CN115645477A - Traditional Chinese medicine formula for preventing and treating HPV (human papillomavirus) and preparation method thereof - Google Patents
Traditional Chinese medicine formula for preventing and treating HPV (human papillomavirus) and preparation method thereof Download PDFInfo
- Publication number
- CN115645477A CN115645477A CN202211341280.3A CN202211341280A CN115645477A CN 115645477 A CN115645477 A CN 115645477A CN 202211341280 A CN202211341280 A CN 202211341280A CN 115645477 A CN115645477 A CN 115645477A
- Authority
- CN
- China
- Prior art keywords
- solution
- traditional chinese
- chinese medicine
- dandelion
- safflower
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000003814 drug Substances 0.000 title claims abstract description 60
- 238000002360 preparation method Methods 0.000 title claims abstract description 12
- 241000701806 Human papillomavirus Species 0.000 title description 22
- 244000020518 Carthamus tinctorius Species 0.000 claims abstract description 23
- 235000003255 Carthamus tinctorius Nutrition 0.000 claims abstract description 23
- 241000195955 Equisetum hyemale Species 0.000 claims abstract description 23
- 244000150195 Cyperus longus Species 0.000 claims abstract description 14
- 241000700605 Viruses Species 0.000 claims abstract description 7
- 229940126680 traditional chinese medicines Drugs 0.000 claims abstract description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 33
- 229940079593 drug Drugs 0.000 claims description 32
- 241000245665 Taraxacum Species 0.000 claims description 22
- 235000005187 Taraxacum officinale ssp. officinale Nutrition 0.000 claims description 22
- HEMHJVSKTPXQMS-UHFFFAOYSA-M Sodium hydroxide Chemical compound [OH-].[Na+] HEMHJVSKTPXQMS-UHFFFAOYSA-M 0.000 claims description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 9
- 230000002829 reductive effect Effects 0.000 claims description 8
- 238000000034 method Methods 0.000 claims description 7
- 238000001556 precipitation Methods 0.000 claims description 6
- 239000006228 supernatant Substances 0.000 claims description 6
- 238000005406 washing Methods 0.000 claims description 6
- 238000005303 weighing Methods 0.000 claims description 6
- 241000234653 Cyperus Species 0.000 claims description 4
- 229940067866 dandelion extract Drugs 0.000 claims description 4
- 235000020691 dandelion extract Nutrition 0.000 claims description 4
- 238000007865 diluting Methods 0.000 claims description 4
- 239000001845 taraxacum officinale leaf extract Substances 0.000 claims description 4
- 239000003513 alkali Substances 0.000 claims description 3
- 238000001035 drying Methods 0.000 claims description 3
- 238000000605 extraction Methods 0.000 claims description 3
- 238000001914 filtration Methods 0.000 claims description 3
- 239000012530 fluid Substances 0.000 claims description 3
- 238000010438 heat treatment Methods 0.000 claims description 3
- 238000002156 mixing Methods 0.000 claims description 3
- 238000010992 reflux Methods 0.000 claims description 3
- 239000011347 resin Substances 0.000 claims description 3
- 229920005989 resin Polymers 0.000 claims description 3
- 238000001179 sorption measurement Methods 0.000 claims description 3
- 238000003756 stirring Methods 0.000 claims description 3
- 239000007788 liquid Substances 0.000 claims 2
- 230000000694 effects Effects 0.000 abstract description 15
- 230000002265 prevention Effects 0.000 abstract description 2
- 206010008342 Cervix carcinoma Diseases 0.000 description 8
- 208000009608 Papillomavirus Infections Diseases 0.000 description 8
- 208000006105 Uterine Cervical Neoplasms Diseases 0.000 description 8
- 201000010881 cervical cancer Diseases 0.000 description 8
- IAZDPXIOMUYVGZ-UHFFFAOYSA-N Dimethylsulphoxide Chemical compound CS(C)=O IAZDPXIOMUYVGZ-UHFFFAOYSA-N 0.000 description 4
- 238000002474 experimental method Methods 0.000 description 4
- 230000002401 inhibitory effect Effects 0.000 description 4
- 206010059313 Anogenital warts Diseases 0.000 description 3
- 241000341655 Human papillomavirus type 16 Species 0.000 description 3
- 108700020796 Oncogene Proteins 0.000 description 3
- 238000011529 RT qPCR Methods 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 201000010153 skin papilloma Diseases 0.000 description 3
- 108091003079 Bovine Serum Albumin Proteins 0.000 description 2
- 208000000907 Condylomata Acuminata Diseases 0.000 description 2
- 239000006144 Dulbecco’s modified Eagle's medium Substances 0.000 description 2
- 208000025009 anogenital human papillomavirus infection Diseases 0.000 description 2
- 201000004201 anogenital venereal wart Diseases 0.000 description 2
- 238000004113 cell culture Methods 0.000 description 2
- 230000003833 cell viability Effects 0.000 description 2
- 208000019065 cervical carcinoma Diseases 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000012258 culturing Methods 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 230000005764 inhibitory process Effects 0.000 description 2
- 230000000670 limiting effect Effects 0.000 description 2
- 108020004999 messenger RNA Proteins 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 239000000902 placebo Substances 0.000 description 2
- 229940068196 placebo Drugs 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 230000002123 temporal effect Effects 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 241000205585 Aquilegia canadensis Species 0.000 description 1
- 244000075634 Cyperus rotundus Species 0.000 description 1
- 235000016854 Cyperus rotundus Nutrition 0.000 description 1
- 102000043276 Oncogene Human genes 0.000 description 1
- 108010019160 Pancreatin Proteins 0.000 description 1
- 241001631646 Papillomaviridae Species 0.000 description 1
- 244000197580 Poria cocos Species 0.000 description 1
- 235000008599 Poria cocos Nutrition 0.000 description 1
- 208000000260 Warts Diseases 0.000 description 1
- 230000003698 anagen phase Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000004663 cell proliferation Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 239000002131 composite material Substances 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 231100000673 dose–response relationship Toxicity 0.000 description 1
- 230000002222 downregulating effect Effects 0.000 description 1
- 230000008508 epithelial proliferation Effects 0.000 description 1
- 210000005002 female reproductive tract Anatomy 0.000 description 1
- 239000012091 fetal bovine serum Substances 0.000 description 1
- 239000012894 fetal calf serum Substances 0.000 description 1
- 210000004392 genitalia Anatomy 0.000 description 1
- 230000012010 growth Effects 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 239000004615 ingredient Substances 0.000 description 1
- 230000002147 killing effect Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 229940055695 pancreatin Drugs 0.000 description 1
- 239000008363 phosphate buffer Substances 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000010839 reverse transcription Methods 0.000 description 1
- 230000002441 reversible effect Effects 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 231100000331 toxic Toxicity 0.000 description 1
- 230000002588 toxic effect Effects 0.000 description 1
Images
Landscapes
- Medicines Containing Plant Substances (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of HPV prevention and treatment, in particular to a traditional Chinese medicine formula for preventing and treating HPV virus and a preparation method thereof, wherein the traditional Chinese medicine formula comprises the following traditional Chinese medicines: compared with the traditional formula of safflower, common scouring rush herb and nutgrass galingale rhizome, the formula of safflower, common scouring rush herb and nutgrass galingale rhizome has the advantage that the same effect can be achieved by adopting 50 percent of dosage.
Description
Technical Field
The invention relates to the technical field of HPV (human papilloma virus) prevention and treatment, in particular to a traditional Chinese medicine formula for preventing and treating HPV virus and a preparation method thereof.
Background
Human Papilloma Virus (HPV) belongs to the genus papillomavirus A of the family papovaviridae, is a spherical DNA virus and can cause squamous epithelial proliferation of human skin mucosa. More than 130 types have been isolated, and different types cause different clinical manifestations, which can be classified according to the tissue sites invaded:
HPV populations of cutaneous types are very common infections, such as common warts, toe warts, flat warts, etc. as described above, but specific infection rates cannot be obtained. Compared with genital warts and cervical cancers caused by high-risk HPV infection and low-risk HPV infection of external genitalia, the genital warts caused by HPV infection account for 15-20% of the worldwide venereal diseases according to statistics.
Regarding the prevalence of HPV infection of the female genital tract, the total HPV infection rate at age 14-59 years was 26.8% according to a survey of national health and nutrition research topics from the United states in 2003-2004, so HPV infection placed an excess burden on women over previous estimates.
The prior art relating to four traditional Chinese medicines of safflower, horsetail, nutgrass galingale rhizome and dandelion mainly comprises:
1. the application number 201611257249.6 discloses a traditional Chinese medicine formula for preventing and treating HPV virus and a preparation method thereof, discloses a formula of dandelion, smoked plum, safflower, honeysuckle, poria cocos, equisetum hiemale and rhizoma cyperi, and the specification only discloses the use conditions of three patients, and the effect is relatively general.
2. The application number 202110934622.1 discloses a traditional Chinese medicine gel composition for preventing and inhibiting HPV virus and a preparation method thereof, and discloses a formula containing safflower, horsetail, nutgrass galingale rhizome and dandelion, and the auxiliary medicines are excessive.
3. The patent application No. CN97108473.4 discloses a prescription containing safflower, horsetail, cyperus tuber and dandelion, but the combination of the ingredients is more.
4. The application No. 201510040443.8 discloses a medicine formula for treating condyloma acuminatum and a preparation method thereof, and discloses a formula containing safflower, horsetail, nutgrass galingale rhizome and dandelion, and the medicine is more in the same combination.
5. The application number 200510068289.1 discloses the therapeutic effect of safflower, horsetail and cyperus tuber, and the experiment proves that the required dosage is large, and the experiment disclosed by the patent mainly aims at killing free viruses.
Disclosure of Invention
In view of the defects in the background art, the invention provides a traditional Chinese medicine formula for preventing and treating HPV virus and a preparation method thereof, and compared with the traditional formula of safflower, horsetail and nutgrass galingale rhizome, the traditional Chinese medicine formula can achieve the same effect by adopting 50% of dosage.
The invention relates to a traditional Chinese medicine formula for preventing and treating HPV virus, which comprises the following traditional Chinese medicines: safflower, horsetail, cyperus tuber and dandelion.
Further, the traditional Chinese medicine comprises the following components in parts by weight: 6 to 12 portions of safflower, 3 to 6 portions of horsetail, 3 to 6 portions of nutgrass galingale rhizome and 12 to 22 portions of dandelion.
Further, the safflower, the horsetail and the nutgrass galingale rhizome: the dandelion is 1:1.
furthermore, the dandelion is 7-15 g.
The invention also provides a preparation method of the traditional Chinese medicine formula for inhibiting and preventing HPV virus, which comprises the following steps:
s1, weighing dandelion according to a weight ratio;
s2, extraction: decocting with aqueous ethanol or ethanol-containing water, refluxing under heating or percolating, extracting, centrifuging or standing to obtain centrifugate or supernatant, concentrating, and recording as solution A;
s3, treating the solution A by adopting an alcohol precipitation or water precipitation method, and concentrating the separated supernatant to obtain a solution B;
s4, taking the solution B, diluting, adding sodium hydroxide, fully stirring, centrifuging or filtering to obtain transparent solution, and marking as solution C; taking the solution C, and putting the solution C on a macroporous adsorption resin column; washing with alkali liquor and water, washing with ethanol, eluting with ethanol, collecting the column-passing solution, and recording as solution D; collecting solution D, recovering ethanol under reduced pressure, concentrating the residual solution under normal pressure to fluid extract, and drying to obtain herba Taraxaci extract;
s5, weighing safflower, common scouring rush herb and nutgrass galingale rhizome according to the weight ratio to prepare an extract;
s6, mixing the safflower, the horsetail, the rhizoma cyperi and the dandelion extract to obtain the group B medicines.
The invention has the main beneficial effects that:
1. no toxic and side effects exist;
2. the activity of SiHa cells is reduced, the expression of HPV16 oncogenes in the SiHa cells is reduced, and the risk of cervical cancer caused by HPV infection is reduced;
3. the content of the effective components extracted from the dandelion is improved;
4. the same effect can be achieved by adopting 50% of dosage.
Drawings
FIG. 1 is a diagram of a dandelion combined gonggui kanti substance for treating cervical cancer SiHa cells for 24h (x 200) according to the invention.
Detailed Description
While the embodiments of the present invention will be described and illustrated in detail with reference to the accompanying drawings, it is to be understood that the invention is not limited to the specific embodiments disclosed, but is intended to cover various modifications, equivalents, and alternatives falling within the scope of the invention as defined by the appended claims.
For the convenience of understanding the embodiments of the present invention, the following description will be further explained by taking specific embodiments as examples with reference to the drawings, and the embodiments are not to be construed as limiting the embodiments of the present invention.
The embodiment 1 of the invention relates to a traditional Chinese medicine formula for preventing and treating HPV virus and an experiment of a preparation method thereof, wherein the formula comprises the following components in parts by weight:
1. reagents and materials
1. Test samples: group A medicines and group B medicines, wherein the group A medicines are safflower: and (3) horsetail: cyperus rotundus =2:1:1, the group B medicines are safflower: and (3) horsetail: rhizoma cyperi: dandelion =2:1:1:4, preparing a medicine;
2. cell: siHa cells (HPV 16-positive cervical cancer cells) as target cells;
3. reagents and consumables: fetal bovine serum (BI, cat # 04-001-ACS), DMEM culture solution (sigma, cat # D6429-500), PBS phosphate buffer (GiBCO, cat # 10010-023), pancreatin (Zhejiang Senrui Biotech., cat # CR 25200), trizol (Thermometer Fisher, cat # 15596026), reverse transcription kit (Thermometer Fisher, cat # K1622), PCR super-mix (10572014, cat # 10572014), 96-well plate (Corning, cat # 3516), 25 ml flask (Corning, cat # 430639)
4. An instrument; cell culture chamber (Thermo scientific, model: 3111), qPCR instrument (ABI, model Quant Studio 7), inverted microscope (OLYMPUS, model: C KX 41).
5. Primers and sequences:
E6：F：CAGCAATACAACAAACCG；R:GCAAGACATACAT CG；
E7：F：CAGAGGAGGAGGATGAAATAG；R：AGGTCTTCC AAAGTACGAATG。
2. method for producing a composite material
The preparation method of the group B medicine comprises the following steps:
s1, weighing dandelion according to a weight ratio;
s2, extraction: decocting with aqueous ethanol or ethanol-containing water, refluxing under heating or percolating, extracting, centrifuging or standing to obtain centrifugate or supernatant, concentrating, and recording as solution A;
s3, treating the solution A by adopting an alcohol precipitation or water precipitation method, and concentrating the separated supernatant to obtain a solution B;
s4, taking the solution B, diluting, adding sodium hydroxide, fully stirring, centrifuging or filtering to obtain transparent solution, and marking as solution C; taking the solution C, and putting the solution C on a macroporous adsorption resin column; washing with alkali liquor and water, washing with ethanol, eluting with ethanol, collecting the column-passing solution, and recording as solution D; collecting solution D, recovering ethanol under reduced pressure, concentrating the residual solution under normal pressure to fluid extract, and drying to obtain herba Taraxaci extract;
s5, weighing safflower, common scouring rush herb and nutgrass galingale rhizome according to the weight ratio to prepare an extract;
s6, mixing the safflower, the common scouring rush herb, the nutgrass galingale rhizome and the dandelion extract to obtain a group B of medicines.
Dissolving the group A medicine extract and the dandelion extract in DMSO, diluting the cell culture solution to the appropriate concentration, and storing at 4 ℃ for later use.
And 2, culturing SiHa cells and HaCaT cells by adopting a DMEM culture solution containing 10% fetal calf serum, inoculating the cells in a logarithmic growth phase to a culture plate or a bottle, adding a culture solution containing group A medicines with different concentrations after adherence, and setting 3 multiple holes in each group by taking no medicine as a control group. The final concentrations of the medicines in the group B are respectively as follows: 50. Mu.g/ml, 100. Mu.g/ml, 200. Mu.g/ml, 300. Mu.g/ml, 400. Mu.g/ml, 500. Mu.g/ml, for a total of 6 concentrations, group A drug alone was used as a control. Culturing for 24h, 48h and 72h. The experiment was repeated 3 times.
3. Observing the growth state of the cells by a microscope, and detecting the cell activity of SiHa and HaCaT cells by an MTT method; cells were harvested, RNA extracted, and reverse transcribed to cDNA.
qPCR detects changes in HPV 16E 6/E7mRNA expression in SiHa cells. By using 2 -ΔΔCt The method calculates the relative expression quantity of the target gene in each sample relative to the negative control group sample.
3. As a result:
group B drugs inhibit SiHa cell proliferation
The group A medicines and the group B medicines intervene SiHa cells for 24h, 48h and 72h. The MTT method detects the cell viability, and the result shows that 400ug/ml and 800ug/ml of group A drugs intervene SiHa cells for 72h, and the cell viability is reduced to different degrees (Table 1); the activity of SiHa cells intervened by 100-800ug/ml dandelion and group A medicines, and the activity of SiHa cells is reduced to different degrees in a time and dosage dependent relationship (Table 2). However, there was no significant change in cell morphology at 24h (fig. 1). And (4) prompting: the effect of the group B medicines on inhibiting SiHa cells is greater than that of the group A medicines singly used.
As shown in fig. 1, treatment of cervical cancer SiHa cells with dandelion in combination with group a drug extract for 24h (x 200): A. blank control; b.200ug/ml, C.400ug/ml, D.800ug/ml group B drug extract; group A drugs were used singly at 800ug/ml.
TABLE 1 temporal Effect of group A drugs on inhibition of cervical carcinoma SiHA cells alone
TABLE 2 temporal Effect of group B drugs on inhibition of cervical carcinoma SiHA cells
* P <0.05 compared to DMSO group; * P <0.01.
2. Group B drugs inhibit the influence of cervical cancer SiHa cells expressing E6 and E7mRNA
The group A medicines and the group B medicines interfere SiHa cells 24h, and the results of detection of the expression levels of the mRNA of E6 and E7 of the SiHa cells by a qPCR method show that the group A medicines with the concentration of 800 mu g/ml can down-regulate the expression of the mRNA of E6 and E7 (Table 3); whereas 100-800 μ g/ml dandelion + group a drugs were able to down-regulate the expression of E6, E7mRNA in a dose dependent relationship (table 4). And (4) prompting: the effect of down regulating E6 and E7mRNA expression of the group B medicines is stronger than that of the group A medicines singly used.
Table 3. Effect of group a drugs on HPV 16E 6, E7mRNA expression in SiHa cells (n = 3)
* P <0.05 compared to placebo; * P <0.01.
Table 4. Effect of group b drugs on HPV 16E 6, E7mRNA expression in SiHa cells (n = 3)
* P <0.05 compared to placebo; * P <0.01.
The group B medicine can reduce the activity of SiHa cells (HPV 16 positive cervical cancer cells), reduce the expression of HPV16 oncogene E6 and E7mRNA in the SiHa cells, has the functions of inhibiting the synthesis and the activity of HPV key protein and reducing the risk of cervical cancer caused by HPV infection, and simultaneously shows that the capacity of reducing the expression of the HPV16 oncogene E6 and E7mRNA in the SiHa cells is 2 times higher when the concentration of the group B medicine and the group A medicine is more than 200 mu g/ml.
Finally, it should be noted that: the above-mentioned embodiments are only specific embodiments of the present invention, which are used for illustrating the technical solutions of the present invention and not for limiting the same, and the protection scope of the present invention is not limited thereto, although the present invention is described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: those skilled in the art can still make modifications or changes to the embodiments described in the foregoing embodiments, or make equivalent substitutions for some features, within the scope of the disclosure; such modifications, changes or substitutions do not depart from the spirit and scope of the embodiments of the present invention, and they should be construed as being included therein. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.
Claims (5)
1. A traditional Chinese medicine formula for preventing and treating HPV virus is characterized by comprising the following traditional Chinese medicines: safflower, horsetail, cyperus tuber and dandelion.
2. The traditional Chinese medicine formula for preventing and treating HPV virus according to claim 1 is characterized in that the traditional Chinese medicine comprises the following components in parts by weight: 6 to 12 parts of safflower, 3 to 6 parts of horsetail, 3 to 6 parts of rhizoma cyperi and 12 to 22 parts of dandelion.
3. The traditional Chinese medicine formula for preventing and treating HPV virus according to claim 2, which is characterized in that: the safflower, the horsetail and the nutgrass galingale rhizome: the dandelion is 1:1.
4. the traditional Chinese medicine formula for preventing and treating HPV virus according to claim 3 is characterized in that: the dandelion is taken from 7 to 15 g.
5. A preparation method of a traditional Chinese medicine formula for preventing and treating HPV is characterized by comprising the following steps:
s1, weighing dandelion according to a weight ratio;
s2, extraction: decocting with aqueous ethanol or ethanol-containing water, refluxing under heating or percolating, extracting, centrifuging or standing to obtain centrifugate or supernatant, concentrating, and recording as solution A;
s3, treating the solution A by adopting an alcohol precipitation or water precipitation method, and concentrating the separated supernatant to obtain solution B;
s4, taking the solution B, diluting, adding sodium hydroxide, fully stirring, centrifuging or filtering to obtain transparent solution, and marking as solution C; taking the solution C, and putting the solution C on a macroporous adsorption resin column; washing with alkali liquor and water in sequence, washing with ethanol, eluting with ethanol, and collecting column-passing liquid, which is marked as liquid D; collecting solution D, recovering ethanol under reduced pressure, concentrating the residual solution under normal pressure to fluid extract, and drying to obtain herba Taraxaci extract;
s5, weighing safflower, common scouring rush herb and nutgrass galingale rhizome according to the weight ratio to prepare an extract;
s6, mixing the safflower, the common scouring rush herb, the nutgrass galingale rhizome and the dandelion extract to obtain a group B of medicines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211341280.3A CN115645477A (en) | 2022-10-31 | 2022-10-31 | Traditional Chinese medicine formula for preventing and treating HPV (human papillomavirus) and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211341280.3A CN115645477A (en) | 2022-10-31 | 2022-10-31 | Traditional Chinese medicine formula for preventing and treating HPV (human papillomavirus) and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115645477A true CN115645477A (en) | 2023-01-31 |
Family
ID=84994047
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211341280.3A Pending CN115645477A (en) | 2022-10-31 | 2022-10-31 | Traditional Chinese medicine formula for preventing and treating HPV (human papillomavirus) and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115645477A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106728648A (en) * | 2016-12-30 | 2017-05-31 | 钱琳佳 | A kind of Chinese medicine preparation of anti-HPV viruse |
| CN107823375A (en) * | 2017-11-27 | 2018-03-23 | 青岛农业大学 | A kind of Chinese medicinal tablet for treating mastitis for milk cows and preparation method thereof |
| CN108969721A (en) * | 2017-06-01 | 2018-12-11 | 王芳 | A kind of capsule preparations for treating Qi-stagnation type abdominal mass |
| US20210145920A1 (en) * | 2018-03-29 | 2021-05-20 | Zhuanshe DU | Traditional chinese medicine composition for treating diseases caused by human papillomavirus, preparation method and use thereof |
| CN113559237A (en) * | 2021-08-16 | 2021-10-29 | 陕西健驰生物药业有限公司 | Traditional Chinese medicine gel composition for preventing and inhibiting HPV (human papillomavirus) and preparation method thereof |
-
2022
- 2022-10-31 CN CN202211341280.3A patent/CN115645477A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106728648A (en) * | 2016-12-30 | 2017-05-31 | 钱琳佳 | A kind of Chinese medicine preparation of anti-HPV viruse |
| CN108969721A (en) * | 2017-06-01 | 2018-12-11 | 王芳 | A kind of capsule preparations for treating Qi-stagnation type abdominal mass |
| CN107823375A (en) * | 2017-11-27 | 2018-03-23 | 青岛农业大学 | A kind of Chinese medicinal tablet for treating mastitis for milk cows and preparation method thereof |
| US20210145920A1 (en) * | 2018-03-29 | 2021-05-20 | Zhuanshe DU | Traditional chinese medicine composition for treating diseases caused by human papillomavirus, preparation method and use thereof |
| CN113559237A (en) * | 2021-08-16 | 2021-10-29 | 陕西健驰生物药业有限公司 | Traditional Chinese medicine gel composition for preventing and inhibiting HPV (human papillomavirus) and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 奉建芳: "现代中药制剂设计", vol. 1, 中国医药科技出版社, pages: 192 - 194 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105031625B (en) | Lactoferrin and carragheen composition of medicine of a kind of electric charge modification and preparation method thereof | |
| CN103920081B (en) | Purpose of pharmaceutical composition | |
| CN102670588B (en) | Application of ellagic acid to preparation of antiviral medicament | |
| CN113521156B (en) | Application of traditional Chinese medicine composition in preparation of medicine for resisting cervical precancerous lesions | |
| RU2679903C1 (en) | Application of extracts of ginseng, gynsenosides and derivatives of ginsenoside for the preparation of medical products or remedies for the treatment of disorders caused by cmv | |
| CN110638893B (en) | anti-HPV (human papillomavirus) infection pharmaceutical composition and application thereof | |
| CN101669979B (en) | Artemisia scoparia extractive and production method and applications thereof | |
| CN106474147B (en) | Dressing for preventing and controlling human papilloma virus infection and preparation method thereof | |
| Yang et al. | REBACIN® as a noninvasive clinical intervention for high‐risk human papillomavirus persistent infection | |
| CN104257745B (en) | A kind of Polysaccharides from Prunella vulgaris L extract and preparation method thereof, preparation and purposes | |
| CN115645477A (en) | Traditional Chinese medicine formula for preventing and treating HPV (human papillomavirus) and preparation method thereof | |
| Mou et al. | Anti‐hepatitis B virus activity and hepatoprotective effect of des (rhamnosyl) verbascoside from Lindernia ruellioides in vitro | |
| CN115381857B (en) | Application of mesenchymal stem cells in preparation of medicine for treating HPV persistent infection | |
| CN103494860A (en) | Method for preparing lithospermum extract and application of lithospermum extract | |
| CN102885928A (en) | Chinese medicinal injection for treating jaundice and preparation method thereof | |
| CN107184815B (en) | Traditional Chinese medicine composition for treating tuberculous ulcer and sinus, preparation method and application thereof | |
| CN108159337B (en) | Pharmaceutical composition for treating viral hepatitis B or C | |
| CN101199498A (en) | Medicament of anti-nipple tumor virus infection | |
| CN102058568B (en) | Application of germacrone | |
| CN109223876A (en) | One kind being used for the composition of human papilloma virus (HPV) | |
| CN110292621A (en) | The antitoxin antibacterial complexing agent of anti-HPV viruse infection and its preparation method of phase inversion gel | |
| CN103892956B (en) | A kind of sheath with antivirus action | |
| CN103877112A (en) | Pharmaceutical composition containing ginsenoside Rh2 and ophiopogonin B | |
| CN112569274A (en) | Application of bistort rhizome extract in preparation of anti-cervical cancer drugs | |
| CN117899103A (en) | Application of clematis polysaccharide in preparation of medicines for treating or preventing HCMV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |