-4-1BB therapeutic agent entering clinical trials, urelumab (BMS-663513), was a fully human monoclonal antibody of the IgG4 class. The drug has encouraging efficacy in the clinic, but the PhaseI and PhaseII phase data show that hepatotoxicity appears to be associated with target and dose, limiting its clinical development. The second drug to enter clinical studies, utomillumab (PF-05082566), is a humanized IgG2 monoclonal antibody that blocks binding to endogenous 4-1BBL while activating 4-1BB. The antibody has better safety compared with Urelumab, but has weak agonistic activity. Therefore, how to develop an efficient and low-toxicity anti-tumor drug aiming at the 4-1BB target becomes the focus of drug research personnel.
No effective PD-L1/4-1BB bispecific antibody drug product exists in the market at present.
Disclosure of Invention
The invention aims to provide a bispecific antibody targeting PD-L1 and 4-1BB. The research and development of the bispecific antibody are expected to make up the deficiency of PD-1/PD-L1 or 4-1BB targeted tumors in the current market, expand new indications, and simultaneously can be used as a new generation of PD-L1 immunotherapy product, so that the bispecific antibody not only can be used for treating patients with immunological tolerance after existing treatment means such as PD-1/PD-L1 and the like in clinic, patients with lower response rate, but also can be used for treating PD-L1 low-expression cancer species without good curative effect at present.
In a first aspect, the invention claims bispecific antibodies targeting PD-L1 and 4-1BB, comprising a PD-L1 antigen-binding domain and a 4-1BB antigen-binding domain.
The PD-L1 antigen binding domain comprises a heavy chain variable region and a light chain variable region; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region are shown as 26 th-32 th, 52 th-56 th and 98 th-107 th sites of SEQ ID No.1 in sequence; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region are shown as 24-36 th, 52-58 th and 93-100 th positions of SEQ ID No.2 in sequence. Wherein the amino acid sequence of said HCDR3 in said heavy chain variable region of said PD-L1 antigen-binding domain may also be as shown in positions 98-107 of SEQ ID No.10 (DRPDGAATNL at positions 98-107 of SEQ ID No.1 is mutated to DRPEGAATNL).
The 4-1BB antigen-binding domain comprises a heavy chain variable region and a light chain variable region; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region are shown as 31-35 th, 50-65 th and 98-106 th positions of SEQ ID No.3 in sequence; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region are shown as 24 th-34 th, 50 th-56 th and 89 th-97 th sites of SEQ ID No.4 in sequence.
Further, in the PD-L1 antigen-binding domain, the amino acid sequence of the heavy chain variable region is 627-744 of SEQ ID No.1 or SEQ ID No.5 or 1-118 of SEQ ID No.10, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity (the place of non-coincidence is preferably in a Framework Region (FR)) with 627-744 of SEQ ID No.1 or SEQ ID No.5 or 1-118 of SEQ ID No. 10; the amino acid sequence of the light chain variable region is 497-606 th position of SEQ ID No.2 or SEQ ID No.5, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of identity (the inconsistency is preferably in the Framework Region (FR)) with the 497-606 th position of SEQ ID No.2 or SEQ ID No. 5.
Further, in the 4-1BB antigen binding domain, the amino acid sequence of the heavy chain variable region is at positions 128-244 of SEQ ID No.3 or SEQ ID No.5, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity (the place of non-correspondence is preferably in the Framework Region (FR)) with positions 128-244 of SEQ ID No.3 or SEQ ID No. 5; the amino acid sequence of the light chain variable region is the 1 st to 107 th positions of SEQ ID No.4 or SEQ ID No.5, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency (the inconsistency is preferably in the Framework Region (FR)) with the 1 st to 107 th positions of SEQ ID No.4 or SEQ ID No. 5.
Still further, the bispecific antibody may be any of the following from N-terminus to C-terminus in structure:
structure a:1 st scFv-L1-Fc-L2-2 nd scFv；
Structure B:1 st scFv-L1-Fc-L2-2 nd Fab；
Structure D:1 st Fab-Fc-L1-2 nd scFv；
Wherein, -represents a peptide bond; l1 and L2 represent a connecting peptide (linker) or an independent peptide bond; l1 and L2 are different or the same; fc represents the Fc fragment of an antibody; 1 st scFv represents a scFv domain capable of specific binding to a first antigen; 1 st Fab represents a Fab domain capable of specific binding to the first antigen; 2 nd scFv represents a scFv domain capable of specific binding to a second antigen; 2 nd Fab represents a Fab domain capable of specific binding to the second antigen; one of the first antigen and the second antigen is PD-L1, and the other is 4-1BB.
The scFv structural domain can be provided with a heavy chain variable region at the N end and a light chain variable region at the C end; alternatively, the N-terminus may be a light chain variable region and the C-terminus a heavy chain variable region.
The connecting peptide (linker) can be selected from the following: a (EAAAK) 4 ALE、KVDKKVEPKSCDKTHTG4S and (G4S) n. Where n is a positive integer (e.g. 1, 2, 3, 4, 5 or 6), preferably n =4.
The bispecific antibody comprises an Fc fragment.
The Fc region may or may not comprise a mutation site.
The Fc segment is of IgG1, igG2, igG3 or IgG4 type, preferably IgG4 type.
Preferably, in said bispecific antibody of structure A in the examples, 1 st scFv recognizing 4-1BB antigen, 2 nd scFv recognizes the PD-L1 antigen.
Preferably, said bispecific antibody 1 of structure B in the examples st scFv recognizing 4-1BB antigen, 2 nd Fab recognizes the PD-L1 antigen.
Preferably, said bispecific antibody of structure D in the examples (designated D1) 1 st Fab recognition of PD-L1 antigen, 2 nd The scFv recognizes 4-1BB antigen, L1 is the "A (EAAAK) 4ALE" amino acid sequence, and the Fc is preferably IgG4. In the embodiment, the bispecific antibody is mutated into D3 on the basis of D1, the 61 st amino acid and the 101 st amino acid from the N terminal of the heavy chain SEQ ID No.7 are mutated into glutamic acid 'E' singly or simultaneously, or the 62 nd amino acid and the 102 th amino acid of the heavy chain SEQ ID No.7 are mutated into glycine 'G' or alanine 'A' singly or simultaneously from the N terminal.
Preferably, in another embodiment said bispecific antibody of structure D (designated D2), 1 st Fab recognition of PD-L1 antigen, 2 nd scFv recognizes the 4-1BB antigen, L1 is the amino acid sequence "(G4S) 3", fc is preferably IgG4. In the embodiment, the bispecific antibody is mutated to D6 on the basis of D2, the 61 st amino acid and the 101 st amino acid from the N terminal of the heavy chain SEQ ID No.8 are mutated to glutamic acid 'E' singly or simultaneously, or the 62 nd amino acid and the 102 th amino acid from the N terminal of the heavy chain SEQ ID No.8 are mutated to glycine 'G' or alanine 'A' singly or simultaneously.
In a particular embodiment of the invention, the bispecific antibody is specifically any one of:
(A) Consists of two identical peptide chains, and the amino acid sequence of each peptide chain is shown as SEQ ID No.5 (corresponding to the structure A);
(B) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.6, and the amino acid sequences of the light chains are shown as SEQ ID No.11 (corresponding to the structure B);
(C) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.7, and the amino acid sequences of the light chains are shown as SEQ ID No.11 (corresponding to the structure D1);
(D) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.9, and the amino acid sequences of the light chains are shown as SEQ ID No.11 (corresponding to a structure D3);
(E) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.8, and the amino acid sequences of the light chains are shown as SEQ ID No.11 (corresponding to a structure D2);
(F) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.10, and the amino acid sequences of the light chains are shown as SEQ ID No.11 (corresponding to structure D6).
In a second aspect, the invention claims nucleic acid molecules encoding the bispecific antibodies described hereinbefore in the first aspect.
In the nucleic acid molecule, the nucleotide sequences encoding HCDR1, HCDR2 and HCDR3 in the heavy chain variable region in the PD-L1 antigen binding domain are shown as 76-96, 154-168 and 292-321 in sequence from the 5' end of SEQ ID No. 27; wherein the nucleotide sequence of said HCDR3 in said heavy chain variable region encoding said PD-L1 antigen binding domain may also be as shown at positions 292-321 of SEQ ID No. 16. The nucleotide sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region in the coding PD-L1 antigen binding domain are shown as 70 th-108 th, 154 th-174 th and 271 th-300 th positions from 5' end of SEQ ID No.28 in sequence.
In the nucleic acid molecule, the nucleotide sequences encoding HCDR1, HCDR2 and HCDR3 in the heavy chain variable region in the 4-1BB antigen binding domain are shown as 91-105, 148-195 and 292-318 of SEQ ID No.29 from the 5' end in sequence. In the nucleic acid molecule, the nucleotide sequences encoding LCDR1, LCDR2 and LCDR3 in the light chain variable region in the 4-1BB antigen binding domain are shown as 70-102, 148-168 and 265-291 of SEQ ID No.30 from the 5' end in sequence.
Further, in the nucleic acid molecule, the nucleotide sequence encoding the heavy chain variable region in the PD-L1 antigen-binding domain is SEQ ID No.27 or 1879-2232 of SEQ ID No.12 or 1-354 of SEQ ID No.16, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity (a place of non-correspondence is preferably in a Framework Region (FR)) with the 1879-2232 of SEQ ID No.27 or SEQ ID No.12 or 1-354 of SEQ ID No. 16. In the nucleic acid molecule, the nucleotide sequence encoding the light chain variable region in the PD-L1 antigen binding domain is 1489-1818 of SEQ ID No.28 or SEQ ID No.12, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% identity with 1489-1818 of SEQ ID No.28 or SEQ ID No. 12.
Further, in the nucleic acid molecule, the nucleotide sequence encoding the heavy chain variable region in the 4-1BB antigen-binding domain is at positions 382 to 732 of SEQ ID No.29 or SEQ ID No.12, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity (the place of inconsistency is preferably in the Framework Region (FR)) with positions 382 to 732 of SEQ ID No.29 or SEQ ID No. 12. In the nucleic acid molecule, the nucleotide sequence encoding the light chain variable region of the 4-1BB antigen binding domain is at positions 1-321 of SEQ ID No.30 or SEQ ID No.12, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity with positions 1-321 of SEQ ID No.30 or SEQ ID No.12 (the place of inconsistency is preferably in the Framework Region (FR)).
Still further, the nucleic acid molecule may be any of:
(a) A nucleic acid molecule a encoding the peptide chain in (a) as described above; the nucleotide sequence of the nucleic acid molecule a is SEQ ID No.12 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.12 (the inconsistency is preferably in a Framework Region (FR)).
(b) Consists of a nucleic acid molecule B1 encoding the heavy chain as described in (B) above and a nucleic acid molecule B2 encoding the light chain as described in (B) above; the nucleotide sequence of the nucleic acid molecule b1 is SEQ ID No.13 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.13 (the inconsistency is preferably in a Framework Region (FR)); the nucleotide sequence of the nucleic acid molecule b2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.18 (the inconsistency is preferably in a Framework Region (FR)).
(c) Consists of a nucleic acid molecule C1 encoding the heavy chain and a nucleic acid molecule C2 encoding the light chain as described above in (C); the nucleotide sequence of the nucleic acid molecule c1 is SEQ ID No.14 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.14 (the inconsistency is preferably in a Framework Region (FR)); the nucleotide sequence of the nucleic acid molecule c2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.18 (the inconsistency is preferably in the Framework Region (FR)).
(d) Consisting of a nucleic acid molecule D1 encoding the heavy chain in (D) as described above and a nucleic acid molecule D2 encoding the light chain in (D) as described above; the nucleotide sequence of the nucleic acid molecule d1 is SEQ ID No.16 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.16 (the inconsistency is preferably in a Framework Region (FR)); the nucleotide sequence of the nucleic acid molecule d2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.18 (the inconsistency is preferably in a Framework Region (FR)).
(e) Consisting of a nucleic acid molecule E1 encoding the heavy chain and a nucleic acid molecule E2 encoding the light chain as described above in (E); the nucleotide sequence of the nucleic acid molecule e1 is SEQ ID No.15 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.15 (the inconsistency is preferably in a Framework Region (FR)); the nucleotide sequence of the nucleic acid molecule e2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.18 (the inconsistency is preferably in the Framework Region (FR)).
(f) Consisting of a nucleic acid molecule F1 encoding the heavy chain of (F) as described above and a nucleic acid molecule F2 encoding the light chain of (F) as described above; the nucleotide sequence of the nucleic acid molecule f1 is SEQ ID No.17 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.17 (the inconsistency is preferably in a Framework Region (FR)); the nucleotide sequence of the nucleic acid molecule f2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No.18 (the inconsistency is preferably in a Framework Region (FR)).
In a third aspect, the invention claims expression cassettes, recombinant vectors, recombinant bacteria or transgenic cell lines containing the nucleic acid molecules described above.
In a fourth aspect, the invention claims a pharmaceutical composition.
The pharmaceutical compositions claimed in the present invention may comprise: (a 1) the bispecific antibody described above; (a 2) a pharmaceutically acceptable excipient, diluent or carrier.
In a fifth aspect, the invention claims a method of making the bispecific antibody described in the first aspect above.
The presently claimed method of making a bispecific antibody as described in the first aspect hereinbefore may comprise the steps of:
(1) A recombinant plasmid obtained by cloning the nucleic acid molecule described in the second aspect into pcDNA3.4 vector;
(2) Transfecting the recombinant plasmid obtained in the step (1) into a receptor cell to obtain a recombinant cell, and culturing the recombinant cell to obtain the bispecific antibody.
Wherein, when the nucleic acid molecule relates to the heavy chain and the light chain, the nucleic acid molecule is respectively cloned into a pcDNA3.4 vector to obtain two recombinant plasmids, then the recombinant plasmids are co-transfected into a receptor cell to obtain a recombinant cell, and the recombinant cell is cultured to obtain the bispecific antibody.
The bispecific antibody has a KD value for binding affinity to human PD-L1 of less than 10E-08M.
The bispecific antibody has a KD value for its binding affinity to human 4-1BB that is less than 10E-08M.
The bispecific antibody is capable of binding to both PD-L1 and 4-1BB.
The bispecific antibody is capable of blocking the binding of PD-1 to PD-L1.
The bispecific antibody has a KD value for binding affinity to monkey PD-L1 of less than 10E-08M.
The bispecific antibody has a KD value for binding affinity to monkey 4-1BB that is less than 10E-08M.
The bispecific antibody can activate T cells in MLR in-vitro experiments and enhance the secretion levels of IL-2 and IFN-gamma.
The bispecific antibody T cell activation effect is dependent on PD-L1, no activity in the absence of PD-L1, and similar EC50 values for the onset of different PD-L1 expression levels.
The bispecific antibody is capable of activating the 4-1BB signaling pathway, which is dependent on cross-linking (Crosslinking).
The bispecific antibody has an anti-tumor effect, and the double-antibody effect is superior to the combined effect of the PD-L1 and the 4-1BB monoclonal antibodies.
The bispecific antibody has good stability.
The bispecific antibody has high safety, and no obvious abnormality is found after the bispecific antibody is administrated in a rhesus monkey body.
The bispecific antibody has good stability and high safety, can block the combination of PD-1 and PD-L1, can activate a human 4-1BB signal channel, can stimulate T cell activation, and can obviously increase the expression quantity of IL-2 and IFN-gamma, which indicates that the antibody can regulate and control an immune system by regulating the activity of immune cells, can be applied to an immunopotentiator for anti-tumor or anti-virus immune response or an immunomodulator for T cell mediated autoimmune diseases, and can also be used for preparing a medicament for treating tumors. Therefore, the bispecific antibody provided by the invention has important significance and application potential when being used for preparing antibody-targeted drugs.
Terms and explanations
BsAb: bispecific antibodies (bispecific antibodies), referred to as diabodies.
ScFv: single-chain variable region antibody fragments, also known as Single-chain antibodies (Single-chain variable fragments).
FACS: fluorescence-activated cell sorting, also known as flow cytometry (Fluorescence-activated cell sorting).
In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, cell culture, molecular genetics, nucleic acid chemistry, immunology laboratory procedures, as used herein, are conventional procedures that are widely used in the relevant art. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.
As used herein, reference to the amino acid sequence of CD137 protein or 4-1BB protein (UniProt Q07011) includes the full length of the 4-1BB protein, or the extracellular fragment 4-1BB-ECD of 4-1BB; also included are fusion proteins of 4-1BB-ECD, such as a fragment fused to the Fc protein fragment of mouse or human IgG (mFc or hFc). When referring to the amino acid sequence of the PD-L1 protein (Uniprot # Q9NZQ 7), it includes the full length of the PD-L1 protein, or the extracellular fragment PD-L1-ECD of PD-L1; also included are fusion proteins of PD-L1-ECD, such as a fragment fused to an Fc protein fragment (mFc or hFc) of a mouse or human IgG. However, it is understood by those skilled in the art that mutations or variations (including but not limited to substitutions, deletions and/or additions) can be naturally occurring or artificially introduced in the amino acid sequence of the 4-1BB protein or PD-L1 without affecting its biological function. Thus, in the present invention, the term "4-1BB protein" or "PD-L1 protein" shall include all such sequences, including natural or artificial variants thereof. Also, when a sequence fragment of the 4-1BB protein or the PD-L1 protein is described, it also includes the corresponding sequence fragment in its natural or artificial variant.
As used herein, the term EC50 refers to the half maximal effect concentration (concentration for 50% >% of the maximum effect), which refers to the concentration that causes 50% of the maximal effect.
As used herein, the term R 2 Is a statistical correlation coefficient, which refers to the degree of agreement between the test data and the fitting function, R 2 The closer the value is to 1, the higher the degree of coincidence, and the closer to 0, the lower the degree of coincidence.
As used herein, the term MLR refers to a Mixed Lymphocyte Reaction (Mixed Lymphocyte Reaction) that involves the detection of the stimulatory effects of antibodies or other drugs on lymphocytes when two unrelated, properly functioning lymphocytes are cultured in vitro in a Mixed culture.
As used herein, the term Linker refers to a protein Linker or Linker element that links different genes of interest together by an appropriate nucleotide sequence, allowing them to be expressed as a single peptide chain in an appropriate organism.
As used herein, the term "Antibody" or Antibody refers to an immunoglobulin molecule generally composed of two pairs of polypeptide chains, each pair having one "light" (L) chain and one "heavy" (H) chain. The constant regions of the Antibody can mediate binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1 q). The VH and VL regions can also be subdivided into regions of high denaturation, referred to as Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, referred to as Framework Regions (FRs). The VH and VL are composed of, in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 consist of 3 CDRs and 4 FRs arranged amino-to carboxy-terminal, the variable regions (VH and VL) of each heavy/light chain pair forming Antibody binding respectively And (4) the part. The term "antibody" is not limited by any particular method of producing an antibody. For example, it includes, in particular, recombinant antibodies, monoclonal antibodies and polyclonal antibodies. The antibodies can be of different isotypes, e.g., igG (e.g., igG1, igG2, igG3, or IgG4 subtypes), igA1, igA2, igD, igE, or IgM antibodies.
As used herein, the terms "bispecific antibody heavy chain" and "bispecific antibody light chain" refer to a bispecific antibody heavy chain in which one chain of high molecular weight is the bispecific antibody heavy chain and a bispecific antibody light chain in which the other chain of low molecular weight is the bispecific antibody light chain, when both chains are present in the bispecific antibody structure.
As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection such that the genetic material element it carries is expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), bacterial Artificial Chromosomes (BACs), or artificial chromosomes of P1 origin (PACs); bacteriophage such as lambda bacteriophage or M13 bacteriophage, animal virus, etc. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), pox viruses, baculoviruses, papilloma viruses, papova viruses (e.g., SV 40). A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may contain a replication initiation site.
As used herein, the term "host cell" refers to a cell that can be used for introducing a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblast, CHO cells, COS cells, NSO cells, heLa cells, BHK cells, HEK293 cells, or human cells.
As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as a reaction between an antibody and an antigen against which it is directed. In some embodiments of the invention, the term "targeting" refers to specific binding.
As used herein, the terms "monoclonal antibody" and "monoclonal antibody" have the same meaning and are used interchangeably; the terms "polypeptide" and "protein" have the same meaning and are used interchangeably. And in the present invention, amino acids are generally represented by one-letter abbreviations as is well known in the art. For example, alanine can be represented by A.
Drawings
FIG. 1 is a schematic diagram of the structure of a dual property antibody of the present invention.
FIG. 2 shows the molecular weight and purity of the bispecific antibody of the present invention tested under SDS-PAGE reducing and non-reducing conditions (R for reduction and NR for non-reduction).
FIG. 3 is a diagram showing that the bispecific antibody of the present invention binds to human PD-L1.
FIG. 4 shows the bispecific antibody mutant candidate molecule of the present invention binding to human PD-L1.
FIG. 5 shows that the bispecific antibody of the present invention binds to human 4-1BB.
FIG. 6 shows the bispecific antibody mutant candidate molecule of the present invention binding to human 4-1BB.
FIG. 7 shows that the bispecific antibody of the present invention binds to both human PD-L1 and human 4-1BB.
FIG. 8 shows the detection of the binding activity of the bispecific antibody of the present invention to human PD-L1 by FACS.
FIG. 9 shows FACS detection of the binding activity of the bispecific antibody of the present invention to human 4-1BB.
FIG. 10 shows the detection of binding activity of the bispecific antibody of the present invention to monkey PD-L1 by ELISA.
FIG. 11 shows the detection of binding activity of the bispecific antibody of the present invention to monkey 4-1BB by ELISA.
FIG. 12 is a MLR assay for T cell activation by bispecific antibodies of the invention. A is the detection of IL-2 secretion level in cell supernatant; b is IFN-gamma secretion level detection in cell supernatant. In the figure, the histogram of each administration group is 10 mug/ml, 2 mug/ml, 0.4 mug/ml, 0.08 mug/ml and 0.016 mug/ml from left to right in sequence; igG concentration from left to right is 10 mug/ml, 0.4 mug/ml and 0.016 mug/ml in sequence
FIG. 13 is HuPD-L1 dependent CD8 + And detecting the activation activity of the T cells.
FIG. 14 shows the reporter gene assay for the 4-1 BB/NF-. Kappa.B activation by the bispecific antibody of the present invention.
FIG. 15 is a reporter gene assay for the blocking of PD-1/PD-L1 activity by the bispecific antibody of the present invention.
FIG. 16 shows the antitumor activity of the bispecific antibody of the present invention.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.
The cell culture, molecular genetics, nucleic acid chemistry, immunology laboratory procedures used in the examples below are all conventional procedures widely used in the relevant art.
The following examples do not include detailed descriptions of conventional methods such as those used for gene amplification, recombinant plasmid construction, and introduction of plasmids into host cells.
pcDNA3.4 vector: (Invitrogen, cat: A14697)
Expi293F cells: ATCC cell bank.
CHO-K1 cells: ATCC cell bank.
MC38 cells: nanjing Ke Bai Biotech Co.
Jurkat cells: nanjing Ke Bai Biotech Ltd.
The conventional equipment and reagents were as follows:
1. a 96-well microplate (Nunc Corp.);
2. plating buffer solution: 0.05M aqueous sodium bicarbonate;
3. washing liquid: phosphate buffer at pH 7.0 containing only 0.05% by volume of Tween 20;
4. sealing liquid: washing solution containing only 10g/L BSA.
5. Horse radish peroxidase labeled avidin;
6. chromogenic substrate: tetramethyl benzidine;
7. stopping liquid: 1M sulfuric acid.
Wherein the solvent of the phosphate buffer solution with the pH of 7.0 is water, and the solutes are sodium chloride, potassium dihydrogen phosphate and disodium hydrogen phosphate; the concentration of the sodium chloride in the phosphate buffer solution with the pH of 7.0 is 135mM, the concentration of the potassium chloride in the phosphate buffer solution with the pH of 7.0 is 2.7mM, the concentration of the potassium dihydrogen phosphate in the phosphate buffer solution with the pH of 7.0 is 1.5mM, and the concentration of the disodium hydrogen phosphate in the phosphate buffer solution with the pH of 7.0 is 8mM (namely, the concentration of the disodium hydrogen phosphate is 8 mM).
Example 1 construction of recombinant vector for anti-human PD-L1/4-1BB bispecific antibody
The sequence of the anti-human PD-L1 monoclonal antibody is from Chinese patent application CN 201910174374.8 of Anhui 'an's biological engineering (group) limited company (called Anhui's biology for short), the sequence of the anti-human 4-1BB monoclonal antibody is from Chinese patent application CN 201911105611.1 of Hefei's Kemibo biotechnology limited company, and the sequence of the anti-human PD-L1 monoclonal antibody is from international patent application PCT/CN2020/127993. The structural schematic diagram of the anti-human PD-L1/4-1BB bispecific antibody is shown in FIG. 1, and all the antibodies have antibody activity.
The bispecific antibody is shown in figure 1, structure a, from N-terminus to C-terminus: 1 st scFv-L1-Fc-L2-2 nd scFv；
The bispecific antibody is shown in fig. 1, structure B, from N-terminus to C-terminus: 1 st scFv-L1-Fc-L2-2 nd Fab；
The bispecific antibody is shown in figure 1, structure D, from N-terminus to C-terminus: 1 st Fab-Fc-L1-2 nd scFv；
Wherein "-" is a peptide bond; l1, L2 are independent peptide bonds or linker elements (linkers); fc is the Fc segment of the antibody; 1 st Is the N-terminal first antigen scFv domain or Fab domain, 2 nd Is a C-terminal secondary antigen scFv domain or Fab domain. The first antigen scFv domain or Fab domain and the second antigen scFv domain or Fab domain each have binding specificity for a different antigen (e.g., PD-L1 or 4-1 BB), where the scFv structure can be either heavy chain-first (VH-VL) or light chain-first (VL-VH). The sequence of the Linker element (Linker) may be a (EAAAK) 4ALE, kvdkvepkscdktht, etc., preferred sequences are (G4S) n, wherein n is a positive integer (e.g., 1, 2, 3, 4, 5 or 6), preferably n =4. The Fc-fragment may comprise mutated or non-mutated sites and may be of the IgG1, igG2, igG3, igG4 type, preferably an IgG4 type Fc.
Alternatively, in the A structure, fc is a human IgG4 subtype, the N end of Fc is connected with a single-chain antibody (VH- (G4S) 4-VL) of an anti-4-1BB antibody through a Linker ((G4S) 2), the C end of Fc is connected with the single-chain antibody (VH- (G4S) 4-VL) of an anti-PD-L1 antibody through the Linker ((G4S) 3), the amino acid sequence of the A structure is shown as SEQ ID No.5, and the corresponding nucleotide sequence is shown as SEQ ID No. 12.
Alternatively, in the structure B, fc is a human IgG4 subtype, one chain (bispecific antibody heavy chain) is the N-terminal of Fc connected with the single-chain antibody (VH- (G4S) 4-VL) of the anti-4-1BB antibody through a Linker ((G4S) 2), the C-terminal of Fc is connected with the heavy chain of the anti-PD-L1 antibody through a Linker ((G4S) 3), the amino acid sequence is shown as SEQ ID No.6 (the corresponding nucleotide sequence is shown as SEQ ID No. 13), the other chain (bispecific antibody light chain) is the light chain of the anti-PD-L1 antibody, and the amino acid sequence is shown as SEQ ID No.11 (the corresponding nucleotide sequence is shown as SEQ ID No. 18).
Alternatively, in the D structure, fc is human IgG4 subtype, and a single-chain antibody (VH- (G4S) 4-VL) against human 4-1BB antibody is linked to the C-terminals of the two heavy chains of the anti-PD-L1 antibody by a Linker (A (EAAAK) 4ALE, KVDKKVEPKSCDKT or (G4S) n), respectively. The other chain is the light chain of the anti-PD-L1 antibody.
D1: l1 is the "A (EAAAK) 4ALE" amino acid sequence. The heavy chain amino acid sequence is shown as SEQ ID No.7 (the corresponding nucleotide sequence is shown as SEQ ID No. 14), and the light chain amino acid sequence is shown as SEQ ID No.11 (the corresponding nucleotide sequence is shown as SEQ ID No. 18).
D3: the mutation is D3 on the basis of D1, the 61 st amino acid and the 101 st amino acid from the N terminal of the heavy chain SEQ ID No.7 are mutated into glutamic acid 'E' singly or simultaneously, or the 62 nd amino acid and the 102 th amino acid from the N terminal of the heavy chain SEQ ID No.7 are mutated into glycine 'G' or alanine 'A' singly or simultaneously. The heavy chain amino acid sequence is shown as SEQ ID No.9 (the corresponding nucleotide sequence is shown as SEQ ID No. 16), and the light chain amino acid sequence is shown as SEQ ID No.11 (the corresponding nucleotide sequence is shown as SEQ ID No. 18).
D2: l1 is the amino acid sequence of "(G4S) 3". The heavy chain amino acid sequence is shown as SEQ ID No.8 (the corresponding nucleotide sequence is shown as SEQ ID No. 15), and the light chain amino acid sequence is shown as SEQ ID No.11 (the corresponding nucleotide sequence is shown as SEQ ID No. 18).
D6: the mutation is D6 on the basis of D2, the 61 st amino acid and the 101 st amino acid from the N end of the heavy chain SEQ ID No.8 are mutated into glutamic acid 'E' singly or simultaneously, or the 62 nd amino acid and the 102 th amino acid from the N end of the heavy chain SEQ ID No.8 are mutated into glycine 'G' or alanine 'A' singly or simultaneously. The heavy chain amino acid sequence is shown as SEQ ID No.10 (the corresponding nucleotide sequence is shown as SEQ ID No. 17), and the light chain amino acid sequence is shown as SEQ ID No.11 (the corresponding nucleotide sequence is shown as SEQ ID No. 18).
The following is a detailed construction process of the bispecific antibody recombinant expression vector.
Directly synthesizing the nucleotide sequence of the heavy chain of the bispecific antibody in the A structure, the B structure and the D structure (D1 or D3 or D2 or D6), respectively introducing an XbaI enzyme digestion site (TCTAGA), a kozak consensus sequence (5 '-GCCACC-3'), and a signal peptide sequence (5 'ATGGAGTTCGGCCTGTCCTGCTGTTTCTGGTGGCCATCCTGAAGGCGTGCAGTGC-3') at the N end, introducing a stop codon and a HindIII enzyme digestion site (AAGCTT) at the C end, digesting the synthetic sequence by adopting XbaI and HindIII and then inserting the digested sequence into a similarly digested pcDNA3.4 vector, namely obtaining the recombinant vector of the target gene of the bispecific antibody. The recombinant plasmids which are verified to be correct by sequencing are respectively named pcDNA3.4-A, pcDNA3.4-B-H, pcDNA3.4-D1-H, pcDNA3.4-D3-H, pcDNA3.4-D2-H and pcDNA3.4-D6-H according to different insertion sequences.
Meanwhile, the light chain gene of the bispecific antibody is artificially synthesized, an XbaI restriction site (TCTAGA), a kozak consensus sequence (5 '-GCCACC-3'), a signal peptide sequence (5-. The recombinant plasmids which are verified to be correct by sequencing are respectively named pcDNA3.4-B-L, pcDNA3.4-D1-L, pcDNA3.4-D3-L, pcDNA3.4-D2-L and pcDNA3.4-D6-L according to different insertion sequences.
Example 2 expression and purification of bispecific antibodies
The recombinant vectors corresponding to the structures described in example 1 were each subjected to the protocol of the Expi293 expression system (Thermo Fisher) according to the product instructions. Respectively adding an Expi Fectamine transfection reagent and DNA plasmids into OptiMEM to obtain solutions A and B, and then uniformly mixing the solution A and the solution B to obtain a solution C. The solution C was added to Expi293 cells (Thermo Fisher), and the Expi293 cells were cultured for 5 days. Wherein, the structure A is only transferred into one recombinant plasmid pcDNA3.4-A; structure B and structure D require two recombinant plasmids corresponding to the co-transformed heavy and light chains, respectively. Centrifuging (10000 rpm for 10 min), taking supernatant, purifying the obtained supernatant by a Protein A affinity chromatography column, and purifying by superdex200pg gel filtration after affinity purification.
The specific operation is as follows: firstly, using PBS to balance a Protein A column (GE company), then culturing supernatant to pass through the column, after balancing, adopting affinity elution buffer solution (formula: solvent is water, solute and concentration are 50mM sodium acetate, pH3.5) to elute 5 column volumes, and collecting elution peak; the superdex200pg (GE) was equilibrated with PBS, and the affinity eluate was applied to a column at 4% ratio to collect the monomer peak, which was then concentrated using a 30KD concentrating centrifuge tube to obtain the desired molecule.
The purified antibody was checked for molecular weight and purity using SDS-PAGE under reducing and non-reducing conditions. The results are shown in FIG. 2, where the A, B, D structures appear as essentially single bands under non-reducing conditions. Under the reduction condition, the structure A is a single band, and the analysis amount is about 80-100KD; the structure B and the structure D are reduced and are represented as two bands, the molecular weights are respectively 80-100KD and 25-30KD, and the molecular weights are consistent with the theoretical molecular weights.
The bispecific antibody with the structure A prepared by the method consists of two identical peptide chains, wherein the amino acid sequence of each peptide chain is shown as SEQ ID No.5 (the corresponding nucleotide sequence is shown as SEQ ID No. 12).
The bispecific antibody with the structure B prepared by the method consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.6 (the corresponding nucleotide sequences are shown as SEQ ID No. 13), and the amino acid sequences of the light chains are shown as SEQ ID No.11 (the corresponding nucleotide sequences are shown as SEQ ID No. 18).
The D1 structure bispecific antibody prepared by the method consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.7 (the corresponding nucleotide sequences are shown as SEQ ID No. 14), and the amino acid sequences of the light chains are shown as SEQ ID No.11 (the corresponding nucleotide sequences are shown as SEQ ID No. 18).
The D3 structure bispecific antibody prepared by the method consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.9 (the corresponding nucleotide sequences are shown as SEQ ID No. 16), and the amino acid sequences of the light chains are shown as SEQ ID No.11 (the corresponding nucleotide sequences are shown as SEQ ID No. 18).
The D2 structure bispecific antibody prepared by the method consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.8 (the corresponding nucleotide sequences are shown as SEQ ID No. 15), and the amino acid sequences of the light chains are shown as SEQ ID No.11 (the corresponding nucleotide sequences are shown as SEQ ID No. 18).
The bispecific antibody with the D6 structure prepared by the method consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.10 (the corresponding nucleotide sequences are shown as SEQ ID No. 17), and the amino acid sequences of the light chains are shown as SEQ ID No.11 (the corresponding nucleotide sequences are shown as SEQ ID No. 18).
Example 3 determination of binding Activity of bispecific antibody to human PD-L1 antigen by ELISA method
The affinity of the bispecific antibody for binding to human PD-L1 was assessed by ELISA. The full-length amino acid sequence of the human PD-L1 is shown as SEQ ID No.22 (Uniprot # Q9NZQ 7). Similar to the above antibody expression preparation, the extracellular segment (19 th to 238 th from the N-terminal of SEQ ID No. 22) is used as the target sequence, inserted between Xba I and HindIII sites of pCDNA3.4 vector, and the target plasmid is obtained after the correctness of sequencing verification, and then the target plasmid is transiently expressed by HEK 293. The 96-well plate (96-well ELISA plate, nunc corporation) was coated with human PD-L1 at a concentration of 350ng/ml, 100. Mu.l/well, overnight at 4 ℃. The plate was washed three times, 300. Mu.l of blocking solution (formula see above) was added to each well, and blocked at 37 ℃ for 1 hour. The bispecific antibody structures a, B, D3 and D6 obtained in example 2 of the present invention were diluted to 5nM with sample diluent (PBS-T plus 1% bovine serum albumin) three times with washing solution (formulation see above), diluted to samples of different concentrations with 4-fold gradient in 7 centrifuge tubes, each concentration set with two duplicate wells at 100 μ l/well, incubated for 1 hour. The plate was washed three times with washing solution, 100. Mu.l of goat anti-human (goat anti-human-HRP, thermoFisher Co., ltd.) was labeled with 8000-fold dilution of horseradish peroxidase per well, and shaken for 0.5 hour. The plates were washed three times with 100. Mu.l of tetramethylbenzidine (TMB, thermoFisher Co.) per well. The reaction was stopped by adding 1M sulfuric acid. OD was measured at 450nm using a Versamax microplate reader (Molecular). According to the antibody and antigen reaction curves, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentrations and detection results are shown in table 1.
The result curve is shown in fig. 3, the bispecific antibody and the human PD-L1 antigen have better combination, and show dose dependence, and the bispecific antibody with different structures has different combination activities with the human PD-L1.
TABLE 1 ELISA for detection of binding Activity of bispecific antibody to human PD-L1
In the same way, the binding activity of different mutant molecules and human PD-L1 corresponding to the D structure is detected, the specific results are shown in Table 2, the curve fitting results are shown in FIG. 4, and the binding activity of the bispecific antibody candidate molecule with the same structure and the human PD-L1 is not greatly different.
TABLE 2 detection of the binding Activity of bispecific antibody mutant molecules to human PD-L1 by ELISA
Example 4 determination of binding Activity of bispecific antibody to human 4-1BB antigen by ELISA method
The affinity of the bispecific antibody for binding to human 4-1BB was assessed by ELISA. The full-length amino acid sequence of human 4-1BB is shown as SEQ ID No.19 (Uniprot # Q07011), the preparation method is similar to that of antibody protein and human PD-L1 protein, the extracellular segment (the amino acid sequence is shown as 24-186 from the N end of SEQ ID No. 19) is taken as a target sequence, the target sequence is inserted between Xba I and Hind III sites of a pCDNA3.4 vector, and the target plasmid is obtained after the sequencing verification is correct and is expressed by HEK293 transient transformation. Human 4-1BB antigen was diluted with a plating solution to 350ng/ml, and 100. Mu.l/well was added to an ELISA plate (Nunc Co., ltd.) at 4 ℃ overnight. The plate was washed three times, 300. Mu.l of blocking solution (formula see above) was added to each well, and blocked at 37 ℃ for 1 hour. The bispecific antibodies A, B, D3 and D6 obtained in example 2 of the invention were diluted to 10nM with sample diluent (PBS-T plus 1% bovine serum albumin), diluted to samples of different concentrations with 4-fold gradient in 7 centrifuge tubes, each concentration was set with two duplicate wells at 100. Mu.l/well, incubated for 1 hour. Adding 100 μ l of horseradish peroxidase-labeled goat anti-human-IgG (goat anti-human-HRP, thermoFisher Co.) diluted 1; the plates were washed three times with 100. Mu.l of tetramethylbenzidine (TMB, thermoFisher Co.) per well. The reaction was stopped by adding 1M sulfuric acid. OD was measured at 450nm using a Versamax microplate reader (Molecular). According to the antibody and antigen reaction curves, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentrations and detection results are shown in table 3.
The results are shown in FIG. 5, where there is better binding between the bispecific antibody and human 4-1BB antigen and it shows dose dependence, and the bispecific antibody with different structures has different binding activity to human 4-1BB.
TABLE 3 detection of bispecific antibody binding Activity with human 4-1BB by ELISA
In the same way, the binding activity of different mutant molecules and human 4-1BB of the D structure is detected, the bispecific antibodies D1, D2, D3 and D6 are respectively diluted to 5nM by using a sample diluent (1% bovine serum albumin is added into PBS-T), and then diluted into samples with different concentrations by using 7 centrifuge tubes in a 4-fold gradient manner, the specific results are shown in Table 2, the curve fitting results are shown in FIG. 6, and after the mutation of the bispecific antibody with the same structure, the binding activity of candidate molecules of D1 and D3, and the binding activity of candidate molecules of D2 and D6 and human 4-1BB are not greatly different.
TABLE 4 detection of bispecific antibody binding to human 4-1BB by ELISA
Example 5 detection of simultaneous binding Properties of bispecific antibody to human PD-L1 and human 4-1BB antigens by ELISA method
Bispecific antibody binding to human PD-L1 was assessed by ELISA for simultaneous binding activity with human 4-1BB. The extracellular domain of human PD-L1 (amino acid sequence shown in SEQ ID No.22 with His tag at positions 19 to 238 from the N-terminus, prepared as described in example 3) was diluted to 500ng/mL with plating solution, 100. Mu.L/well was added to an ELISA plate (Nunc Corp.), and left overnight at 4 ℃. The plate was washed three times, 300. Mu.l of blocking solution (formula see above) was added to each well, and blocked at 37 ℃ for 1 hour. The bispecific antibodies A, B, D3 and D6 obtained in example 2 of the invention were diluted to 5nM with sample diluent (PBS-T plus 1% bovine serum albumin), and then diluted to samples of different concentrations by 5-fold gradient with 7 centrifuge tubes, each concentration was set with two duplicate wells at 100. Mu.l/well, incubated for 1 hour. The antigen human 4-1BB (SEQ ID No.19, 24-186 from the N-terminus, with a murine Fc tag, prepared as described in example 4) was added at a concentration of 500ng/ml, and incubated at 100. Mu.l/well for 1 hour at room temperature. Goat anti-mouse-HRP was diluted with 1% bsa at 1; the plates were washed three times with 100. Mu.l of tetramethylbenzidine (TMB, thermoFisher Co.) per well. The reaction was stopped by adding 1M sulfuric acid. OD was measured at 450nm using a Versamax microplate reader (Molecular). According to the antibody and antigen reaction curves, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentrations and detection results are shown in table 5.
Results the curve is shown in figure 7, bispecific antibody can simultaneously bind to human PD-L1 and human 4-1BB and exhibit dose dependence, with different structures of bispecific antibody with different binding activity to human 4-1BB.
TABLE 5 ELISA for detection of simultaneous binding Activity of bispecific antibody with human PD-L1 and human 4-1BB
Example 6 detection of binding Properties of bispecific antibody to cell surface human PD-L1 antigen by FACS method
The full length (SEQ ID No. 22) of human PD-L1 was inserted between Xba I and HindIII sites of pCDNA3.4 vector according to the method commonly used in the art, and the resulting recombinant plasmid was verified to be correct by sequencing and then introduced into wild-type CHO-K1 cells using Lipofectamine3000 transfection reagent (Invitrogen) to obtain a cell line CHO-K1/hPD-L1 highly expressing human PD-L1. Culturing and collecting CHO-K1/hPD-L1 cells in logarithmic growth phase, resuspending with about 1ml buffer, washing, centrifuging, and packaging the resuspended cells into centrifuge tubes, 2 × 10 5 Each cell per tube. The bispecific antibodies a, B, D3 and D6 obtained in example 2 of the present invention were diluted to 50nM with PBS, respectively, and further diluted with 3-fold gradient for 6 concentrations. The samples at each concentration were added sequentially to centrifuge tubes containing cells, 100. Mu.l per tube, and a blank control was set. After incubation for 60min, the cells were washed twice with 1ml of wash solution (PBS +2% fetal bovine serum), and then goat anti-human FITC secondary antibody (Invitrogen, cat # H10301) was added, resuspended by pipetting, and incubated for 30min in the dark. The tube was washed twice with 1ml of wash solution, then resuspended with 500. Mu.l of PBS per tube, placed on ice and protected from light, and tested on the machine. According to the antibody and antigen reaction curves, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentrations and detection results are shown in table 6.
TABLE 6 FACS detection of the binding Activity of bispecific antibodies to human PD-L1
| Concentration (nM) | A | | D3 | D6 | |
| 50 | 8731.7 | 8489.5 | 8872.2 | 8924.8 | |
| 16.666 | 7997.6 | 8215.3 | 8711.1 | 8404.1 | |
| 5.555 | 3337.1 | 4429.6 | 3816.1 | 2950.3 | |
| 1.851 | 1197.8 | 1449.3 | 1394.8 | 1187.5 | |
| 0.617 | 671.4 | 889.1 | 708 | 653.7 | |
| 0.308 | 504.9 | 616.7 | 543.3 | 516 | |
| EC50(nM) | 7.345 | 5.816 | 6.588 | 7.598 | |
| R 2 | 0.99 | 0.99 | 0.99 | 0.99 |
As shown in fig. 8, there was better binding between bispecific antibody and human PD-L1 antigen and it showed dose dependence, with different structures of bispecific antibody having different binding activities to human PD-L1.
Example 7 detection of binding Properties of bispecific antibody to cell surface human 4-1BB antigen by FACS method
The full length of human 4-1BB (SEQ ID No. 19) was inserted as the target sequence between Xba I and HindIII sites of pCDNA3.4 vector according to a method commonly used in the art, and the resulting recombinant plasmid was confirmed by sequencing and then introduced into wild-type CHO-K1 cells using Lipofectamine3000 transfection reagent (Invitrogen) to obtain cell strain CHO-K1/h4-1BB highly expressing human 4-1BB. Culturing and collecting CHO-K1/h4-1BB cells in the logarithmic growth phase, washing the cells with about 1ml of buffer solution, centrifuging the cells, and resuspending the cellsSubpackaging into centrifuge tube, 2 × 10 5 Each cell per tube. The bispecific antibodies a, B, D3 and D6 obtained in example 2 of the present invention were diluted to 50nM with PBS, respectively, and further diluted with 3-fold gradient for 6 concentrations. Samples of each concentration were added sequentially to a centrifuge tube containing cells, 100. Mu.l per tube, and a blank control was set. After incubation for 60min, the cells were washed twice with 1ml of wash solution (PBS +2% fetal bovine serum), and then goat anti-human FITC secondary antibody (Invitrogen, cat # H10301) was added, resuspended by pipetting, and incubated for 30min in the dark. And washing twice with 1ml of washing solution, adding 500 mu l of PBS into each tube for resuspension, placing on ice and keeping out of the light, and detecting on a machine. According to the antibody and antigen reaction curve, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentration and detection results are shown in table 7.
TABLE 7 FACS detection of the binding Activity of bispecific antibodies to human 4-1BB
As shown in FIG. 9, there was better binding between bispecific antibody and human 4-1BB antigen and it appeared dose-dependent, with different structures of bispecific antibody having different binding activities to human 4-1BB.
Example 8 detection of binding Properties of bispecific antibody and monkey PD-L1 antigen by ELISA method
The binding activity of the bispecific antibody to monkey PD-L1 was assessed by ELISA. The monkey PD-L1 extracellular segment amino acid sequence is shown in SEQ ID No.23 (Uniprot # G7PSE 7). Similar to the above antibody expression preparation, the extracellular segment is used as the target sequence to construct a plasmid, and the plasmid is transiently expressed by HEK 293. 96-well plates were coated with monkey PD-L1 at a concentration of 500ng/ml, 100. Mu.l/well, overnight at 4 ℃. The plate was washed three times with 300. Mu.l of blocking solution (formulation see above) per well and blocked for 1 hour at 37 ℃. The plate was washed three times, and the bispecific antibody D6 obtained in example 2 of the present invention was diluted to 1. Mu.g/ml with a sample diluent (PBS-T plus 1% bovine serum albumin), and then diluted to samples of different concentrations by 4-fold gradient using 7 centrifuge tubes, each concentration having two duplicate wells, 100. Mu.l/well, and incubated for 1 hour. The plate was washed three times with washing solution, 100. Mu.l of goat anti-human (goat anti-human-HRP, thermoFisher Co., ltd.) diluted 8000 times was added to each well, and the mixture was shaken for 0.5 hour. The plates were washed three times with 100. Mu.l of tetramethylbenzidine (TMB, thermoFisher Co.) per well. The reaction was stopped by adding 1M sulfuric acid. OD was measured at 450nm using a Versamax microplate reader (Molecular). According to the antibody and antigen reaction curve, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentration and detection results are shown in table 8. The parent antibody Anti-PD-L1 (Anti-human PD-L1 monoclonal antibody from China patent application CN 201910174374.8 of Anhui biological engineering (group) limited (called Anhui biological) and Tercreri (Roche) are selected as control antibodies in the experiment, and the Tercreri produces and expresses according to the Accession Number DB11595 serial Number in drug Bank (https:// go. Drug Bank. Com)).
The results are shown in figure 10, where there is better binding between the bispecific antibody and monkey PD-L1 antigen and it appears dose dependent, with no significant difference in binding activity from the parent antibody.
TABLE 8 detection of binding Activity of bispecific antibody and monkey PD-L1 by ELISA
Example 9 detection of binding Properties of bispecific antibody to monkey 4-1BB antigen by ELISA method
The binding activity of the bispecific antibody to monkey 4-1BB was assessed by ELISA. The amino acid sequence of the monkey 4-1BB extracellular segment is shown in SEQ ID No.20 (Uniprot # A9YYE 7). Similar to the above antibody expression preparation, the extracellular segment is used as the target sequence to construct a plasmid, and the plasmid is transiently expressed by HEK 293. 96-well plates were coated with monkey 4-1BB at a concentration of 500ng/ml, 100. Mu.l/well, overnight at 4 ℃. The plate was washed three times with 300. Mu.l of blocking solution (formulation see above) per well and blocked for 1 hour at 37 ℃. The plate was washed three times, and the bispecific antibody D6 obtained in example 2 of the present invention was diluted to 10nM with a sample diluent (1% bovine serum albumin in PBS-T), and then diluted to samples of different concentrations by 4-fold gradient in 7 centrifuge tubes, each concentration was set to two duplicate wells at 100. Mu.l/well, and incubated for 1 hour. The plate was washed three times with washing solution, 100. Mu.l of goat anti-human (goat anti-human-HRP, thermoFisher Co., ltd.) was labeled with 8000-fold dilution of horseradish peroxidase per well, and shaken for 0.5 hour. The plate was washed three times with 100. Mu.l of tetramethylbenzidine (TMB, thermoFisher Co.) per well. The reaction was stopped by adding 1M sulfuric acid. OD was measured at 450nm using a Versamax microplate reader (Molecular). According to the antibody and antigen reaction curves, a 4-parameter Logistic fitting method is adopted for drawing, and specific dilution concentrations and detection results are shown in table 9. In the experiment, a parent antibody Anti-4-1BB (namely an Anti-human 4-1BB monoclonal antibody Hanke10F4 in Chinese patent application CN 201911105611.1 of Hefei Han Ke Mibo biotechnology Limited company) is selected as a control antibody, and human IgG4 (Sino Biological company, the product number HG 4K) is selected as an unrelated control antibody.
Results the curves are shown in figure 11, and the bispecific antibody and monkey 4-1BB antigen between better binding, and show dose dependence, binding activity and parent antibody no significant difference.
TABLE 9 detection of bispecific antibody binding Activity with monkey 4-1BB by ELISA
Example 10 in vitro potency assay for the Effect of bispecific antibodies on activation of T lymphocytes
Whole blood was obtained from healthy human A, and PBMC cells were isolated using lymphocyte separation medium (Sigma) according to the protocolAnd (5) cellularizing for later use. Whole blood was collected from healthy human B, PBMC was separated using lymphocyte separation medium, and EasySep was used TM DC cells were isolated from Human CD14 Positive Selection Kit II (Stemcell Co.), and the cells were resuspended in medium supplemented with 10ng/mL IL-6, 10ng/mL IL-1. Beta., 10ng/mL LTNF-. Alpha., and 1. Mu.g/mL PGE 2 to induce maturation.
The bispecific antibody D6 prepared in example 2, parent antibody Anti-4-1BB (namely Anti-human 4-1BB monoclonal antibody Hanke10F4 in Chinese patent application CN 201911105611.1 from Heifeng Hankemibo biotechnology limited) and Anti-PD-L1 (Anti-human PD-L1 monoclonal antibody of Chinese patent application CN 201910174374.8 from Anhui Ankeke bioengineering (group) limited (simply called Ankemibe) are respectively diluted to 10 mu g/ml, and are diluted by 5 times of gradient to 5 concentrations (10 mu g/ml, 2 mu g/ml, 0.4 mu g/ml, 0.08 mu g/ml and 0.016 mu g/ml). An irrelevant antibody human IgG4 (Sino Biological Co., ltd., product No. HG 4K) was set, and concentrations of 10. Mu.g/ml, 0.4. Mu.g/ml and 0.016. Mu.g/ml were set. The PBMCs and DC cells obtained ready for use were mixed as 10:1 part into 96-well plates, PBMC 1X 10 5 Each of which is provided with a hole. The volume is 100. Mu.l/well, and then the diluted antibody to be detected is added, 100. Mu.l/well. After 3 days of incubation, the supernatant was assayed for IFN-. Gamma.and IL-2 secretion levels.
The results are shown in fig. 12, and the bispecific antibody D6 can activate T cells in the mixed lymphoid reaction system, and further increase the secretion levels of IFN- γ and IL-2 in the cell supernatant, compared to the two parental mabs and the negative unrelated control antibody.
Example 11 in vitro potency assay bispecific antibody T cell activation Effect dependent on PD-L1
As above, whole blood was obtained from healthy humans, PBMC was isolated, and human CD8 was used + T cell magnetic beads (BD Co., ltd., cat. No. 557766) were isolated and purified according to the instructions to obtain human CD8 + T cells for later use.
The anti-CD3 antibody (Biolegend, cat # 317325) was diluted to 0.5. Mu.g/ml with PBS, added to a 96-well plate (Corning), 60. Mu.l/well, and the 96-well plate was incubated at 37 ℃ for 1 hour. Washing with PBS followed by a fine reaction of CHO-K1/hPD-L1 (see example 6) with CHO-K1Cells were added to a 96-well plate at different ratios (0 4. Then placing the 96-well plate in a cell culture box for incubation for 6h, removing cell supernatant by suction, and adding 100 mul of human CD8 into each well + T cells, 2.5X 10 4 One for each well. The antibody to be tested (D6) was diluted to 2. Mu.g/ml with the medium and further diluted in 5 concentrations by 20-fold gradient. Diluted antibodies were added to 96-well plates at 100. Mu.l/well, with 3 duplicate wells per concentration set. And putting the 96-well plate into a cell culture box for incubation for 3 days, and detecting the secretion amount of the cell factor IFN-gamma in cell culture supernatant by using an ELISA method.
The results are shown in FIG. 13, bispecific antibody is able to activate CD8 + T cells, this activation being dependent on PD-L1. The dual antibody failed to activate CD8 when no PD-L1 was present in the system + T cells, with increased expression of PD-L1, double anti-activated CD8 + The maximum capacity of T cells is increasing, but the semi-effective concentration of antibody does not vary much.
Example 12 detection of bispecific antibody Activity by reporter Gene method
The full-length sequence of human 4-1BB is used as a target gene and inserted between Xba I and HindIII sites of a pCDNA3.4 vector (see example 7), and after the sequencing verification is correct, plasmid A is obtained, and meanwhile, plasmid B (pNF-kB-Luc, youbao biology, product number VT 1588) with an NF kB element sequence (the sequence is shown as SEQ ID No. 25) and a luciferase gene (the sequence is shown as SEQ ID No. 26) is taken. Both plasmids A and B were then introduced into HEK293 cells (Shanghai cell Bank of China) together using Lipofectamine3000 transfection reagent (Invitrogen). HEK-293/NF kB-Luci/4-1 BB is obtained by pressurized screening.
HEK-293/NF-. Kappa.B-Luci/4-1 BB cells and CHO-K1/hPD-L1 cells (see example 6) were taken in the logarithmic growth phase, 50. Mu.l of each of the two cells, both 3X 10 cells, were added to a 96-well plate (Corning, 3917) 4 One for each well. Diluting the antibody (D6) to be detected to 20 μ g/ml (the experiment sets a control of the combination of parent antibodies Anti 4-1BB and Anti PD-L1 at the same time, wherein the Anti 4-1BB is an Anti-human 4-1BB monoclonal antibody derived from China patent application CN 201911105611.1 of Hemiabo biotechnology Limited in HemiangyaiHanke10F4; anti-PD-L1 is an Anti-human PD-L1 monoclonal antibody from Chinese patent application CN 201910174374.8 of Anhui Ankei bioengineering (group) limited company (called Ankei biology for short), is subjected to 5-fold gradient dilution for 9 concentrations, and is sequentially added into a 96-well plate with 100 mu L per well. After standing in an incubator for 18-24h, 100. Mu.l of ONE-Glo Luciferase assay sysytem reagent (Promega) was added and incubated at room temperature for 10min to measure chemiluminescence.
The results are shown in FIG. 14, where the bispecific antibody was able to activate the 4-1BB downstream NF-. Kappa.B signaling pathway dependent on PD-L1, leading to an enhanced detection signal value, and then the two parental mabs were used in combination, since Anti 4-1BB mab lost the cross-linking effect and was unable to activate the 4-1BB downstream NF-. Kappa.B signaling pathway. The PD-L1 monoclonal antibody can only bind to CHO-K1/hPD-L1 and can not act on the signal channel.
Similarly, jurkat/NFAT-Luci/PD1 cells stably expressing human PD-1 and NFAT elements and CHO-K1/PDL1/TCR cells expressing human PD-L1 and TCR-activating protein were constructed and added to a 96-well plate at 50000. The antibody D6 to be detected is diluted to 12 mu g/ml, and after being diluted by 3 times of gradient for 9 concentrations, the antibody D6 is sequentially added into a 96-well plate and 100 mu l/well. After standing in an incubator for 18-24h, 100. Mu.l of ONE-Glo Luciferase assay sysytem reagent (Promega) was added and incubated at room temperature for 10min to measure chemiluminescence.
The results are shown in figure 15, where the bispecific antibody was able to block the PD-1/PD-L1 signaling pathway, indicating that the diabody also exerts PD-L1 antibody inhibitory functions.
Example 13 inhibitory Effect of bispecific antibodies on tumor growth
PD-1/4-1BB double Knock-in mice (B-hPD-1/h 4-1BB mica) are selected for detecting the effect of the bispecific in vivo antitumor drug. The B-hPD-1/h4-1BB mice model is a genetic engineering mouse, is formed by chimeric human h4-1BB gene and human PD-L1 in the genome of a genetic background C57BL/6 mouse, and is derived from a Baiosai chart (cargo number 110004).
The mice were inoculated subcutaneously with the mouse colon cancer MC38 cell line on the back (shaved) side (5X 10 cells per mouse) 5 Cells, 100 μ l). When the average tumor volume of the tumor-bearing mice reaches 100mm 3 When in use, willMice were randomly assigned to 3 groups of 5 mice per experimental design. Animals were examined twice weekly for survival and activity following tumor inoculation. The method comprises the following steps: tumor growth, mobility, diet, weight and other abnormal behaviors. Dosing was performed twice weekly and tumor volumes were measured. The formula of the calculated volume is 1/2 multiplied by the length multiplied by the width (mm) 3 ). The day of group administration was defined as day 0. The grouping and dosing schedule are shown in table 10:
TABLE 10 grouping and dosing regimens
Note: n is the number of animals per group. Vehicle is a normal saline control group; anti PD-L1+ Anti 4-1BB is a control combined by a parent antibody Anti 4-1BB and Anti PD-L1; d1 is the bispecific antibody D1 prepared in example 2.
As shown in fig. 16, the tumor growth of the mice was effectively inhibited after the administration of bispecific antibody D1, compared to the control Vehicle and the bimab combination group.
Example 14 in vivo toxicology assay for bispecific antibody rhesus monkey
Experimental selection 4 rhesus monkeys were selected to evaluate the toxic side effects of the bispecific antibodies in monkeys. The rhesus monkeys were divided into two groups of high and low doses, one for each group of male and female, with the high dose being 50mg/kg and the low dose being 5mg/kg, and the specific administration sample was D6, administered intravenously 1 time per week for 4 weeks, for 4 times total. The adaptation period was observed at least 1 time each day in the morning and afternoon. On the day of administration, 1 observation was made before administration, 1 observation was made in the afternoon after administration, and at least 1 observation was made in the morning and afternoon of the non-administration day. When the animals developed overt toxicity symptoms, the frequency of observation was increased and the time was recorded. As shown in Table 11, after repeating the administration of the high and low doses for 4 weeks, the level of ALT (glutamic-pyruvic transaminase) and AST (glutamic-oxaloacetic transaminase) was not significantly increased compared to the acclimation period, indicating better tolerance. On the other hand, the number of leukocytes in peripheral blood and the proportion of lymphocytes in the leukocytes of the rhesus monkey are slightly increased, but the leukocytes are in a normal range, the monkey is normal in general state, respiration, heart rate, hematology, liver function, kidney function and the like in the whole experimental period, and the animal tolerance is better.
TABLE 11 rhesus monkey 4 week repeat toxicology test
Remarking: day 1 of the adaptation Phase (best Phase) (P1), the day of first administration is defined as day 1 of the administration Phase (Dosing Phase) (D1), WBCs are white blood cells, and% LYMPH is the percentage of lymphocytes.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> Sakuaimaibo Biotechnology Limited; anhui-Ke bioengineering (group) corporation
<120> bispecific antibody targeting PD-L1 and 4-1BB
<130> GNCLN211752
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 118
<212> PRT
<213> Artificial sequence
<400> 1
Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr
20 25 30
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile
35 40 45
Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg Asp Arg Pro Asp Gly Ala Ala Thr Asn Leu Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser
115
<210> 2
<211> 110
<212> PRT
<213> Artificial sequence
<400> 2
Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Gln Ser Ser Gln Asn Val Tyr Ser Asn
20 25 30
Asn Arg Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
35 40 45
Leu Ile Tyr Trp Thr Ser Phe Leu Ala Ser Gly Val Pro Ser Arg Phe
50 55 60
Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu
65 70 75 80
Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Ala Gly Gly Tyr Ser Gly
85 90 95
Asn Leu Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210> 3
<211> 117
<212> PRT
<213> Artificial sequence
<400> 3
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Ser Ser Leu Thr Ser Tyr
20 25 30
Gly Val His Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Gly Leu
35 40 45
Gly Val Ile Trp Pro Gly Gly Ser Thr Asn Tyr Asn Ser Ala Leu Met
50 55 60
Ser Arg Val Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln Val Ser Leu
65 70 75 80
Lys Met Ser Ser Leu Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg Val Thr Gly Thr Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Thr
100 105 110
Val Thr Val Ser Ser
115
<210> 4
<211> 107
<212> PRT
<213> Artificial sequence
<400> 4
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly
1 5 10 15
Asp Arg Val Thr Ile Ser Cys Ser Ala Ser Gln Gly Ile Ser Asn Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile
35 40 45
Tyr Tyr Thr Ser Thr Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Lys Leu Pro Trp
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105
<210> 5
<211> 744
<212> PRT
<213> Artificial sequence
<400> 5
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly
1 5 10 15
Asp Arg Val Thr Ile Ser Cys Ser Ala Ser Gln Gly Ile Ser Asn Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile
35 40 45
Tyr Tyr Thr Ser Thr Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Lys Leu Pro Trp
85 90 95
Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser
100 105 110
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln
115 120 125
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr
130 135 140
Leu Ser Leu Thr Cys Thr Val Ser Gly Ser Ser Leu Thr Ser Tyr Gly
145 150 155 160
Val His Trp Val Arg Gln Pro Pro Gly Lys Cys Leu Glu Gly Leu Gly
165 170 175
Val Ile Trp Pro Gly Gly Ser Thr Asn Tyr Asn Ser Ala Leu Met Ser
180 185 190
Arg Val Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln Val Ser Leu Lys
195 200 205
Met Ser Ser Leu Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg
210 215 220
Val Thr Gly Thr Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Thr Val
225 230 235 240
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ser
245 250 255
Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly
260 265 270
Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
275 280 285
Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln
290 295 300
Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val
305 310 315 320
His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr
325 330 335
Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
340 345 350
Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile
355 360 365
Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val
370 375 380
Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser
385 390 395 400
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
405 410 415
Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
420 425 430
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val
435 440 445
Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met
450 455 460
His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
465 470 475 480
Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
485 490 495
Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
500 505 510
Asp Arg Val Thr Ile Thr Cys Gln Ser Ser Gln Asn Val Tyr Ser Asn
515 520 525
Asn Arg Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
530 535 540
Leu Ile Tyr Trp Thr Ser Phe Leu Ala Ser Gly Val Pro Ser Arg Phe
545 550 555 560
Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu
565 570 575
Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Ala Gly Gly Tyr Ser Gly
580 585 590
Asn Leu Tyr Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Gly Gly
595 600 605
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
610 615 620
Gly Ser Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro
625 630 635 640
Gly Gly Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser
645 650 655
Ser Tyr Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Cys Leu Glu
660 665 670
Tyr Ile Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Asp Ser
675 680 685
Val Lys Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val
690 695 700
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
705 710 715 720
Cys Ala Arg Asp Arg Pro Asp Gly Ala Ala Thr Asn Leu Trp Gly Gln
725 730 735
Gly Thr Leu Val Thr Val Ser Ser
740
<210> 6
<211> 712
<212> PRT
<213> Artificial sequence
<400> 6
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly
1 5 10 15
Asp Arg Val Thr Ile Ser Cys Ser Ala Ser Gln Gly Ile Ser Asn Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile
35 40 45
Tyr Tyr Thr Ser Thr Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Lys Leu Pro Trp
85 90 95
Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser
100 105 110
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln
115 120 125
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr
130 135 140
Leu Ser Leu Thr Cys Thr Val Ser Gly Ser Ser Leu Thr Ser Tyr Gly
145 150 155 160
Val His Trp Val Arg Gln Pro Pro Gly Lys Cys Leu Glu Gly Leu Gly
165 170 175
Val Ile Trp Pro Gly Gly Ser Thr Asn Tyr Asn Ser Ala Leu Met Ser
180 185 190
Arg Val Thr Ile Ser Lys Asp Asn Ser Lys Ser Gln Val Ser Leu Lys
195 200 205
Met Ser Ser Leu Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg
210 215 220
Val Thr Gly Thr Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Thr Val
225 230 235 240
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ser
245 250 255
Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly
260 265 270
Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
275 280 285
Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln
290 295 300
Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val
305 310 315 320
His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr
325 330 335
Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
340 345 350
Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile
355 360 365
Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val
370 375 380
Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser
385 390 395 400
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
405 410 415
Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
420 425 430
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val
435 440 445
Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met
450 455 460
His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
465 470 475 480
Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
485 490 495
Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
500 505 510
Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr
515 520 525
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile
530 535 540
Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Asp Ser Val Lys
545 550 555 560
Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val Tyr Leu
565 570 575
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
580 585 590
Arg Asp Arg Pro Asp Gly Ala Ala Thr Asn Leu Trp Gly Gln Gly Thr
595 600 605
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro
610 615 620
Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly
625 630 635 640
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn
645 650 655
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
660 665 670
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
675 680 685
Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser
690 695 700
Asn Thr Lys Val Asp Lys Arg Val
705 710
<210> 7
<211> 707
<212> PRT
<213> Artificial sequence
<400> 7
Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr
20 25 30
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile
35 40 45
Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg Asp Arg Pro Asp Gly Ala Ala Thr Asn Leu Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro
115 120 125
Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly
130 135 140
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn
145 150 155 160
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
165 170 175
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
180 185 190
Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser
195 200 205
Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys
210 215 220
Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser Val Phe Leu
225 230 235 240
Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
245 250 255
Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln
260 265 270
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys
275 280 285
Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu
290 295 300
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys
305 310 315 320
Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys
325 330 335
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
340 345 350
Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys
355 360 365
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
370 375 380
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly
385 390 395 400
Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln
405 410 415
Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn
420 425 430
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Ala Glu Ala Ala
435 440 445
Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala
450 455 460
Lys Ala Leu Glu Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val
465 470 475 480
Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Ser Ser
485 490 495
Leu Thr Ser Tyr Gly Val His Trp Val Arg Gln Pro Pro Gly Lys Cys
500 505 510
Leu Glu Gly Leu Gly Val Ile Trp Pro Gly Gly Ser Thr Asn Tyr Asn
515 520 525
Ser Ala Leu Met Ser Arg Val Thr Ile Ser Lys Asp Asn Ser Lys Ser
530 535 540
Gln Val Ser Leu Lys Met Ser Ser Leu Thr Ala Ala Asp Thr Ala Val
545 550 555 560
Tyr Tyr Cys Ala Arg Val Thr Gly Thr Trp Tyr Phe Asp Val Trp Gly
565 570 575
Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
580 585 590
Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro
595 600 605
Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Ser
610 615 620
Ala Ser Gln Gly Ile Ser Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro
625 630 635 640
Asp Gly Thr Val Lys Leu Leu Ile Tyr Tyr Thr Ser Thr Leu His Ser
645 650 655
Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr
660 665 670
Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys
675 680 685
Gln Gln Tyr Ser Lys Leu Pro Trp Thr Phe Gly Cys Gly Thr Lys Leu
690 695 700
Glu Ile Lys
705
<210> 8
<211> 704
<212> PRT
<213> Artificial sequence
<400> 8
Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr
20 25 30
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile
35 40 45
Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg Asp Arg Pro Asp Gly Ala Ala Thr Asn Leu Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser Ala Ser Ala Ser Thr Lys Gly Pro Ser Val
115 120 125
Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala
130 135 140
Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser
145 150 155 160
Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val
165 170 175
Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro
180 185 190
Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys
195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro
210 215 220
Pro Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser Val
225 230 235 240
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr
245 250 255
Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu
260 265 270
Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys
275 280 285
Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser
290 295 300
Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys
305 310 315 320
Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile
325 330 335
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro
340 345 350
Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu
355 360 365
Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn
370 375 380
Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
385 390 395 400
Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg
405 410 415
Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu
420 425 430
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Gly Gly
435 440 445
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met
450 455 460
Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr
465 470 475 480
Ile Ser Cys Ser Ala Ser Gln Gly Ile Ser Asn Tyr Leu Asn Trp Tyr
485 490 495
Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr Tyr Thr Ser
500 505 510
Thr Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly
515 520 525
Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala
530 535 540
Thr Tyr Tyr Cys Gln Gln Tyr Ser Lys Leu Pro Trp Thr Phe Gly Cys
545 550 555 560
Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly
565 570 575
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln
580 585 590
Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr
595 600 605
Cys Thr Val Ser Gly Ser Ser Leu Thr Ser Tyr Gly Val His Trp Val
610 615 620
Arg Gln Pro Pro Gly Lys Cys Leu Glu Gly Leu Gly Val Ile Trp Pro
625 630 635 640
Gly Gly Ser Thr Asn Tyr Asn Ser Ala Leu Met Ser Arg Val Thr Ile
645 650 655
Ser Lys Asp Asn Ser Lys Ser Gln Val Ser Leu Lys Met Ser Ser Leu
660 665 670
Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg Val Thr Gly Thr
675 680 685
Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
690 695 700
<210> 9
<211> 707
<212> PRT
<213> Artificial sequence
<400> 9
Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr
20 25 30
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile
35 40 45
Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Glu Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg Asp Arg Pro Glu Gly Ala Ala Thr Asn Leu Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro
115 120 125
Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly
130 135 140
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn
145 150 155 160
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
165 170 175
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
180 185 190
Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser
195 200 205
Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys
210 215 220
Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser Val Phe Leu
225 230 235 240
Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
245 250 255
Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln
260 265 270
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys
275 280 285
Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu
290 295 300
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys
305 310 315 320
Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys
325 330 335
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
340 345 350
Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys
355 360 365
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
370 375 380
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly
385 390 395 400
Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln
405 410 415
Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn
420 425 430
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Ala Glu Ala Ala
435 440 445
Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala
450 455 460
Lys Ala Leu Glu Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val
465 470 475 480
Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Ser Ser
485 490 495
Leu Thr Ser Tyr Gly Val His Trp Val Arg Gln Pro Pro Gly Lys Cys
500 505 510
Leu Glu Gly Leu Gly Val Ile Trp Pro Gly Gly Ser Thr Asn Tyr Asn
515 520 525
Ser Ala Leu Met Ser Arg Val Thr Ile Ser Lys Asp Asn Ser Lys Ser
530 535 540
Gln Val Ser Leu Lys Met Ser Ser Leu Thr Ala Ala Asp Thr Ala Val
545 550 555 560
Tyr Tyr Cys Ala Arg Val Thr Gly Thr Trp Tyr Phe Asp Val Trp Gly
565 570 575
Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
580 585 590
Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro
595 600 605
Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Ser
610 615 620
Ala Ser Gln Gly Ile Ser Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro
625 630 635 640
Asp Gly Thr Val Lys Leu Leu Ile Tyr Tyr Thr Ser Thr Leu His Ser
645 650 655
Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr
660 665 670
Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys
675 680 685
Gln Gln Tyr Ser Lys Leu Pro Trp Thr Phe Gly Cys Gly Thr Lys Leu
690 695 700
Glu Ile Lys
705
<210> 10
<211> 702
<212> PRT
<213> Artificial sequence
<400> 10
Asp Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr
20 25 30
Asp Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile
35 40 45
Gly Tyr Ile Ser Tyr Val Ser Arg Thr Tyr Tyr Ala Glu Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg Asp Arg Pro Glu Gly Ala Ala Thr Asn Leu Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro
115 120 125
Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly
130 135 140
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn
145 150 155 160
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
165 170 175
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
180 185 190
Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser
195 200 205
Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys
210 215 220
Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser Val Phe Leu
225 230 235 240
Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
245 250 255
Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln
260 265 270
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys
275 280 285
Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu
290 295 300
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys
305 310 315 320
Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys
325 330 335
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
340 345 350
Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys
355 360 365
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
370 375 380
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly
385 390 395 400
Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln
405 410 415
Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn
420 425 430
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Gly Gly Gly Ser
435 440 445
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln
450 455 460
Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser
465 470 475 480
Cys Ser Ala Ser Gln Gly Ile Ser Asn Tyr Leu Asn Trp Tyr Gln Gln
485 490 495
Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr Tyr Thr Ser Thr Leu
500 505 510
His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp
515 520 525
Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr
530 535 540
Tyr Cys Gln Gln Tyr Ser Lys Leu Pro Trp Thr Phe Gly Cys Gly Thr
545 550 555 560
Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
565 570 575
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu Ser
580 585 590
Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr
595 600 605
Val Ser Gly Ser Ser Leu Thr Ser Tyr Gly Val His Trp Val Arg Gln
610 615 620
Pro Pro Gly Lys Cys Leu Glu Gly Leu Gly Val Ile Trp Pro Gly Gly
625 630 635 640
Ser Thr Asn Tyr Asn Ser Ala Leu Met Ser Arg Val Thr Ile Ser Lys
645 650 655
Asp Asn Ser Lys Ser Gln Val Ser Leu Lys Met Ser Ser Leu Thr Ala
660 665 670
Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg Val Thr Gly Thr Trp Tyr
675 680 685
Phe Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
690 695 700
<210> 11
<211> 217
<212> PRT
<213> Artificial sequence
<400> 11
Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Gln Ser Ser Gln Asn Val Tyr Ser Asn
20 25 30
Asn Arg Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
35 40 45
Leu Ile Tyr Trp Thr Ser Phe Leu Ala Ser Gly Val Pro Ser Arg Phe
50 55 60
Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu
65 70 75 80
Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Ala Gly Gly Tyr Ser Gly
85 90 95
Asn Leu Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr
100 105 110
Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
115 120 125
Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
130 135 140
Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly
145 150 155 160
Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr
165 170 175
Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His
180 185 190
Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val
195 200 205
Thr Lys Ser Phe Asn Arg Gly Glu Cys
210 215
<210> 12
<211> 2232
<212> DNA
<213> Artificial sequence
<400> 12
gacattcaga tgactcagtc tccctcttcc ctgtctgcct ccctgggcga tagggtgaca 60
atcagctgtt ctgcttccca gggcatctcc aactacctga actggtacca gcagaagcca 120
gatggcaccg tgaagctgct gatctactat acctctacac tgcactctgg cgtgccaagc 180
cggtttagcg gatctggatc tggaaccgac tatactctga ccattagctc tctgcagccc 240
gaggatatcg ccacatacta ttgccagcag tatagcaagc tgccttggac cttcggctgt 300
ggcacaaagc tggagatcaa gggtggtggt ggttccggtg gtggtggttc cggtggcggc 360
ggctcaggcg gaggaggaag ccaggtgcag ctgcaggaga gcggaccagg actggtgaag 420
ccaagcgaga ccctgtctct gacctgcaca gtgagcggct cttccctgac atcttacggc 480
gtgcattggg tgagacagcc acctggcaag tgtctggagg gactgggcgt gatctggcca 540
ggaggctcta ccaactataa ttccgctctg atgagccgcg tgacaatcag caaggacaac 600
tccaagagcc aggtgtctct gaagatgagc tctctgaccg ccgctgatac cgccgtgtac 660
tattgcgcta gggtgaccgg cacatggtac ttcgacgtgt ggggccaggg caccacagtg 720
accgtgtcct ctggcggagg aggatccgga ggaggtggat ctgagagcaa gtatgggccc 780
ccatgccctc catgtccagc tccagaggct gctggaggcc cttccgtgtt cctgtttccc 840
cctaagccaa aggacaccct gatgatcagc agaacccctg aggtgacatg cgtggtggtg 900
gacgtgtctc aggaggaccc agaggtgcag tttaactggt acgtggatgg cgtggaggtg 960
cacaatgcta agaccaagcc cagggaggag cagttcaatt ctacctaccg ggtggtgtcc 1020
gtgctgacag tgctgcatca ggattggctg aacggcaagg agtataagtg caaggtgtcc 1080
aataagggcc tgccttccag catcgagaag accatcagca aggctaaggg acagcctaga 1140
gagccacagg tgtacacact gccaccctcc caggaggaga tgaccaagaa ccaggtgagc 1200
ctgacatgtc tggtgaaggg cttttatcca tctgacatcg ctgtggagtg ggagtccaat 1260
ggccagcccg agaacaatta caagaccaca cctccagtgc tggacagcga tggctctttc 1320
tttctgtatt ccaggctgac cgtggataag agccggtggc aggagggcaa cgtgttcagc 1380
tgctctgtga tgcacgaggc cctgcacaat cattacacac agaagtccct gagcctgtct 1440
ctgggcggcg gcggctctgg aggaggagga tccggtggag gtggatctga catccagatg 1500
acacagagcc cttccaccct gtccgccagc gtgggagaca gagtgaccat cacttgccag 1560
tccagccaga acgtgtactc taacaataga ctgtcatggt atcagcagaa gccagggaag 1620
gctcctaagc tcctgatcta ttggaccagc ttcctcgcct ccggagtgcc atcaaggttc 1680
agcggcagtg gatctgggac agaatttact ctgaccatca gctccctgca gcccgacgat 1740
tttgccactt attactgcgc tggcggatac agcggcaacc tgtacacctt cggttgcggt 1800
accaagttgg aaattaaggg tggtggtggt tccggtggtg gtggatctgg cggaggagga 1860
agcggtggag gtggatctga cgtgcagctt gtggagagcg gaggaggcct ggtgcagcct 1920
ggaggctctc tgagactctc ctgtaccgtg tctggcatcg acctgagctc ctatgacatg 1980
acctgggtcc gccaggctcc agggaagtgc ctggagtaca tcggctacat tagctacgtg 2040
tctcggacat actatgccga cagcgtgaag ggcagattca ccatctccaa ggacacctcc 2100
aagaacacgg tgtatctgca gatgaacagc ctgagagccg aggacacggc cgtgtattac 2160
tgtgccagag acaggcccga cggcgctgcc accaacctgt ggggacaggg taccctggtg 2220
accgtgagct cc 2232
<210> 13
<211> 2136
<212> DNA
<213> Artificial sequence
<400> 13
gacattcaga tgactcagtc tccctcttcc ctgtctgcct ccctgggcga tagggtgaca 60
atcagctgtt ctgcttccca gggcatctcc aactacctga actggtacca gcagaagcca 120
gatggcaccg tgaagctgct gatctactat acctctacac tgcactctgg cgtgccaagc 180
cggtttagcg gatctggatc tggaaccgac tatactctga ccattagctc tctgcagccc 240
gaggatatcg ccacatacta ttgccagcag tatagcaagc tgccttggac cttcggctgt 300
ggcacaaagc tggagatcaa gggtggtggt ggttccggtg gtggtggttc cggtggcggc 360
ggctcaggcg gaggaggaag ccaggtgcag ctgcaggaga gcggaccagg actggtgaag 420
ccaagcgaga ccctgtctct gacctgcaca gtgagcggct cttccctgac atcttacggc 480
gtgcattggg tgagacagcc acctggcaag tgtctggagg gactgggcgt gatctggcca 540
ggaggctcta ccaactataa ttccgctctg atgagccgcg tgacaatcag caaggacaac 600
tccaagagcc aggtgtctct gaagatgagc tctctgaccg ccgctgatac cgccgtgtac 660
tattgcgcta gggtgaccgg cacatggtac ttcgacgtgt ggggccaggg caccacagtg 720
accgtgtcct ctggcggagg aggatccgga ggaggtggat ctgagagcaa gtatgggccc 780
ccatgccctc catgtccagc tccagaggct gctggaggcc cttccgtgtt cctgtttccc 840
cctaagccaa aggacaccct gatgatcagc agaacccctg aggtgacatg cgtggtggtg 900
gacgtgtctc aggaggaccc agaggtgcag tttaactggt acgtggatgg cgtggaggtg 960
cacaatgcta agaccaagcc cagggaggag cagttcaatt ctacctaccg ggtggtgtcc 1020
gtgctgacag tgctgcatca ggattggctg aacggcaagg agtataagtg caaggtgtcc 1080
aataagggcc tgccttccag catcgagaag accatcagca aggctaaggg acagcctaga 1140
gagccacagg tgtacacact gccaccctcc caggaggaga tgaccaagaa ccaggtgagc 1200
ctgacatgtc tggtgaaggg cttttatcca tctgacatcg ctgtggagtg ggagtccaat 1260
ggccagcccg agaacaatta caagaccaca cctccagtgc tggacagcga tggctctttc 1320
tttctgtatt ccaggctgac cgtggataag agccggtggc aggagggcaa cgtgttcagc 1380
tgctctgtga tgcacgaggc cctgcacaat cattacacac agaagtccct gagcctgtct 1440
ctgggcggcg gcggctctgg aggaggagga tccggtggag gtggatctga cgtgcagctt 1500
gtggagagcg gaggaggcct ggtgcagcct ggaggctctc tgagactctc ctgtaccgtg 1560
tctggcatcg acctgagctc ctatgacatg acctgggtcc gccaggctcc agggaagggg 1620
ctggagtaca tcggctacat tagctacgtg tctcggacat actatgccga cagcgtgaag 1680
ggcagattca ccatctccaa ggacacctcc aagaacacgg tgtatctgca gatgaacagc 1740
ctgagagccg aggacacggc cgtgtattac tgtgccagag acaggcccga cggcgctgcc 1800
accaacctgt ggggacaggg taccctggtg accgtgagct ccgctagcac aaagggacca 1860
tccgtgtttc ccctggctcc ttgcagccgc tctacatccg agagcaccgc cgctctggga 1920
tgtctggtga aggactactt ccccgagcct gtgaccgtgt cttggaactc cggcgccctg 1980
acaagcggag tgcacacctt tcccgctgtg ctgcagtctt ccggcctgta ctctctgagc 2040
tctgtggtga cagtgccttc cagctctctg ggcaccaaga catatacctg caacgtggac 2100
cataagccaa gcaataccaa ggtggataag agagtg 2136
<210> 14
<211> 2121
<212> DNA
<213> Artificial sequence
<400> 14
gacgtgcagc ttgtggagag cggaggaggc ctggtgcagc ctggaggctc tctgagactc 60
tcctgtaccg tgtctggcat cgacctgagc tcctatgaca tgacctgggt ccgccaggct 120
ccagggaagg ggctggagta catcggctac attagctacg tgtctcggac atactatgcc 180
gacagcgtga agggcagatt caccatctcc aaggacacct ccaagaacac ggtgtatctg 240
cagatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgccag agacaggccc 300
gatggcgctg ccaccaacct gtggggacag ggtaccctgg tgaccgtgag ctccgctagc 360
acaaagggac catccgtgtt tcccctggct ccttgcagcc gctctacatc cgagagcacc 420
gccgctctgg gatgtctggt gaaggactac ttccccgagc ctgtgaccgt gtcttggaac 480
tccggcgccc tgacaagcgg agtgcacacc tttcccgctg tgctgcagtc ttccggcctg 540
tactctctga gctctgtggt gacagtgcct tccagctctc tgggcaccaa gacatatacc 600
tgcaacgtgg accataagcc aagcaatacc aaggtggata agagagtgga gagcaagtat 660
gggcccccat gccctccatg tccagctcca gaggctgctg gaggcccttc cgtgttcctg 720
tttcccccta agccaaagga caccctgatg atcagcagaa cccctgaggt gacatgcgtg 780
gtggtggacg tgtctcagga ggacccagag gtgcagttta actggtacgt ggatggcgtg 840
gaggtgcaca atgctaagac caagcccagg gaggagcagt tcaattctac ctaccgggtg 900
gtgtccgtgc tgacagtgct gcatcaggat tggctgaacg gcaaggagta taagtgcaag 960
gtgtccaata agggcctgcc ttccagcatc gagaagacca tcagcaaggc taagggacag 1020
cctagagagc cacaggtgta cacactgcca ccctcccagg aggagatgac caagaaccag 1080
gtgagcctga catgtctggt gaagggcttt tatccatctg acatcgctgt ggagtgggag 1140
tccaatggcc agcccgagaa caattacaag accacacctc cagtgctgga cagcgatggc 1200
tctttctttc tgtattccag gctgaccgtg gataagagcc ggtggcagga gggcaacgtg 1260
ttcagctgct ctgtgatgca cgaggccctg cacaatcatt acacacagaa gtccctgagc 1320
ctgtctctgg gcgccgaggc tgctgctaag gaggccgctg ccaaggaggc tgccgctaag 1380
gaggctgctg ctaaggccct cgagcaggtg cagctgcagg agagcggacc aggactggtg 1440
aagccaagcg agaccctgtc tctgacctgc acagtgagcg gctcttccct gacatcttac 1500
ggcgtgcatt gggtgagaca gccacctggc aagtgtctgg agggactggg cgtgatctgg 1560
ccaggaggct ctaccaacta taattccgct ctgatgagcc gcgtgacaat cagcaaggac 1620
aactccaaga gccaggtgtc tctgaagatg agctctctga ccgccgctga taccgccgtg 1680
tactattgcg ctagggtgac cggcacatgg tacttcgacg tgtggggcca gggcaccaca 1740
gtgaccgtgt cctctggtgg tggtggttcc ggtggcggcg gctcaggcgg aggaggaagc 1800
gacattcaga tgactcagtc tccctcttcc ctgtctgcct ccctgggcga tagggtgaca 1860
atcagctgtt ctgcttccca gggcatctcc aactacctga actggtacca gcagaagcca 1920
gatggcaccg tgaagctgct gatctactat acctctacac tgcactccgg agtgccaagc 1980
cggtttagcg gatctggatc cggaaccgac tatactctga ccattagctc tctgcagccc 2040
gaggatatcg ccacatacta ttgccagcag tatagcaagc tgccttggac cttcggctgt 2100
ggcacaaagc tggagatcaa g 2121
<210> 15
<211> 2112
<212> DNA
<213> Artificial sequence
<400> 15
gacgtgcagc ttgtggagag cggaggaggc ctggtgcagc ctggaggctc tctgagactc 60
tcctgtaccg tgtctggcat cgacctgagc tcctatgaca tgacctgggt ccgccaggct 120
ccagggaagg ggctggagta catcggctac attagctacg tgtctcggac atactatgcc 180
gacagcgtga agggcagatt caccatctcc aaggacacct ccaagaacac ggtgtatctg 240
cagatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgccag agacaggccc 300
gatggcgctg ccaccaacct gtggggacag ggtaccctgg tgaccgtgag ctccgctagc 360
gcctctacaa agggaccatc cgtgtttccc ctggctcctt gcagccgctc tacatccgag 420
agcaccgccg ctctgggatg tctggtgaag gactacttcc ccgagcctgt gaccgtgtct 480
tggaactccg gcgccctgac aagcggagtg cacacctttc ccgctgtgct gcagtcttcc 540
ggcctgtact ctctgagctc tgtggtgaca gtgccttcca gctctctggg caccaagaca 600
tatacctgca acgtggacca taagccaagc aataccaagg tggataagag agtggagagc 660
aagtatgggc ccccatgccc tccatgtcca gctccagagg ctgctggagg cccttccgtg 720
ttcctgtttc cccctaagcc aaaggacacc ctgatgatca gcagaacccc tgaggtgaca 780
tgcgtggtgg tggacgtgtc tcaggaggac ccagaggtgc agtttaactg gtacgtggat 840
ggcgtggagg tgcacaatgc taagaccaag cccagggagg agcagttcaa ttctacctac 900
cgggtggtgt ccgtgctgac agtgctgcat caggattggc tgaacggcaa ggagtataag 960
tgcaaggtgt ccaataaggg cctgccttcc agcatcgaga agaccatcag caaggctaag 1020
ggacagccta gagagccaca ggtgtacaca ctgccaccct cccaggagga gatgaccaag 1080
aaccaggtga gcctgacatg tctggtgaag ggcttttatc catctgacat cgctgtggag 1140
tgggagtcca atggccagcc cgagaacaat tacaagacca cacctccagt gctggacagc 1200
gatggctctt tctttctgta ttccaggctg accgtggata agagccggtg gcaggagggc 1260
aacgtgttca gctgctctgt gatgcacgag gccctgcaca atcattacac acagaagtcc 1320
ctgagcctgt ctctgggcgg cggcggctct ggaggaggag gatccggtgg aggtggatct 1380
gacattcaga tgactcagtc tccctcttcc ctgtctgcct ccctgggcga tagggtgaca 1440
atcagctgtt ctgcttccca gggcatctcc aactacctga actggtacca gcagaagcca 1500
gatggcaccg tgaagctgct gatctactat acctctacac tgcactccgg agtgccaagc 1560
cggtttagcg gatctggatc tggaaccgac tatactctga ccattagctc tctgcagccc 1620
gaggatatcg ccacatacta ttgccagcag tatagcaagc tgccttggac cttcggctgt 1680
ggcacaaagc tggagatcaa gggtggtggt ggttccggtg gtggtggttc cggtggcggc 1740
ggctcaggcg gaggaggaag ccaggtgcag ctgcaggaga gcggaccagg actggtgaag 1800
ccaagcgaga ccctgtctct gacctgcaca gtgagcggct cttccctgac atcttacggc 1860
gtgcattggg tgagacagcc acctggcaag tgtctggagg gactgggcgt gatctggcca 1920
ggaggctcta ccaactataa ttccgctctg atgagccgcg tgacaatcag caaggacaac 1980
tccaagagcc aggtgtctct gaagatgagc tctctgaccg ccgctgatac cgccgtgtac 2040
tattgcgcta gggtgaccgg cacatggtac ttcgacgtgt ggggccaggg caccacagtg 2100
accgtgtcct ct 2112
<210> 16
<211> 2121
<212> DNA
<213> Artificial sequence
<400> 16
gacgtgcagc ttgtggagag cggaggaggc ctggtgcagc ctggaggctc tctgagactc 60
tcctgtaccg tgtctggcat cgacctgagc tcctatgaca tgacctgggt ccgccaggct 120
ccagggaagg ggctggagta catcggctac attagctacg tgtctcggac atactatgcc 180
gagagcgtga agggcagatt caccatctcc aaggacacct ccaagaacac ggtgtatctg 240
cagatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgccag agacaggccc 300
gagggcgctg ccaccaacct gtggggacag ggtaccctgg tgaccgtgag ctccgctagc 360
acaaagggac catccgtgtt tcccctggct ccttgcagcc gctctacatc cgagagcacc 420
gccgctctgg gatgtctggt gaaggactac ttccccgagc ctgtgaccgt gtcttggaac 480
tccggcgccc tgacaagcgg agtgcacacc tttcccgctg tgctgcagtc ttccggcctg 540
tactctctga gctctgtggt gacagtgcct tccagctctc tgggcaccaa gacatatacc 600
tgcaacgtgg accataagcc aagcaatacc aaggtggata agagagtgga gagcaagtat 660
gggcccccat gccctccatg tccagctcca gaggctgctg gaggcccttc cgtgttcctg 720
tttcccccta agccaaagga caccctgatg atcagcagaa cccctgaggt gacatgcgtg 780
gtggtggacg tgtctcagga ggacccagag gtgcagttta actggtacgt ggatggcgtg 840
gaggtgcaca atgctaagac caagcccagg gaggagcagt tcaattctac ctaccgggtg 900
gtgtccgtgc tgacagtgct gcatcaggat tggctgaacg gcaaggagta taagtgcaag 960
gtgtccaata agggcctgcc ttccagcatc gagaagacca tcagcaaggc taagggacag 1020
cctagagagc cacaggtgta cacactgcca ccctcccagg aggagatgac caagaaccag 1080
gtgagcctga catgtctggt gaagggcttt tatccatctg acatcgctgt ggagtgggag 1140
tccaatggcc agcccgagaa caattacaag accacacctc cagtgctgga cagcgatggc 1200
tctttctttc tgtattccag gctgaccgtg gataagagcc ggtggcagga gggcaacgtg 1260
ttcagctgct ctgtgatgca cgaggccctg cacaatcatt acacacagaa gtccctgagc 1320
ctgtctctgg gcgccgaggc tgctgctaag gaggccgctg ccaaggaggc tgccgctaag 1380
gaggctgctg ctaaggccct cgagcaggtg cagctgcagg agagcggacc aggactggtg 1440
aagccaagcg agaccctgtc tctgacctgc acagtgagcg gctcttccct gacatcttac 1500
ggcgtgcatt gggtgagaca gccacctggc aagtgtctgg agggactggg cgtgatctgg 1560
ccaggaggct ctaccaacta taattccgct ctgatgagcc gcgtgacaat cagcaaggac 1620
aactccaaga gccaggtgtc tctgaagatg agctctctga ccgccgctga taccgccgtg 1680
tactattgcg ctagggtgac cggcacatgg tacttcgacg tgtggggcca gggcaccaca 1740
gtgaccgtgt cctctggtgg tggtggttcc ggtggcggcg gctcaggcgg aggaggaagc 1800
gacattcaga tgactcagtc tccctcttcc ctgtctgcct ccctgggcga tagggtgaca 1860
atcagctgtt ctgcttccca gggcatctcc aactacctga actggtacca gcagaagcca 1920
gatggcaccg tgaagctgct gatctactat acctctacac tgcactccgg agtgccaagc 1980
cggtttagcg gatctggatc cggaaccgac tatactctga ccattagctc tctgcagccc 2040
gaggatatcg ccacatacta ttgccagcag tatagcaagc tgccttggac cttcggctgt 2100
ggcacaaagc tggagatcaa g 2121
<210> 17
<211> 2106
<212> DNA
<213> Artificial sequence
<400> 17
gacgtgcagc ttgtggagag cggaggaggc ctggtgcagc ctggaggctc tctgagactc 60
tcctgtaccg tgtctggcat cgacctgagc tcctatgaca tgacctgggt ccgccaggct 120
ccagggaagg ggctggagta catcggctac attagctacg tgtctcggac atactatgcc 180
gagagcgtga agggcagatt caccatctcc aaggacacct ccaagaacac ggtgtatctg 240
cagatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgccag agacaggccc 300
gagggcgctg ccaccaacct gtggggacag ggtaccctgg tgaccgtgag ctccgctagc 360
acaaagggac catccgtgtt tcccctggct ccttgcagcc gctctacatc cgagagcacc 420
gccgctctgg gatgtctggt gaaggactac ttccccgagc ctgtgaccgt gtcttggaac 480
tccggcgccc tgacaagcgg agtgcacacc tttcccgctg tgctgcagtc ttccggcctg 540
tactctctga gctctgtggt gacagtgcct tccagctctc tgggcaccaa gacatatacc 600
tgcaacgtgg accataagcc aagcaatacc aaggtggata agagagtgga gagcaagtat 660
gggcccccat gccctccatg tccagctcca gaggctgctg gaggcccttc cgtgttcctg 720
tttcccccta agccaaagga caccctgatg atcagcagaa cccctgaggt gacatgcgtg 780
gtggtggacg tgtctcagga ggacccagag gtgcagttta actggtacgt ggatggcgtg 840
gaggtgcaca atgctaagac caagcccagg gaggagcagt tcaattctac ctaccgggtg 900
gtgtccgtgc tgacagtgct gcatcaggat tggctgaacg gcaaggagta taagtgcaag 960
gtgtccaata agggcctgcc ttccagcatc gagaagacca tcagcaaggc taagggacag 1020
cctagagagc cacaggtgta cacactgcca ccctcccagg aggagatgac caagaaccag 1080
gtgagcctga catgtctggt gaagggcttt tatccatctg acatcgctgt ggagtgggag 1140
tccaatggcc agcccgagaa caattacaag accacacctc cagtgctgga cagcgatggc 1200
tctttctttc tgtattccag gctgaccgtg gataagagcc ggtggcagga gggcaacgtg 1260
ttcagctgct ctgtgatgca cgaggccctg cacaatcatt acacacagaa gtccctgagc 1320
ctgtctctgg gcggcggcgg ctctggagga ggaggatccg gtggaggtgg atctgacatt 1380
cagatgactc agtctccctc ttccctgtct gcctccctgg gcgatagggt gacaatcagc 1440
tgttctgctt cccagggcat ctccaactac ctgaactggt accagcagaa gccagatggc 1500
accgtgaagc tgctgatcta ctatacctct acactgcact ccggagtgcc aagccggttt 1560
agcggatctg gatctggaac cgactatact ctgaccatta gctctctgca gcccgaggat 1620
atcgccacat actattgcca gcagtatagc aagctgcctt ggaccttcgg ctgtggcaca 1680
aagctggaga tcaagggtgg tggtggttcc ggtggtggtg gttccggtgg cggcggctca 1740
ggcggaggag gaagccaggt gcagctgcag gagagcggac caggactggt gaagccaagc 1800
gagaccctgt ctctgacctg cacagtgagc ggctcttccc tgacatctta cggcgtgcat 1860
tgggtgagac agccacctgg caagtgtctg gagggactgg gcgtgatctg gccaggaggc 1920
tctaccaact ataattccgc tctgatgagc cgcgtgacaa tcagcaagga caactccaag 1980
agccaggtgt ctctgaagat gagctctctg accgccgctg ataccgccgt gtactattgc 2040
gctagggtga ccggcacatg gtacttcgac gtgtggggcc agggcaccac agtgaccgtg 2100
tcctct 2106
<210> 18
<211> 651
<212> DNA
<213> Artificial sequence
<400> 18
gacatccaga tgacacagag cccttccacc ctgtccgcca gcgtgggaga cagagtgacc 60
atcacttgcc agtccagcca gaacgtgtac tctaacaata gactgtcatg gtatcagcag 120
aagccaggga aggctcctaa gctcctgatc tattggacca gcttcctcgc ctccggagtg 180
ccatcaaggt tcagcggcag tggatctggg acagaattta ctctgaccat cagctccctg 240
cagcccgacg attttgccac ttattactgc gctggcggat acagcggcaa cctgtacacc 300
ttcggtcagg gtaccaagtt ggaaattaag cgtacggtgg ctgcaccatc tgtcttcatc 360
ttcccgccat ctgatgagca gttgaaatct ggaactgcct ctgttgtgtg cctgctgaat 420
aacttctatc ccagagaggc caaagtacag tggaaggtgg ataacgccct ccaatcgggt 480
aactcccagg agagtgtcac agagcaggac agcaaggaca gcacctacag cctcagcagc 540
accctgacgc tgagcaaagc agactacgag aaacacaaag tctacgcctg cgaagtcacc 600
catcagggcc tgagctcgcc cgtcacaaag agcttcaaca ggggagagtg c 651
<210> 19
<211> 255
<212> PRT
<213> Artificial sequence
<400> 19
Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu
1 5 10 15
Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro
20 25 30
Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys
35 40 45
Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile
50 55 60
Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser
65 70 75 80
Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly
85 90 95
Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu
100 105 110
Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln
115 120 125
Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys
130 135 140
Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro
145 150 155 160
Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala
165 170 175
Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu
180 185 190
Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu
195 200 205
Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe
210 215 220
Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly
225 230 235 240
Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
245 250 255
<210> 20
<211> 163
<212> PRT
<213> Artificial sequence
<400> 20
Leu Gln Asp Leu Cys Ser Asn Cys Pro Ala Gly Thr Phe Cys Asp Asn
1 5 10 15
Asn Arg Ser Gln Ile Cys Ser Pro Cys Pro Pro Asn Ser Phe Ser Ser
20 25 30
Ala Gly Gly Gln Arg Thr Cys Asp Ile Cys Arg Gln Cys Lys Gly Val
35 40 45
Phe Lys Thr Arg Lys Glu Cys Ser Ser Thr Ser Asn Ala Glu Cys Asp
50 55 60
Cys Ile Ser Gly Tyr His Cys Leu Gly Ala Glu Cys Ser Met Cys Glu
65 70 75 80
Gln Asp Cys Lys Gln Gly Gln Glu Leu Thr Lys Lys Gly Cys Lys Asp
85 90 95
Cys Cys Phe Gly Thr Phe Asn Asp Gln Lys Arg Gly Ile Cys Arg Pro
100 105 110
Trp Thr Asn Cys Ser Leu Asp Gly Lys Ser Val Leu Val Asn Gly Thr
115 120 125
Lys Glu Arg Asp Val Val Cys Gly Pro Ser Pro Ala Asp Leu Ser Pro
130 135 140
Gly Ala Ser Ser Ala Thr Pro Pro Ala Pro Ala Arg Glu Pro Gly His
145 150 155 160
Ser Pro Gln
<210> 21
<211> 164
<212> PRT
<213> Artificial sequence
<400> 21
Val Gln Asn Ser Cys Asp Asn Cys Gln Pro Gly Thr Phe Cys Arg Lys
1 5 10 15
Tyr Asn Pro Val Cys Lys Ser Cys Pro Pro Ser Thr Phe Ser Ser Ile
20 25 30
Gly Gly Gln Pro Asn Cys Asn Ile Cys Arg Val Cys Ala Gly Tyr Phe
35 40 45
Arg Phe Lys Lys Phe Cys Ser Ser Thr His Asn Ala Glu Cys Glu Cys
50 55 60
Ile Glu Gly Phe His Cys Leu Gly Pro Gln Cys Thr Arg Cys Glu Lys
65 70 75 80
Asp Cys Arg Pro Gly Gln Glu Leu Thr Lys Gln Gly Cys Lys Thr Cys
85 90 95
Ser Leu Gly Thr Phe Asn Asp Gln Asn Gly Thr Gly Val Cys Arg Pro
100 105 110
Trp Thr Asn Cys Ser Leu Asp Gly Arg Ser Val Leu Lys Thr Gly Thr
115 120 125
Thr Glu Lys Asp Val Val Cys Gly Pro Pro Val Val Ser Phe Ser Pro
130 135 140
Ser Thr Thr Ile Ser Val Thr Pro Glu Gly Gly Pro Gly Gly His Ser
145 150 155 160
Leu Gln Val Leu
<210> 22
<211> 290
<212> PRT
<213> Artificial sequence
<400> 22
Met Arg Ile Phe Ala Val Phe Ile Phe Met Thr Tyr Trp His Leu Leu
1 5 10 15
Asn Ala Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val Glu Tyr
20 25 30
Gly Ser Asn Met Thr Ile Glu Cys Lys Phe Pro Val Glu Lys Gln Leu
35 40 45
Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu Met Glu Asp Lys Asn Ile
50 55 60
Ile Gln Phe Val His Gly Glu Glu Asp Leu Lys Val Gln His Ser Ser
65 70 75 80
Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu Gly Asn
85 90 95
Ala Ala Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr
100 105 110
Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Val
115 120 125
Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu Val Val
130 135 140
Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln Ala Glu Gly Tyr
145 150 155 160
Pro Lys Ala Glu Val Ile Trp Thr Ser Ser Asp His Gln Val Leu Ser
165 170 175
Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg Glu Glu Lys Leu Phe Asn
180 185 190
Val Thr Ser Thr Leu Arg Ile Asn Thr Thr Thr Asn Glu Ile Phe Tyr
195 200 205
Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu Leu
210 215 220
Val Ile Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg Thr His
225 230 235 240
Leu Val Ile Leu Gly Ala Ile Leu Leu Cys Leu Gly Val Ala Leu Thr
245 250 255
Phe Ile Phe Arg Leu Arg Lys Gly Arg Met Met Asp Val Lys Lys Cys
260 265 270
Gly Ile Gln Asp Thr Asn Ser Lys Lys Gln Ser Asp Thr His Leu Glu
275 280 285
Glu Thr
290
<210> 23
<211> 220
<212> PRT
<213> Artificial sequence
<400> 23
Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val Glu Tyr Gly Ser
1 5 10 15
Asn Met Thr Ile Glu Cys Lys Phe Pro Val Glu Lys Gln Leu Asp Leu
20 25 30
Thr Ser Leu Ile Val Tyr Trp Glu Met Glu Asp Lys Asn Ile Ile Gln
35 40 45
Phe Val His Gly Glu Glu Asp Leu Lys Val Gln His Ser Asn Tyr Arg
50 55 60
Gln Arg Ala Gln Leu Leu Lys Asp Gln Leu Ser Leu Gly Asn Ala Ala
65 70 75 80
Leu Arg Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr Arg Cys
85 90 95
Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Val Lys Val
100 105 110
Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu Val Val Asp Pro
115 120 125
Val Thr Ser Glu His Glu Leu Thr Cys Gln Ala Glu Gly Tyr Pro Lys
130 135 140
Ala Glu Val Ile Trp Thr Ser Ser Asp His Gln Val Leu Ser Gly Lys
145 150 155 160
Thr Thr Thr Thr Asn Ser Lys Arg Glu Glu Lys Leu Leu Asn Val Thr
165 170 175
Ser Thr Leu Arg Ile Asn Thr Thr Ala Asn Glu Ile Phe Tyr Cys Ile
180 185 190
Phe Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu Leu Val Ile
195 200 205
Pro Glu Leu Pro Leu Ala Leu Pro Pro Asn Glu Arg
210 215 220
<210> 24
<211> 221
<212> PRT
<213> Artificial sequence
<400> 24
Phe Thr Ile Thr Ala Pro Lys Asp Leu Tyr Val Val Glu Tyr Gly Ser
1 5 10 15
Asn Val Thr Met Glu Cys Arg Phe Pro Val Glu Arg Glu Leu Asp Leu
20 25 30
Leu Ala Leu Val Val Tyr Trp Glu Lys Glu Asp Glu Gln Val Ile Gln
35 40 45
Phe Val Ala Gly Glu Glu Asp Leu Lys Pro Gln His Ser Asn Phe Arg
50 55 60
Gly Arg Ala Ser Leu Pro Lys Asp Gln Leu Leu Lys Gly Asn Ala Ala
65 70 75 80
Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr Cys Cys
85 90 95
Ile Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Leu Lys Val
100 105 110
Asn Ala Pro Tyr Arg Lys Ile Asn Gln Arg Ile Ser Val Asp Pro Ala
115 120 125
Thr Ser Glu His Glu Leu Ile Cys Gln Ala Glu Gly Tyr Pro Glu Ala
130 135 140
Glu Val Ile Trp Thr Asn Ser Asp His Gln Pro Val Ser Gly Lys Arg
145 150 155 160
Ser Val Thr Thr Ser Arg Thr Glu Gly Met Leu Leu Asn Val Thr Ser
165 170 175
Ser Leu Arg Val Asn Ala Thr Ala Asn Asp Val Phe Tyr Cys Thr Phe
180 185 190
Trp Arg Ser Gln Pro Gly Gln Asn His Thr Ala Glu Leu Ile Ile Pro
195 200 205
Glu Leu Pro Ala Thr His Pro Pro Gln Asn Arg Thr His
210 215 220
<210> 25
<211> 70
<212> DNA
<213> Artificial sequence
<400> 25
tggggacttt ccgctgggga ctttccgctg gggactttcc gctggggact ttccgctggg 60
gactttccgc 70
<210> 26
<211> 1653
<212> DNA
<213> Artificial sequence
<400> 26
atggaagatg ccaaaaacat taagaagggc ccagcgccat tctacccact cgaagacggg 60
accgccggcg agcagctgca caaagccatg aagcgctacg ccctggtgcc cggcaccatc 120
gcctttaccg acgcacatat cgaggtggac attacctacg ccgagtactt cgagatgagc 180
gttcggctgg cagaagctat gaagcgctat gggctgaata caaaccatcg gatcgtggtg 240
tgcagcgaga atagcttgca gttcttcatg cccgtgttgg gtgccctgtt catcggtgtg 300
gctgtggccc cagctaacga catctacaac gagcgcgagc tgctgaacag catgggcatc 360
agccagccca ccgtcgtatt cgtgagcaag aaagggctgc aaaagatcct caacgtgcaa 420
aagaagctac cgatcataca aaagatcatc atcatggata gcaagaccga ctaccagggc 480
ttccaaagca tgtacacctt cgtgacttcc catttgccac ccggcttcaa cgagtacgac 540
ttcgtgcccg agagcttcga ccgggacaaa accatcgccc tgatcatgaa cagtagtggc 600
agtaccggat tgcccaaggg cgtagcccta ccgcaccgca ccgcttgtgt ccgattcagt 660
catgcccgcg accccatctt cggcaaccag atcatccccg acaccgctat cctcagcgtg 720
gtgccatttc accacggctt cggcatgttc accacgctgg gctacttgat ctgcggcttt 780
cgggtcgtgc tcatgtaccg cttcgaggag gagctattct tgcgcagctt gcaagactat 840
aagattcaat ctgccctgct ggtgcccaca ctatttagct tcttcgctaa gagcactctc 900
atcgacaagt acgacctaag caacttgcac gagatcgcca gcggcggggc gccgctcagc 960
aaggaggtag gtgaggccgt ggccaaacgc ttccacctac caggcatccg ccagggctac 1020
ggcctgacag aaacaaccag cgccattctg atcacccccg aaggggacga caagcctggc 1080
gcagtaggca aggtggtgcc cttcttcgag gctaaggtgg tggacttgga caccggtaag 1140
acactgggtg tgaaccagcg cggcgagctg tgcgtccgtg gccccatgat catgagcggc 1200
tacgttaaca accccgaggc tacaaacgct ctcatcgaca aggacggctg gctgcacagc 1260
ggcgacatcg cctactggga cgaggacgag cacttcttca tcgtggaccg gctgaagagc 1320
ctgatcaaat acaagggcta ccaggtagcc ccagccgaac tggagagcat cctgctgcaa 1380
caccccaaca tcttcgacgc cggggtcgcc ggcctgcccg acgacgatgc cggcgagctg 1440
cccgccgcag tcgtcgtgct ggaacacggt aaaaccatga ccgagaagga gatcgtggac 1500
tatgtggcca gccaggttac aaccgccaag aagctgcgcg gtggtgttgt gttcgtggac 1560
gaggtgccta aaggactgac cggcaagttg gacgcccgca agatccgcga gattctcatt 1620
aaggccaaga agggcggcaa gatcgccgtg taa 1653
<210> 27
<211> 354
<212> DNA
<213> Artificial sequence
<400> 27
gacgtgcagc ttgtggagag cggaggaggc ctggtgcagc ctggaggctc tctgagactc 60
tcctgtaccg tgtctggcat cgacctgagc tcctatgaca tgacctgggt ccgccaggct 120
ccagggaagg ggctggagta catcggctac attagctacg tgtctcggac atactatgcc 180
gacagcgtga agggcagatt caccatctcc aaggacacct ccaagaacac ggtgtatctg 240
cagatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgccag agacaggccc 300
gatggcgctg ccaccaacct gtggggacag ggtaccctgg tgaccgtgag ctcc 354
<210> 28
<211> 330
<212> DNA
<213> Artificial sequence
<400> 28
gacatccaga tgacacagag cccttccacc ctgtccgcca gcgtgggaga cagagtgacc 60
atcacttgcc agtccagcca gaacgtgtac tctaacaata gactgtcatg gtatcagcag 120
aagccaggga aggctcctaa gctcctgatc tattggacca gcttcctcgc ctctggcgtg 180
ccatcaaggt tcagcggcag tggatctggg acagaattta ctctgaccat cagctccctg 240
cagcccgacg attttgccac ttattactgc gctggcggat acagcggcaa cctgtacacc 300
ttcggtcagg gtaccaagtt ggaaattaag 330
<210> 29
<211> 351
<212> DNA
<213> Artificial sequence
<400> 29
caggtgcagc tgcaggagtc cggaccagga ctggtgaagc catccgagac actgagcctg 60
acctgtacag tgtccggatc cagcctgacc agctacggag tgcactgggt gaggcagcca 120
cctggcaagg gactggaggg cctgggcgtg atctggcctg gcggcagcac aaactataat 180
tctgctctga tgtcccgggt gaccatctct aaggacaact ccaagagcca ggtgtccctg 240
aagatgtctt ccctgacagc cgctgacacc gccgtgtact attgcgctag agtgaccggc 300
acatggtact tcgacgtgtg gggccagggc accacagtga cagtgagctc t 351
<210> 30
<211> 321
<212> DNA
<213> Artificial sequence
<400> 30
gacatccaga tgacacagtc cccatccagc ctgtctgcct ccctgggcga tagagtgacc 60
atcagctgct ctgcttccca gggcatctcc aactacctga attggtatca gcagaagccc 120
gatggcaccg tgaagctgct gatctactat accagcacac tgcactctgg agtgccttcc 180
cgcttcagcg gatctggatc cggaaccgac tacaccctga caatctcttc cctgcagcct 240
gaggacatcg ccacatacta ttgccagcag tattccaagc tgccatggac ctttggcggc 300
ggcacaaagc tggagatcaa g 321
Claims (10)
1. A bispecific antibody targeting PD-L1 and 4-1BB, comprising a PD-L1 antigen-binding domain and a 4-1BB antigen-binding domain;
the PD-L1 antigen binding domain comprises a heavy chain variable region and a light chain variable region; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region are shown as 26 th-32 th, 52 th-56 th and 98 th-107 th sites of SEQ ID No.1 in sequence; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region are shown as 24-36 th, 52-58 th and 93-100 th positions of SEQ ID No.2 in sequence; wherein the amino acid sequence of said HCDR3 in said heavy chain variable region of said PD-L1 antigen-binding domain is alternatively as shown at positions 98-107 of SEQ ID No. 10;
the 4-1BB antigen-binding domain comprises a heavy chain variable region and a light chain variable region; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region are shown as 31-35 th, 50-65 th and 98-106 th positions of SEQ ID No.3 in sequence; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region are shown as 24 th-34 th, 50 th-56 th and 89 th-97 th sites of SEQ ID No.4 in sequence.
2. The bispecific antibody of claim 1, characterized in that: in the PD-L1 antigen binding domain, the amino acid sequence of the heavy chain variable region is 627-744 position of SEQ ID No.1 or SEQ ID No.5 or 1-118 position of SEQ ID No.10, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% identity with 627-744 position of SEQ ID No.1 or SEQ ID No.5 or 1-118 position of SEQ ID No. 10; and/or
In the PD-L1 antigen binding domain, the amino acid sequence of the light chain variable region is 497-606 th position of SEQ ID No.2 or SEQ ID No.5, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of identity with 497-606 th position of SEQ ID No.2 or SEQ ID No. 5;
and/or
In the 4-1BB antigen binding domain, the amino acid sequence of the heavy chain variable region is position 128-244 of SEQ ID No.3 or SEQ ID No.5, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% identity with position 128-244 of SEQ ID No.3 or SEQ ID No. 5; and/or
In the 4-1BB antigen binding domain, the amino acid sequence of the light chain variable region is SEQ ID No.4 or 1-107 of SEQ ID No.5, or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% identity with 1-107 of SEQ ID No.4 or SEQ ID No. 5.
3. The bispecific antibody of claim 1 or 2, characterized in that: the bispecific antibody has a structure from N end to C end as follows:
structure a:1 st scFv-L1-Fc-L2-2 nd scFv；
Structure B:1 st scFv-L1-Fc-L2-2 nd Fab；
Structure D:1 st Fab-Fc-L1-2 nd scFv；
Wherein, -represents a peptide bond; l1, L2 represent a connecting peptide or an independent peptide bond; l1 and L2 are different or the same; fc represents the Fc fragment of an antibody; 1 st scFv represents a scFv domain capable of specific binding to a first antigen; 1 st Fab represents a Fab domain capable of specific binding to the first antigen; 2 nd scFv represents a scFv domain capable of specific binding to a second antigen; 2 nd Fab represents a Fab domain capable of specific binding to the second antigen; one of the first antigen and the second antigen is PD-L1 and the other is 4-1BB;
the N end of the scFv structural domain is a heavy chain variable region, and the C end of the scFv structural domain is a light chain variable region; or the N end is a light chain variable region, and the C end is a heavy chain variable region.
4. The bispecific antibody of claim 3, characterized in that: the connecting peptide is selected from the following: a (EAAAK) 4 ALE、KVDKKVEPKSCDKTHT、G4S、(G4S)n；
Where n is a positive integer, preferably n =4.
5. The bispecific antibody of any one of claims 1-4, characterized in that: the bispecific antibody comprises an Fc fragment;
the Fc segment comprises a mutation or does not comprise a mutation site;
the Fc segment is of IgG1, igG2, igG3 or IgG4 type, preferably IgG4 type.
6. A bispecific antibody targeting PD-L1 and 4-1BB, characterized in that: the bispecific antibody is any one of the following:
(A) Consists of two identical peptide chains, and the amino acid sequence of each peptide chain is shown as SEQ ID No. 5;
(B) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.6, and the amino acid sequences of the light chains are shown as SEQ ID No. 11;
(C) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.7, and the amino acid sequences of the light chains are shown as SEQ ID No. 11;
(D) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.9, and the amino acid sequences of the light chains are shown as SEQ ID No. 11;
(E) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.8, and the amino acid sequences of the light chains are shown as SEQ ID No. 11;
(F) Consists of two heavy chains and two light chains; the amino acid sequences of the heavy chains are shown as SEQ ID No.10, and the amino acid sequences of the light chains are shown as SEQ ID No. 11.
7. A nucleic acid molecule encoding the bispecific antibody of any one of claims 1-6.
8. The nucleic acid molecule of claim 7, wherein: in the nucleic acid molecule, nucleotide sequences encoding HCDR1, HCDR2 and HCDR3 in the heavy chain variable region in the PD-L1 antigen binding domain are shown as 76 th-96 th, 154 th-168 th and 292 th-321 th positions from 5' end of SEQ ID No.27 in sequence; wherein the nucleotide sequence of said HCDR3 in said heavy chain variable region encoding said PD-L1 antigen binding domain is alternatively as set forth in SEQ ID No.16 at positions 292-321; and/or
In the nucleic acid molecule, the nucleotide sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region in the PD-L1 antigen binding domain are shown as 70 th-108 th, 154 th-174 th and 271 th-300 th positions from 5' end of SEQ ID No.28 in sequence;
and/or;
in the nucleic acid molecule, the nucleotide sequences encoding HCDR1, HCDR2 and HCDR3 in the heavy chain variable region in the 4-1BB antigen binding domain are shown as 91-105, 148-195 and 292-318 of SEQ ID No.29 from the 5' end in sequence; and/or
In the nucleic acid molecule, the nucleotide sequences encoding LCDR1, LCDR2 and LCDR3 in the variable region of the light chain in the 4-1BB antigen binding domain are shown as 70-102, 148-168 and 265-291 of SEQ ID No.30 from the 5' end in sequence;
further, in the nucleic acid molecule, the nucleotide sequence encoding the heavy chain variable region in the PD-L1 antigen-binding domain is SEQ ID No.27 or 1879-2232 of SEQ ID No.12 or 1-354 of SEQ ID No.16, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity with the nucleotide sequence of 1879-2232 of SEQ ID No.27 or SEQ ID No.12 or 1-354 of SEQ ID No. 16; and/or
Further, in the nucleic acid molecule, the nucleotide sequence encoding the light chain variable region in the PD-L1 antigen-binding domain is 1489-1818 of SEQ ID No.28 or SEQ ID No.12, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity with 1489-1818 of SEQ ID No.28 or SEQ ID No. 12;
and/or
Further, in the nucleic acid molecule, the nucleotide sequence encoding the heavy chain variable region in the 4-1BB antigen binding domain is SEQ ID No.29 or SEQ ID No.12 at positions 382 to 732, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity with positions 382 to 732 of SEQ ID No.29 or SEQ ID No. 12; and/or
Further, in the nucleic acid molecule, the nucleotide sequence encoding the light chain variable region in the 4-1BB antigen binding domain is at positions 1-321 of SEQ ID No.30 or SEQ ID No.12, or has 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, or 75% or more identity with positions 1-321 of SEQ ID No.30 or SEQ ID No. 12;
still further, the nucleic acid molecule is any one of:
(a) A nucleic acid molecule a encoding the peptide chain of (A) according to claim 6; the nucleotide sequence of the nucleic acid molecule a is SEQ ID No.12 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 12;
(b) Consisting of a nucleic acid molecule B1 encoding the heavy chain in (B) as described in claim 6 and a nucleic acid molecule B2 encoding the light chain in (B) as described in claim 6; the nucleotide sequence of the nucleic acid molecule b1 is SEQ ID No.13 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 13; the nucleotide sequence of the nucleic acid molecule b2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 18;
(c) Consists of a nucleic acid molecule C1 encoding the heavy chain in (C) as defined in claim 6 and a nucleic acid molecule C2 encoding the light chain in (C) as defined in claim 6; the nucleotide sequence of the nucleic acid molecule c1 is SEQ ID No.14 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 14; the nucleotide sequence of the nucleic acid molecule c2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 18;
(d) Consists of a nucleic acid molecule D1 encoding the heavy chain in (D) as defined in claim 6 and a nucleic acid molecule D2 encoding the light chain in (D) as defined in claim 6; the nucleotide sequence of the nucleic acid molecule d1 is SEQ ID No.16 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 16; the nucleotide sequence of the nucleic acid molecule d2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 18;
(e) Consists of a nucleic acid molecule E1 encoding the heavy chain in (E) as defined in claim 6 and a nucleic acid molecule E2 encoding the light chain in (E) as defined in claim 6; the nucleotide sequence of the nucleic acid molecule e1 is SEQ ID No.15 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 15; the nucleotide sequence of the nucleic acid molecule e2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 18;
(f) Consisting of a nucleic acid molecule F1 encoding the heavy chain in (F) described in claim 6 and a nucleic acid molecule F2 encoding the light chain in (F) described in claim 6; the nucleotide sequence of the nucleic acid molecule f1 is SEQ ID No.17 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 17; the nucleotide sequence of the nucleic acid molecule f2 is SEQ ID No.18 or has more than 99%, more than 95%, more than 90%, more than 85%, more than 80% or more than 75% of consistency with SEQ ID No. 18.
9. An expression cassette, recombinant vector, recombinant bacterium or transgenic cell line comprising the nucleic acid molecule of claim 7 or 8; or
A pharmaceutical composition comprising: (a1) The bispecific antibody of any one of claims 1-6; (a 2) a pharmaceutically acceptable excipient, diluent or carrier.
10. A method for making a bispecific antibody of any one of claims 1-6 comprising the steps of:
(1) A recombinant plasmid obtained by cloning the nucleic acid molecule of claim 7 or 8 into pcDNA3.4 vector;
(2) Transfecting the recombinant plasmid obtained in the step (1) into a receptor cell to obtain a recombinant cell, and culturing the recombinant cell to obtain the bispecific antibody.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110838282.2A CN115677859A (en) | 2021-07-23 | 2021-07-23 | Bispecific antibodies targeting PD-L1 and 4-1BB |
| PCT/CN2022/078798 WO2023000675A1 (en) | 2021-07-23 | 2022-03-02 | Bispecific antibody targeting pd-l1 and 4-1bb |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110838282.2A CN115677859A (en) | 2021-07-23 | 2021-07-23 | Bispecific antibodies targeting PD-L1 and 4-1BB |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115677859A true CN115677859A (en) | 2023-02-03 |
Family
ID=85044523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110838282.2A Pending CN115677859A (en) | 2021-07-23 | 2021-07-23 | Bispecific antibodies targeting PD-L1 and 4-1BB |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115677859A (en) |
-
2021
- 2021-07-23 CN CN202110838282.2A patent/CN115677859A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6783886B2 (en) | Anti-CTLA4 monoclonal antibody or antigen-binding fragment thereof, pharmaceutical composition and use | |
| CN109476732B (en) | Trispecific and/or trivalent binding proteins | |
| CN107151269B (en) | PDL-1 antibody, pharmaceutical composition and application thereof | |
| WO2020043184A1 (en) | Anti-pd-1 and anti-vegfa bifunctional antibody, pharmaceutical composition thereof and use thereof | |
| JP2020018298A (en) | Antibody constructs for cldn18.2 and cd3 | |
| WO2015085847A1 (en) | Pd-1 antibody, antigen-binding fragment thereof, and medical application thereof | |
| AU2018241624A1 (en) | Improved antigen binding receptors | |
| KR20190055008A (en) | Anti-HER2 Antibody or Antigen Binding Fragment Thereof, and Chimeric Antigen Receptor Comprising The Same | |
| CA2876133C (en) | Human bispecific egfrviii antibody engaging molecules | |
| WO2016149698A2 (en) | Hiv-1 neutralizing antibodies and uses thereof (v3 antibodies) | |
| CN112409483A (en) | anti-PD-L1 nano antibody | |
| TWI815305B (en) | PD-1/VEGF quadrivalent bispecific antibody, preparation method and use thereof | |
| CN111247429A (en) | Universal reporter cell assay for specific testing of novel antigen binding modules | |
| CN113004415B (en) | Bispecific antibody targeting HER2 and 4-1BB and application thereof | |
| CN112424601A (en) | Diagnostic assay for detecting tumor antigens in cancer patients | |
| WO2023020537A1 (en) | Bispecific antibody and use thereof | |
| KR20210143096A (en) | Antibody specific for CD22 and uses thereof | |
| CN112442122A (en) | Blocking type PD-1 nano antibody and its coding sequence and use | |
| CA2875451A1 (en) | Antibody against transporter and use thereof | |
| WO2022216887A1 (en) | Novel anti-cd4 antibodies | |
| CN114634566B (en) | Antigen binding fragment of Claudin18_2, antibody and application thereof | |
| CN113825772A (en) | anti-HER 2 affibodies and switchable chimeric antigen receptors using the same as switch molecules | |
| WO2023000675A1 (en) | Bispecific antibody targeting pd-l1 and 4-1bb | |
| EP4286520A1 (en) | Antigen binding protein and use thereof | |
| CN111742220A (en) | Diagnostic assay for detecting tumor antigens in cancer patients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |