CN115612635A - Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof - Google Patents

Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof Download PDF

Info

Publication number
CN115612635A
CN115612635A CN202210720843.3A CN202210720843A CN115612635A CN 115612635 A CN115612635 A CN 115612635A CN 202210720843 A CN202210720843 A CN 202210720843A CN 115612635 A CN115612635 A CN 115612635A
Authority
CN
China
Prior art keywords
microbial inoculum
akkermansia muciniphila
mice
liver
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210720843.3A
Other languages
Chinese (zh)
Inventor
谷劲松
陈家璇
李源
王艺霖
吴梦尧
徐会连
张秀君
谭晓军
成堃
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Jinan
Original Assignee
University of Jinan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Jinan filed Critical University of Jinan
Priority to CN202210720843.3A priority Critical patent/CN115612635A/en
Publication of CN115612635A publication Critical patent/CN115612635A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745—Bifidobacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225—Lactobacillus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a mucinous Essemann-pick bacterium ww001, a composition, a composite microbial inoculum and application thereof, belonging to the technical field of microorganisms. The Akkermansia muciniphila (Akkermansia muciniphila) ww001 is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2021040; the preservation date is 2021, 01 month and 08 days; the address of the depository institution: china, wuhan university. The akkermansia muciniphila ww001 disclosed by the invention is beneficial to reversing intestinal mucosa injury caused by ethanol exposure, so that the integrity of an intestinal mucosa barrier and the dynamic balance of intestinal flora are recovered, and liver injury such as steatosis, liver inflammation and the like is avoided.

Description

Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof
Technical Field
The invention belongs to the technical field of microorganisms, and particularly relates to a mucinous Ehrlichia ww001, a composition thereof, a composite microbial inoculum and application thereof.
Background
Alcoholic Liver Disease (ALD) has been currently listed behind cardiovascular diseases, tumors, as a third-place public health problem, and currently, up to 330 million people die of alcoholism each year, accounting for 6% of the total number of deaths worldwide. The development process of alcoholic liver disease is divided into three stages, fatty liver, hepatitis and cirrhosis, where the fatty liver stage can be reversed by dietary control. It is noted that only about 15% to 20% of alcoholics develop alcoholic hepatitis patients, and that alcoholic hepatitis and cirrhosis do not occur only in severe alcoholics, which may lead to severe alcoholic hepatitis and cirrhosis even if some people drink small amounts of alcohol, for example, women are more likely to suffer from alcohol-induced liver-related disorders than men.
The research shows that the gene polymorphism of cytochrome P4502E1 (CYP 2E 1) and alcohol dehydrogenase-3 (ADH-3) is a risk factor for alcoholics to develop alcoholic liver disease, and the gene polymorphism of Patatin-like phospholipase-3 (PNPLA-3) is also a factor for developing alcoholic cirrhosis. Another important genetic factor related to the progress of alcoholic liver disease is the gene polymorphism of acetaldehyde dehydrogenase (ALDH), ethanol enters into the body, and is firstly dehydrogenated and oxidized into acetaldehyde, the acetaldehyde is continuously dehydrogenated and oxidized into acetic acid, the acetic acid forms acetyl coenzyme A to participate in tricarboxylic acid cycle, and finally final products such as energy ATP, water, carbon dioxide and the like are generated. Alcohol dehydrogenase, liver microsome alcohol oxidase system, hydrogen peroxide oxidase system, etc. in human body can oxidize alcohol into acetaldehyde, acetaldehyde metabolism can be carried out only under the catalysis of acetaldehyde dehydrogenase, and various acetaldehyde dehydrogenases exist in human body, wherein acetaldehyde dehydrogenase-2 has the strongest catalysis effect. Acetaldehyde dehydrogenase-2 has obvious ethnic difference in catalytic activity in human bodies, carries defective acetaldehyde dehydrogenase genes in nature, acetaldehyde generated after drinking cannot be completely decomposed into acetic acid by acetaldehyde dehydrogenase with low in-vivo activity, acetaldehyde in high concentration in the bodies promotes vasodilatation, people have drunkenness symptoms such as nausea, vomiting and coma, and the like, and acetaldehyde is a high-activity compound and can interfere with generation of mitochondrial ATP of liver cells and biosynthesis of protein, damage cell microtubules, cause protein and fat to generate excretion disorder and accumulate in the liver cells, cause osmotic swelling of the cells and further cause alcoholic liver injury.
The difference of alcoholic liver diseases among different crowds is not only related to the activity of alcohol metabolizing enzyme in liver cells, but also closely related to intestinal flora, and the quantity and the quality of the intestinal flora of alcoholic liver disease patients are obviously changed compared with those of normal crowds. Ethanol alters the composition ratio of intestinal microorganisms, resulting in increased intestinal permeability and bacterial endotoxins and metabolites entering the blood and liver, another important factor that leads to alcoholism. Research shows that the incidence of alcoholic liver disease is closely related to intestinal dysbiosis, the increase of ethanol concentration in the intestinal tract causes the overgrowth of Proteobacteria (Proteobacteria) and the like in the small intestine, the concentration of acetaldehyde derived from microorganisms is increased, the activity of acetaldehyde dehydrogenase for metabolizing acetaldehyde is lower in the intestinal mucosa, part of acetaldehyde may be continuously present in the intestinal tract and causes local injury, and thus the intestinal permeability is further improved.
The intake of ethanol can cause intestinal microecological imbalance by affecting the permeability of intestinal mucosa, intestinal dysbacteriosis, bacterial translocation and other modes, thereby activating the immune response of organisms and inducing the liver to generate inflammatory reaction to cause liver injury. Llopis et al found that mice transplanted with intestinal flora from alcoholic hepatitis patients develop more severe inflammation of the liver, have higher intestinal permeability and higher mobility of bacterial endotoxin than the control group. The results of this study indicate that the gut microbiota directly mediates the development of alcoholic liver disease. An article published by Llorente et al in Nature communication reports that alcohol increases the proportion of Enterococcus (Enterococcus spp) in the intestinal tract of mice, and that transplantation of Enterococcus to mice also results in liver inflammation and death of hepatocytes [8]. The results of the study show that ethanol reduces part of the nutritional sources of beneficial microorganisms-Short Chain Fatty Acids (SCFAs) and Branched Chain Amino Acids (BCAAs), thereby directly or indirectly altering the composition of the gut microbiota.
Ferrer et al attempted to improve and treat alcoholic liver disease in mice by a method of Fecal Transplantation (FMT), in which Fecal material containing bacteria from healthy individuals was transplanted into recipient mice. They fed mice with Lieber DeCarli alcohol liquid diet and found that some mice did not develop alcohol-induced liver damage, and these mice were named alcohol-resistant group. The Ferrer transplants the feces of the donor mice with the ethanol tolerance to the recipient mice with the ethanol sensitivity three times a week for three weeks, successfully reverses the intestinal flora disorder of the sensitive mice caused by the ethanol, recovers the dynamic balance of the intestinal flora, and avoids the liver injury phenomena such as fatty degeneration, liver inflammation and the like. This study indicates that a proportion of gut commensal bacteria play an important role in regulating host immune responses and maintaining the integrity of the gut mucosa.
In 2018, grander et al found that Akkermansia muciniphila (Akkermansia muciniphil) in intestinal tract of alcoholic fatty liver patientsa, akk) abundance correlates with the severity of alcoholic liver disease. Feeding the mice with the ethanol feed can cause the abundance of the Exmansonia acuminata to be remarkably reduced, and the Exmansonia acuminata in intestinal tracts is supplemented (gavage is 1.5 multiplied by 10) 8 CFUs/time, 3 times per week) can significantly reduce liver damage and hepatic steatosis (decreased glutamate pyruvate transaminase level, decreased expression of pro-inflammatory cytokines in the liver) in mice, prevent alcohol-induced intestinal leakage, enhance intestinal mucus thickness, promote intestinal barrier integrity, and improve experimental alcoholic liver disease. The research result shows that the alcoholic liver disease patient can benefit by supplementing the Acinetobacter.
The Achromobacter argyi colonizes in a mucous layer of intestinal tracts of a human body, mucoprotein is degraded to provide a nitrogen source and a carbon source for self colonization, and the strain is preferentially utilized for the mucoprotein, so that the Achromobacter argyi colonizes in mucous layers of tail ends of ileums and colons with abundant mucoprotein, the colonization of the Achromobacter argyi is mainly influenced by components of the mucous layer and changes along with the development change of the mucous layer, the strain accounts for 3% -5% of the total amount of intestinal microorganisms under normal conditions, and the colonization of the group of bacteria in intestinal tracts of the old people is obviously reduced. In animal models with diabetes and obesity, eckmann species can help remodel the integrity of epithelial mucosa, reduce weight gain and fat accumulation, improve glucose tolerance, and reduce inflammation and metabolic endotoxemia. As the only representative known in the phylum enterowartia, akkermansia contains genes unique to the microbiome of many human species, and thus altering its abundance is highly likely to significantly affect the functionality of the entire microflora of the intestine. After the mixed bacteria of the bifidobacterium animalis and the lactobacillus rhamnosus are taken by mice, the abundance of the Ackermanus in the intestinal tract is obviously increased, and the lactobacillus reuteri can also cause the abundance of the Ackermanus in the intestinal tract to be increased, which indicates that a remarkable interaction mechanism exists between the Ackermanus and other intestinal bacteria.
Based on that akkermansia muciniphila can effectively relieve and prevent alcoholic liver injury, a composition for effectively treating alcoholic liver injury is designed by taking akkermansia muciniphila as a core and combining bifidobacterium animalis, lactobacillus rhamnosus, lactobacillus reuteri, polyphenol natural product extracts such as ellagitannin, dihydromyricetin and the like.
Disclosure of Invention
Aiming at the problems, the invention provides a viscous protein Aickmann bacterium ww001, a composition thereof, a composite microbial inoculum and application thereof, which are used for treating alcoholic liver injury. The use of the akkermansia muciniphila ww001 disclosed by the invention is beneficial to reversing the damage of the intestinal mucosa caused by ethanol exposure, so that the integrity of the intestinal mucosa barrier and the dynamic balance of the intestinal flora are recovered, and the liver damage such as steatosis, liver inflammation and the like is avoided.
In a first aspect, the present invention provides a viscoelastic protein Akkermansia mulcinilia ww001, wherein the Akkermansia mulcinilia ww001 is deposited at the chinese type culture collection center at 2021, day 01 and 08, and the deposit number is CCTCC NO: m2021040; and (4) storage address: china, wuhan university.
The culture method of the akkermansia muciniphila ww001 comprises the following steps:
the basic culture medium comprises carbon source, nitrogen source, basic components, growth factor and trace elements. Wherein:
the carbon source contained 9.0g/L glucose and 11.1g/L N-acetylglucosamine;
the nitrogen sources include: amino acid and mucin Muc, the total concentration is 2.77g/L; the amino acid comprises the following components in percentage by weight: threonine 29.5%, proline 12.9%, glycine 2.5%, valine 4.2%, serine 16%, cysteine 3.4%, isoleucine 3.4%, glutamine 3.4%, leucine 6%, glutamic acid 2.5%, aspartic acid 2.5%, alanine 1.6%, lysine 1.6%, asparagine 1.6%, tyrosine 2.5%, arginine 1.6%, histidine 1.6%, phenylalanine 1.6%, methionine 0.8%, tryptophan 0.8%;
the basic components comprise: na (Na) 2 HPO 4 ·2H 2 O 0.5g/L、KH 2 PO 4 0.4g/L、NH 4 Cl 0.3g/L、CaCl 2 ·2H 2 O 0.1g/L、MgCl 2 ·6H 2 O 0.1g/L、NaCl 0.3g/L、NaHCO 3 4g/L、Na 2 S·9H 2 O 0.48g/L；
The growth factors include: biotin 0.004mg/L, nicotinic acid 0.04mg/L, pyridoxine 0.1mg/L, riboflavin 0.02mg/L, thiamine 0.04mg/L, cyanocobalamin 0.02mg/L, p-aminobenzoic acid 0.02mg/L, pantothenic acid 0.02mg/L, choline 0.1mg/L, inositol 0.08mg/L, menadione 0.02mg/L, lutein 0.04mg/L, folic acid 0.01mg/L;
the trace elements include: feCl 2 0.9mg/L、H 3 BO 4 0.08mg/L、ZnCl 2 0.07mg/L、CuCl 2 0.01mg/L、 MnCl 2 0.06mg/L、CoCl 2 0.07mg/L、NiCl 2 0.01mg/L、Na 2 SeO 3 0.02mg/L、Na 2 WO 4 ·2H 2 O 0.03mg/L、Na 2 MoO 4 0.02mg/L。
The feeding liquid has the same components as the carbon source and the nitrogen source in the basic culture medium by adopting a feeding culture mode, wherein the concentration of the carbon source is 60.3g/L, the concentration of the nitrogen source is 8.31g/L, and after the feeding is completed, the final concentration of the carbon source in the culture medium is 40.2g/L and the final concentration of the nitrogen source is 5.54g/L.
The culture temperature is as follows: 20-40 ℃, preferably 37 ℃.
pH = 5.5-8.0, preferably pH =6.5, using 10% NaOH or 15% Na 2 CO 3 And (5) controlling.
Protective gas: n is a radical of 2 :CO 2 20 (v/v) or N =80 2 :CO 2 :H 2 20 (v/v/v), and the pressure is 182kPa (1.8 atm).
The solvent of the growth factor can be absolute ethyl alcohol, is prepared into mother liquor with proper concentration, and is directly added after high-temperature steam sterilization. The components of the culture medium of the invention can be mixed together for high-temperature sterilization.
In a second aspect, the invention provides a composition comprising akkermansia muciniphila ww001, said composition comprising one or more pharmaceutically acceptable excipients or carriers.
In a third aspect, the invention provides a complex microbial inoculum comprising Akkermansia muciniphila ww001, wherein the complex microbial inoculum comprises Akkermansia muciniphila (Akkermansia muciniphila), bifidobacterium animalis (Bifidobacterium animalis), lactobacillus rhamnosus (Lactobacillus rhamnosus) and Lactobacillus reuteri (Lactobacillus reuteri).
Preferably, the compound microbial inoculum comprises the following components of akkermansia muciniphila: bifidobacterium animalis: lactobacillus rhamnosus: the viable bacteria number ratio of lactobacillus reuteri is 3.
In a fourth aspect, the invention provides a composition containing the complex microbial inoculum, wherein the composition comprises ellagitannin and dihydromyricetin, and the weight ratio of the ellagitannin to the dihydromyricetin is 3:1; the adding amount of the ellagitannin and the dihydromyricetin is 5 times of the mass of the composite microbial inoculum.
In a fifth aspect, the invention provides an application of akkermansia muciniphila ww001 in preparation of a medicine for treating and/or preventing liver injury.
In a sixth aspect, the invention provides an application of a complex microbial inoculum containing akkermansia muciniphila ww001 in preparation of a medicament for treating and/or preventing liver injury.
In a seventh aspect, the invention provides an application of a composition containing an akkermansia muciniphila ww001 composite microbial inoculum in preparation of a medicament for treating and/or preventing liver injury.
Preferably, the liver injury is alcoholic liver injury.
The invention has the beneficial effects that:
(1) The akkermansia muciniphila ww001 disclosed by the invention is beneficial to reversing intestinal mucosa injury caused by ethanol exposure, so that the integrity of an intestinal mucosa barrier and the dynamic balance of intestinal flora are recovered, and liver injury such as steatosis, liver inflammation and the like is avoided.
(2) The bacterial composition provided by the invention can increase the activity of Alcohol Dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) and accelerate alcohol metabolism.
(3) Liver damage caused by acute and chronic alcohol of mice can increase the content of TG, AST, ALT and AKP in serum, and the bacterial composition can reduce the content of TG, AST, ALT and AKP by being applied. The inventors have also determined that by treating immortalised human normal liver cells HL7702 cells in vitro, alcohol has an inhibitory effect on the growth of HL7702 cells, and that the inclusion of the bacterial composition of the invention can slow down the inhibitory effect of alcohol on cells. Alcohol causes a large amount of lipid deposition in cells, and administration of the bacterial composition of the present invention can significantly reduce the formation of lipid droplets and inhibit TG synthesis in cells.
(4) The culture medium can improve the growth rate of the akkermansia muciniphila and realize high-density fermentation. The concentration of the culture medium can reach 3.0 multiplied by 10 10 CFU/mL。
Drawings
In order to more clearly illustrate the embodiments or technical solutions in the prior art of the present invention, the drawings used in the embodiments or technical solutions in the prior art will be briefly described below, and it is obvious for those skilled in the art that other drawings can be obtained according to these drawings without creative efforts.
FIG. 1 is a graph showing the effect of Alcohol Dehydrogenase (ADH) on liver of an alcoholism mouse in example 2 of the present invention.
FIG. 2 is a graph showing the effect of hepatic acetaldehyde dehydrogenase (ALDH) of mice with alcoholism in accordance with example 2 of the present invention.
FIG. 3 is a graph showing the effect of glutamic pyruvic transaminase (ALT) on liver of alcoholism mice in example 2 of the present invention.
FIG. 4 is a graph showing the effect of example 2 on aspartate Aminotransferase (AST) in the liver of an alcoholism mouse.
FIG. 5 is a chart of HL7702 cell oil red O staining which characterizes the improvement effect of the microbial inoculum of the examples 2 and 3 on the alcoholic liver diseases of mice.
FIG. 6 is a graph of HE staining of liver tissue sections to characterize the improvement effect of the microbial inoculum of examples 2 and 3 of the invention on mouse alcoholic liver disease.
FIG. 7 is a random forest map of mice with the microbial inoculum composition and the gavage alcohol according to example 4 of the present invention.
Fig. 8 is a graph of changes in metagenome COG-predicted intragastric perfusion of a complex microbial inoculum mouse and an intragastric perfusion alcohol mouse in embodiment 3 of the invention.
Fig. 9 is a variation graph of the microbial inoculum composition mice and the gavage alcohol mice in embodiment 4 of the invention for predicting gavage by metagenome COG.
Fig. 10 is a graph of metagenomic EC predicting the changes of gavage compound bacteria mice and gavage alcohol mice in example 3 of the present invention.
Fig. 11 metagenome EC predicts the change profile of gavage mouse and gavage alcohol mouse of the microbial inoculum composition of example 4 of the present invention.
Fig. 12 is a graph showing how the metagenome KO predicts the gavage of the compound microbial inoculum mice and the gavage alcohol mice in example 3 of the present invention.
FIG. 13 metagenome KO predicts the changes of gavage mice and gavage alcohol mice with the microbial inoculum composition of example 4 of the present invention.
FIG. 14 shows the variation of the enteromucophilic protein Ackermansia in mice with gavage alcohol and normal control mice with the complex microbial inoculum of example 3 and the microbial inoculum composition of example 4.
FIG. 15 is a graph showing the comparison of the degree of liver hypertrophy of mice with gavage alcohol and normal control mice, wherein the mice are prepared by gavage with the complex microbial inoculum of example 3 and the microbial inoculum composition of example 4.
Detailed Description
In order to make those skilled in the art better understand the technical solution of the present invention, the technical solution in the embodiment of the present invention will be clearly and completely described below with reference to the drawings in the embodiment of the present invention, and it is obvious that the described embodiment is only a part of the embodiment of the present invention, and not a whole embodiment. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1
The invention provides a muciniphilic Akkermansia (Akkermansia muciniphila) ww001, which is preserved in China Center for Type Culture Collection (CCTCC) at No. 01/08 of 2021, and the preservation number is CCTCC NO: m2021040; the preservation address is as follows: china, wuhan university. The specific screening method of the akkermansia muciniphila ww001 comprises the following steps:
(1) The strain source is as follows: feces of healthy adults.
(2) Culture medium:
10 × buffer solution: weighing 4.1g KH 2 PO 4 、5.3g Na 2 HPO 4 、40g NaHCO 3 Adding 800mL of distilled water for dissolving, adjusting the pH value to 7.2, and adding distilled water for constant volume to 1L; each 1L of the culture medium was prepared in 100mL of 10 Xbuffer solution. To the removed buffer was added 0.5g of L-cysteine, the pH was adjusted to 7.2, and membrane filtration sterilized.
Solution A: each 1 liter contains NH 4 Cl 24g、NaCl 24g、CaCl 2 ·2H 2 O8.8 g and MgCl 2 ·6H 2 O 8g；
And B, liquid B: h 3 BO 3 0.618g、ZnCl 2 0.682g、CuCl 2 ·2H 2 O 0.17g、MnCl 2 ·4H 2 O 0.99g、 CoCl 2 ·6H 2 O 1.19g、NiCl 2 ·6H 2 0.238g of O was prepared into 20mL of 10 Xmother liquor, and FeCl was added thereto 2 ·4H 2 O0.298 g and concentrated hydrochloric acid (12M, 4.17 mL) to a constant volume of 200mL;
and C, liquid C: na (Na) 2 SeO 3 ·5H 2 O 0.262g、Na 2 WO 4 ·2H 2 O 0.33g、Na 2 MoO 4 ·2H 2 Preparing 10 multiplied by 1L of working solution by 0.242g of O and 4g of NaOH, and then adding 20mL of distilled water to the mother solution to be 200mL;
enrichment culture medium: each 100mL of the medium contained 10 Xbuffer solution (10mL), solution A (12.5mL), solution B (1mL), solution C (1 mL), resazurin (0.5 mg), and mucin (2.5 g).
Separating a culture medium: the enrichment medium was added agar in proportion (100mL, 3g).
Primary screening of culture medium: each 10mL of the medium contained 3.85g of BHI medium and 2.5g of mucin.
(3) Separation of the strains: diluting a fecal sample by using PBS (phosphate buffer solution) containing L-cysteine hydrochloride according to the gradient of 10 times until the fecal sample is invisible to the naked eyes and turbid to obtain a first sample invisible to the naked eyes; diluting the first turbid sample with 10-fold gradient, 2 10-fold gradient and 3 10-fold gradient to obtain a second turbid sample with no visible light, a third turbid sample with no visible light and a fourth turbid sample with no visible lightNo cloudy sample was visible; respectively inoculating a first sample, a second sample, a third sample and a fourth sample to an enrichment medium, and performing anaerobic constant-temperature culture at 37 ℃ for 48-72 h to obtain an enriched sample; selecting an enrichment sample which grows turbid in an enrichment culture medium, has no precipitate, agglomeration or filiform substance and has higher dilution gradient for carrying out first PCR detection to obtain a positive enrichment sample; positive enrichment samples were diluted to 10 gradient with PBS buffer -1 ～10 -9 Obtaining a diluted enrichment sample; get 10 -3 ～10 -9 Coating the diluted enrichment sample in a dilution gradient in a separation culture medium, and carrying out anaerobic constant-temperature culture at 37 ℃ for 1-2 weeks to obtain a separation bacterial colony; selecting an isolated colony which is free of foreign bacteria, has a diameter within 1mm, is milky white and sticky, and is inoculated into a primary screening culture medium, and performing anaerobic constant-temperature culture at 37 ℃ for 48-96 hours to obtain primary screening bacterial liquid; and selecting the primary screening bacterial liquid with the absorbance OD600 lower than 0.4 to perform second PCR identification and sequencing identification to obtain the Erwinia euchroma (Akkermansia muciniphila).
(4) Identification of the strains
First and second PCR primers
AM1(5’→3’)CAGCACGTGAAGGTGGGGAC(SEQ ID NO.1)
AM2(5’→3’)CCTTGCGGTTGGCTTCAGAT(SEQ ID NO.2)
Sequencing identification PCR primer
27F(5’→3’)AGAGTTTGATCCTGGCCTCA
1492R(5’→3’)GGTTACCTTGTTACGACTT
And (3) sequencing results:
TGCAAACTTGTTCGACTTCATCCCAGTTACCAGTCTCACCTTAGGACCCTGCCTCCT TGCGGTTGGCTTCAGATACTTCGGGTGCGACCGGCTTCCATGATGTGACGGGCGGTGTG TACAAGACCCGGGAACGTATTCACGGCGCCGTAGCTGATGCGCCATTACTAGCGATTCC GGCTTCGTGTAGGCGGGTTGCAGCCTACAGTCCGAACTGGGCCCAGTTTTTAGGATTTC CTCCGCCTCGCGGCTTCGGCCCCCTCTGTACTGGGCATTGTAGTACGTGTGCAGCCCTGG GCATAAGGGCCATACTGACCTGACGTCGTCCCCACCTTCCTCCCAGTTGATCTGGGCAGT CTCGCCAGAGTCCCCACCTTCACGTGCTGGTAACTGGCAACAGGGGTTGCGCTCGTTGC TGGACTTAACCAAACATCTCACGACACGAGCTGACGACGGCCATGCAGCACCTGTGTAA CGCCTCCGAAGAGTCGCATGCTTTCACATGTTGTTCATTACATGTCAAGCCCAGGTAAGG TTCTTCGCGTTGCATCGAATTAAGCCACATACTCCACCGCTTGTGCGGGTCCCCGTCAAT TTCTTTGAGTTTTAATCTTGCGACCGTACTCCCCAGGCGGCACGCTTAACGCGTTAGCTC CGGCACGCAGGGGGTCGATTCCCCGCACACCAAGCGTGCACCGTTTACTGCCAGGACT ACAGGGGTATCTAATCCCTTTCGCTCCCCTGGCCTTCGTGCCTCAGCGTCAGTTAATGTC CAGGAACCCGCCTTCGCCACGAGTGTTCCTCTCGATATCTACGCATTTCACTGCTACACC GAGAATTCCGGTTCCCCCTCCATTACTCTAGTCTCGCAGTATCATGTGCCGTCCGCGGGT TGAGCCCGCGCCTTTCACACACGACTTACGAAACAGCCTACGCACGCTTTACGCCCAGT GATTCCGAACAACGCTTGAGACCTCTGTATTACCGCGGCTGCTGGCACAGAGTTAGCCG TCTCTTCCTCTTGTGGTACTATCTTTTTAATTTGCTCCCACATGACAGGGGTTTACAATCC GAAGACCTTCATTCCCCCACGCGGCGTCGCACCATCAGGGTTTCCCCCATTGTGAATGAT TCTCGACTGCTGCCACCCGTAGGTGTCTGGACCGTGTCTCAGTTCCAGTGTGGCCGGAC ATCCTCTCAGACCGGCTACCCGTCATCGCCTTGGTGAGCCGTTACCTCACCAACTAACTA ATAGGCCGCGAGCCCATCCCCAAGCGCATTGCTGCTTTAATCTTTCGATACTATGCGGTAT TAATCCCAGTTTCCCAGGGCTATCCCGCTCTCGGGGGCAGGTTACTCACGTGTTACTCAC CCGTGCGCCACTAGAGAATTATTAGCAAGCTAGCAATTCTCTCGTTCGACTTGCAGTCTA CAAGGGGC。
example 2
The fermentation method of the akkermansia muciniphila ww001 comprises the following steps:
the basic culture medium comprises the following components:
the carbon source comprises: 9.0g/L glucose and 11.1g/L N-acetylglucosamine;
the nitrogen sources include: amino acid and mucin Muc, the total concentration is 2.77g/L; the amino acid comprises the following components in percentage by weight: threonine 29.5%, proline 12.9%, glycine 2.5%, valine 4.2%, serine 16%, cysteine 3.4%, isoleucine 3.4%, glutamine 3.4%, leucine 6%, glutamic acid 2.5%, aspartic acid 2.5%, alanine 1.6%, lysine 1.6%, asparagine 1.6%, tyrosine 2.5%, arginine 1.6%, histidine 1.6%, phenylalanine 1.6%, methionine 0.8%, tryptophan 0.8%;
the basic components comprise: na (Na) 2 HPO 4 ·2H 2 O 0.5g/L、KH 2 PO 4 0.4g/L、NH 4 Cl 0.3g/L、CaCl 2 ·2H 2 O 0.1g/L、MgCl 2 ·6H 2 O 0.1g/L、NaCl 0.3g/L、NaHCO 3 4g/L、Na 2 S·9H 2 O 0.48g/L；
The growth factors include: biotin 0.004mg/L, nicotinic acid 0.04mg/L, pyridoxine 0.1mg/L, riboflavin 0.02mg/L, thiamine 0.04mg/L, cyanocobalamine 0.02mg/L, p-aminobenzoic acid 0.02mg/L, pantothenic acid 0.02mg/L, choline 0.1mg/L, inositol 0.08mg/L, menadione 0.02mg/L, lutein 0.04mg/L, folic acid 0.01mg/L;
the trace elements include: feCl 2 0.9mg/L、H 3 BO 4 0.08mg/L、ZnCl 2 0.07mg/L、CuCl 2 0.01mg/L、 MnCl 2 0.06mg/L、CoCl 2 0.07mg/L、NiCl 2 0.01mg/L、Na 2 SeO 3 0.02mg/L、Na 2 WO 4 ·2H 2 O 0.03mg/L、Na 2 MoO 4 0.02mg/L。
The feeding liquid has the same components as the carbon source and the nitrogen source in the basic culture medium by adopting a feeding culture mode, wherein the concentration of the carbon source is 60.3g/L, the concentration of the nitrogen source is 8.31g/L, and after the feeding is completed, the final concentration of the carbon source in the culture medium is 40.2g/L and the final concentration of the nitrogen source is 5.54g/L.
The culture temperature is as follows: 37 ℃ is carried out.
Fermentation time: and 7 days.
pH＝6.5。
Protective gas: n is a radical of 2 :CO 2 20 (v/v) and a pressure of 182kPa (1.8 atm).
Detecting the strain concentration in the fermentation liquor to be 3.0 multiplied by 10 after the fermentation is finished 10 CFU/ml。
Example 3
A liquid complex microbial inoculum comprising a mucinous Ekermansia ww001, wherein the complex microbial inoculum comprises the mucinous Ekermansia ww001, bifidobacterium animalis (Bifidobacterium animalis) Bio-67304, lactobacillus rhamnosus (Lactobacillus rhamnosus) Bio-67385 and Lactobacillus reuteri (Lactobacillus reuteri) Bio-67171.
The bifidobacterium animalis was purchased from https:// www.biobw.org/, platform No.: bio-67304;
the Lactobacillus rhamnosus was purchased from https:// www.biobw.org/, platform No.: bio-67385;
the Lactobacillus reuteri strain was purchased from https:// www.biobw.org/, platform No.: bio-67171.
In the complex microbial inoculum, the viscosity-philic protein Aickmann bacterium ww001: bifidobacterium animalis Bio-67304: lactobacillus rhamnosus Bio-67385: viable bacteria count ratio of lactobacillus reuteri Bio-67171 = 3.
The cultivation method of Exmenopteria muciniphila ww001 was the same as in example 2;
the fermentation method of bifidobacterium animalis Bio-67304 is as follows:
the basal medium comprises: 10g/L hydrolyzed casein, 5g/L phytone, 2g/L yeast powder, 5g/L glucose, and dipotassium hydrogen phosphate (K) 2 HPO 4 ·7H 2 O) 2g/L, magnesium chloride (MgC 1) 2 ·6H 2 O) 0.5g/L, zinc sulfate (ZnSO) 4 ·7H 2 O) 0.25g/L, calcium chloride (CaC 1) 2 ) 0.15g/L, iron chloride (FeC 1) 3 ) 0.1mg/L, cysteine-hydrochloric acid 0.5g/L, tween-80 1mL/L, final pH =6.5 ± 0.2.
The culture conditions are as follows:
the culture temperature is as follows: 37 ℃; pH =6.5; protective gas: n is a radical of 2 /CO 2 (80, 20,v/v); the pressure was 182kPa (1.8 atm).
The fermentation method of Lactobacillus rhamnosus Bio-67385 and Lactobacillus reuteri Bio-67171 is as follows:
the basal medium comprises: 10.0g/L of peptone, 5.0g/L of beef extract powder, 5.0g/L of yeast extract, 1.0mL/L of Tween-80, 2g/L of diamine citrate, 20.0g/L of glucose, 5.0g/L, K of sodium acetate 2 HPO 4 ·3H 2 O 2.0g/L、MgSO 4 ·7H 2 O 0.2g/L、MnSO 4 ·4H 2 O0.1 g/L, final pH =6.5 ± 0.2.
The culture conditions are as follows:
the culture temperature is 37 ℃; pH =6.5; protective gas: n is a radical of hydrogen 2 /CO 2 (80, 20,v/v); the pressure was 182kPa (1.8 atm).
Example 4
A composition containing a complex microbial inoculum of akkermansia muciniphila ww001, wherein the complex microbial inoculum is the complex microbial inoculum of the akkermansia muciniphila ww001: bifidobacterium animalis Bio-67304: lactobacillus rhamnosus Bio-67385: lactobacillus reuteri Bio-67171 (viable cell count ratio) = 3.
The preparation method comprises the following steps:
to the complex microbial inoculum prepared in example 3, a polyphenol natural product extract (the mass ratio of ellagitannin to dihydromyricetin is 3:1) was added, wherein the weight ratio of the complex microbial inoculum to the polyphenol natural product extract is 5:1.
Example 5
The microbial inoculum prepared in examples 2-4 was subjected to mouse experiments, the specific method was as follows:
1. method for constructing mouse alcoholic liver disease model by Lieber-Decalli method
C57BL/6 mice, male, 8-10 weeks old, body mass 20-25g. One week after normal feed feeding of C57BL/6 mice, the mice were divided into control and ethanol groups, each group with n =10-12 (as the case may be). The mice in the control group and the ethanol group are respectively fed with the control feed L10015 and the Lieber-Decali feed for 7 weeks, and the caloric ratio provided by the ethanol in the feed of the mice in the ethanol group is gradually increased: 10% (week 1), 20% (week 2), 25% (weeks 3, 4), 30% (weeks 5-7), see table 1 below. The desired samples were collected after 7 weeks.
TABLE 1 calorie of each component of the feed (cal)
Figure BDA0003711209230000121
Figure BDA0003711209230000131
Note: the ethanol heat proportion in the Lieber-Decalli model is gradually adjusted from 10% to 30%, and the carbohydrate proportion is correspondingly adjusted. 1cal =4.1859j.
2. The microbial inoculum prepared in the embodiment 2 to 4 and the composition containing the microbial inoculum are respectively used for intragastric administration of alcoholic liverThe gavage amount of the disease model mouse is 1.5 multiplied by 10 of the total bacteria count 9 CFU/200 μ l saline, gavage once every 8 to 11 days for 15 days. The control group uses the equivalent physiological saline of the gavage of an alcoholic liver disease model mouse; the blank group was treated with normal mice with the same amount of physiological saline by intragastric administration. Analyzing the abundance of the akkermansia sp and the change of the metagenome of the intestinal flora of the gavage mice, calculating the colonization proportion of the akkermansia sp, and analyzing each pathological index of the alcoholic liver disease. The specific result is shown in the attached figures 1-15 in the specification.
FIG. 1 shows the effect of the microbial inoculum and compositions containing the microbial inoculum prepared in examples 2 to 4 on Alcohol Dehydrogenase (ADH) in liver of alcoholism mice. It can be seen from the figure that the activity of the alcohol dehydrogenase in mice of the microbial inoculum and the composition containing the microbial inoculum prepared in the gavage examples 2-4 is obviously increased, and the difference is most obvious compared with the control group at 60 minutes.
FIG. 2 shows the effect of the microbial inoculum and compositions containing the microbial inoculum prepared in examples 2 to 4 on alcohol intoxication mouse liver acetaldehyde dehydrogenase (ALDH). It can be seen from the figure that the acetaldehyde dehydrogenase activity of the mice of the microbial inoculum and the composition containing the microbial inoculum prepared in the gavage examples 2 to 4 is remarkably increased, and the difference is most remarkable compared with the control group at 40 minutes.
FIG. 3 shows the effect of the microbial preparations prepared in examples 2 to 4 and compositions containing the same on alanine Aminotransferase (ALT) in liver of alcoholism mice. It can be seen from the figure that the glutamic-pyruvic transaminase activity of the microbial inoculum prepared in the intragastric gavage examples 2-4 and the composition containing the microbial inoculum is obviously reduced compared with that of the control group, and the acute liver cell damage is protected.
FIG. 4 shows the effect of the microbial inoculum and compositions containing the microbial inoculum prepared in examples 2 to 4 on aspartate Aminotransferase (AST) in the liver of an alcoholism mouse. It can be seen from the figure that the glutamic-oxaloacetic transaminase activity of the mice treated with the microbial inoculum and the composition containing the microbial inoculum prepared in the gavage examples 2-4 is significantly reduced compared with that of the control group, and acute liver cell damage is protected.
In view of the results shown in FIGS. 1 to 4, the composition containing the complex microbial preparation of Exmenoptera muciniphila ww001 in example 4 was most effective in treating alcoholic liver disease.
FIG. 5 records HL7702 cell oil red O staining to characterize the improvement effect of the composition of the complex microbial inoculum of example 3 and the complex microbial inoculum of example 4 on alcoholic liver cell injury. Wherein, A in the figure is a control group (HL 7702 cell); b is a cell image for long-term stem prognosis of human liver normal cells HL7702 by using ethanol; the intervention method comprises the following steps: human immortalized normal liver cells, HL7702 cells, were seeded at a density of 5,000 cells per well in 24-well plates and cultured in RPMI-1640 medium. After 24 hours, HL7702 cells were treated with alcohol at a final concentration of 100. Mu.M instead of the medium. And C is an image of HL7702 cells after ethanol drying is processed by using the composite microbial inoculum of the embodiment 3, and the processing method comprises the following steps: replacing the culture medium of ethanol intervention hepatic normal cells HL7702 with the composite microbial inoculum prepared in the example 3; d is an image of HL7702 cells after ethanol drying is processed by using the composite microbial inoculum composition of the embodiment 4, and the processing method comprises the following steps: the complex microbial inoculum composition prepared in example 4 was used to replace the culture medium of ethanol-dried hepatic normal cells HL 7702.
The observation of the results of the oil red O staining of HL7702 cells of the control group shows that the cells have good growth state and normal shape, and no obvious lipid droplets are formed in the cells. The results of cell oil red O staining after long-term stem prognosis of human liver normal cells HL7702 by using ethanol show that a large amount of lipid deposition is observed in HL7702 cells, orange-red lipid droplets are clearly formed, fat particles are clearly visible, and intracellular lipid droplets are arranged in a bead shape, are uniformly distributed and have clear limits. The lipid drop particles in HL7702 cells treated by the composite microbial inoculum composition of example 3 and the composite microbial inoculum composition of example 4 are obviously reduced, the relative distribution of lipid is uneven, and the arrangement is disordered compared with that of an alcohol group. The composite microbial inoculum and the composition containing the microbial inoculum in example 3 can reduce the formation of lipid droplets, and has obvious effect on in vitro alcoholic fatty liver cells.
FIG. 6 records HE staining of liver tissue sections to characterize the improvement effect of the combination of the complex microbial inoculum of example 3 and the complex microbial inoculum of example 4 on the alcoholic liver disease of mice. Wherein, A in the figure is a control group (a section of normal liver tissue of a mouse); b, tissue sections obtained after long-term dry prediction is carried out on mouse livers by using ethanol, and an intervention method adopts a Lieber-Decalli method to construct a mouse alcoholic liver disease model; c is a liver tissue section obtained after the mice suffering from alcoholic liver injury are drenched by using the composite microbial inoculum of the embodiment 3; and D is a liver tissue section obtained after the mice with alcoholic liver injury are drenched by using the composite microbial inoculum composition in the example 4. The liver section of the control mouse shows that the cell structure of the liver tissue is basically normal and clearly visible, the liver plate is arranged neatly, and the liver tissue has no obvious cell damage. The liver cells of the alcohol mice are seriously damaged pathologically, liver plates disappear, liver cords are disorganized, and the liver cords are changed into vacuole-like fat and accompanied with fibrosis. After the compound microbial inoculum and the compound microbial inoculum in the example 3 are treated, the damage of the liver of the mouse is reversed to a certain degree, and the liver plate is basically arranged neatly.
FIG. 7 is a random forest map of mice in gavage example 4 with the microbial inoculum composition and the gavage alcohol. Metagenome sequencing is carried out on intestinal flora of the mice, and compared with mice of mice in an alcohol group, the bacterial agent composition in the example 4 has the effect that the verrucomicrobia of the mice is remarkably increased, and the akkermansia muciniphila is a main bacterium in the level of the verrucomicia, so that the bacterial agent composition in the example 4 can remarkably increase the akkermansia muciniphila in intestinal tracts.
Fig. 8 records the changes of the compound bacterial agent mice and the gavage alcohol mice in the metagenome COG prediction gavage example 3. Macrogenome sequencing finds that the complex microbial inoculum of gavage example 3, mice dTDP-D-glucose 4,6-dehydratase, DNA gyrase/topoisomerase IV, subbunit A, 1696 rRNA G527 N7-methyl rsmG (former glucose-inhibited division protein B), short-chain dehydrogenase and other proteins are increased remarkably, and the method is favorable for preventing alcoholic liver injury.
FIG. 9 records the change of the microbial inoculum composition of mouse and the gavage alcohol mouse in the metagenome COG prediction gavage example 4. The proteins such as Predicted oxidant detect, predicted SnaL-like aldehyde condensation-catalysis enzyme, carboxylester type B and the like are increased remarkably, and the prevention of alcoholic liver injury is facilitated.
Fig. 10 records the changes of metagenome EC in predicting gavage example 3 in the compound bacterial agent mice and the gavage alcohol mice. Macro genome sequencing finds that the complex microbial inoculum in the gavage example 3 has obviously increased UDP-glucoronate 4-epimerase, D-glycerol-beta-D-mano-heptose-7-phosphate kinase, D-glycerol-beta-D-mano-heptose 1-phosphate adenylyltransferase, carbonate dehydrogenase and other enzymes, and is beneficial to preventing alcoholic liver injury.
Fig. 11 records the changes of the metagenome EC in predicting gavage example 4 in the microbial inoculum composition mice and the gavage alcohol mice. The macrogenomic sequencing shows that the microbial inoculum composition in the gastric lavage example 4 contains more enzymes such as mouse 3-hydro-L-gulonate-6-phosphate decarbonylase, glutamyl aminopeptidase, UDP-N-acetylmuramylpentapeptide-lysine N (6) -alanytransferase, UDP-N-acetylmuramyl-L-alanyl-D-glutaminate-L-lysine and the like, and is beneficial to preventing alcoholic liver injury.
Fig. 12 records the changes of the metagenome KO to predict gavage example 3 in the complex microbial inoculum mice and the gavage alcohol mice. The gavage example 3 complex microbial inoculum mouse gudB and rocG are found through metagenome sequencing; glutamate dehydrogenase, K05967; uncharged protein, plc, cpa; phospholipase C \ alpha-toxin, K09711; and the metabolic pathways such as the unicellularized protein and the like are remarkably increased, and the alcoholic liver injury can be prevented.
Fig. 13 records the changes of the metagenome KO predicted gavage example 4 in the microbial inoculum composition mice and the gavage alcohol mice. The microbial inoculum composition of gavage example 4, namely the mice sspF, is found by metagenomic sequencing; small acid-soluble spore protein F (minor alpha/beta-type SASP), disA; diadenylate cyclase, cdhE, acsC; acetylCoA decarbonylase/synthsase complex outburnit gamma and acsE; the metabolic pathways such as 5-methytrahydrofolate corrinoid/iron sulfur protein methytranferase and the like are obviously increased, and the method is favorable for preventing alcoholic liver injury.
FIG. 14 records that high throughput sequencing revealed changes in enteromucophilic Ichmansia in mice with gavage alcohol and normal control mice with the complex microbial inoculum of example 3 and the microbial inoculum composition of example 4. Akkermansia muciniphila in the body of the alcohol group mice is obviously reduced, and the intestinal canal Akkermansia muciniphila of the mice is recovered by gavage of the compound microbial inoculum of the example 3 and the microbial inoculum composition of the example 4.
FIG. 15 shows the comparison of the liver hypertrophy degree of the mice with gavage alcohol and normal control mice in the mice with the complex microbial inoculum of the gavage example 3 and the microbial inoculum composition of the example 4. Alcohol caused liver hypertrophy in mice, as evidenced by a significant increase in liver index, compared to liver index in control mice. After the treatment of the composite microbial inoculum of the example 3 and the microbial inoculum composition of the example 4, the liver index of the mice is reduced to different degrees. Particularly, after the microbial inoculum composition in the example 4 is treated, the liver index of the mice is obviously different from that of the mice in a control group. The experimental result shows that the composite microbial inoculum in the example 3 and the microbial inoculum composition in the example 4 have the effect of relieving the liver injury induced by the mice.
Although the present invention has been described in detail by referring to the drawings in connection with the preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made on the embodiments of the invention by those skilled in the art without departing from the spirit and scope of the invention, and these modifications or substitutions should be within the scope of the invention/any changes or substitutions that are obvious to those skilled in the art can be easily made within the technical scope of the invention disclosed in the invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.
SEQUENCE LISTING
<110> university of Jinan
<120> akkermansia muciniphila ww001, and composition, complex microbial inoculum and application thereof
<130> 2022.06.09
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 1437
<212> DNA
<213> Exkermanella muciniphila (Akkermansia muciniphila)
<400> 1
tgcaaacttg ttcgacttca tcccagttac cagtctcacc ttaggaccct gcctccttgc 60
ggttggcttc agatacttcg ggtgcgaccg gcttccatga tgtgacgggc ggtgtgtaca 120
agacccggga acgtattcac ggcgccgtag ctgatgcgcc attactagcg attccggctt 180
cgtgtaggcg ggttgcagcc tacagtccga actgggccca gtttttagga tttcctccgc 240
ctcgcggctt cggccccctc tgtactgggc attgtagtac gtgtgcagcc ctgggcataa 300
gggccatact gacctgacgt cgtccccacc ttcctcccag ttgatctggg cagtctcgcc 360
agagtcccca ccttcacgtg ctggtaactg gcaacagggg ttgcgctcgt tgctggactt 420
aaccaaacat ctcacgacac gagctgacga cggccatgca gcacctgtgt aacgcctccg 480
aagagtcgca tgctttcaca tgttgttcat tacatgtcaa gcccaggtaa ggttcttcgc 540
gttgcatcga attaagccac atactccacc gcttgtgcgg gtccccgtca atttctttga 600
gttttaatct tgcgaccgta ctccccaggc ggcacgctta acgcgttagc tccggcacgc 660
agggggtcga ttccccgcac accaagcgtg caccgtttac tgccaggact acaggggtat 720
ctaatccctt tcgctcccct ggccttcgtg cctcagcgtc agttaatgtc caggaacccg 780
ccttcgccac gagtgttcct ctcgatatct acgcatttca ctgctacacc gagaattccg 840
gttccccctc cattactcta gtctcgcagt atcatgtgcc gtccgcgggt tgagcccgcg 900
cctttcacac acgacttacg aaacagccta cgcacgcttt acgcccagtg attccgaaca 960
acgcttgaga cctctgtatt accgcggctg ctggcacaga gttagccgtc tcttcctctt 1020
gtggtactat ctttttaatt tgctcccaca tgacaggggt ttacaatccg aagaccttca 1080
ttcccccacg cggcgtcgca ccatcagggt ttcccccatt gtgaatgatt ctcgactgct 1140
gccacccgta ggtgtctgga ccgtgtctca gttccagtgt ggccggacat cctctcagac 1200
cggctacccg tcatcgcctt ggtgagccgt tacctcacca actaactaat aggccgcgag 1260
cccatcccca agcgcattgc tgctttaatc tttcgatact atgcggtatt aatcccagtt 1320
tcccagggct atcccgctct cgggggcagg ttactcacgt gttactcacc cgtgcgccac 1380
tagagaatta ttagcaagct agcaattctc tcgttcgact tgcagtctac aaggggc 1437
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
cagcacgtga aggtggggac 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
ccttgcggtt ggcttcagat 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
agagtttgat cctggcctca 20
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence
<400> 5
ggttaccttg ttacgactt 19

Claims (10)

1. The Akkermansia muciniphila ww001 is characterized in that the Akkermansia muciniphila ww001 is preserved in China center for type culture collection with the preservation number of CCTCC NO: m2021040; the preservation date is 2021, 01 month 08; the address of the depository institution: china, wuhan university.
2. A method for culturing the Ekermansia muciniphila ww001 according to claim 1, which comprises:
the basic medium comprises carbon source, nitrogen source, basic components, growth factor and trace elements; wherein:
the carbon source contained 9.0g/L glucose and 11.1g/L N-acetylglucosamine;
the nitrogen sources include: amino acid and mucin Muc, the total concentration is 2.77g/L; the amino acid comprises the following components in percentage by weight: threonine 29.5%, proline 12.9%, glycine 2.5%, valine 4.2%, serine 16%, cysteine 3.4%, isoleucine 3.4%, glutamine 3.4%, leucine 6%, glutamic acid 2.5%, aspartic acid 2.5%, alanine 1.6%, lysine 1.6%, asparagine 1.6%, tyrosine 2.5%, arginine 1.6%, histidine 1.6%, phenylalanine 1.6%, methionine 0.8%, tryptophan 0.8%;
the basic components comprise: na (Na) 2 HPO 4 ·2H 2 O 0.5g/L、KH 2 PO 4 0.4g/L、NH 4 Cl 0.3g/L、CaCl 2 ·2H 2 O 0.1g/L、MgCl 2 ·6H 2 O 0.1g/L、NaCl 0.3g/L、NaHCO 3 4g/L、Na 2 S·9H 2 O 0.48g/L；
The growth factors include: biotin 0.004mg/L, nicotinic acid 0.04mg/L, pyridoxine 0.1mg/L, riboflavin 0.02mg/L, thiamine 0.04mg/L, cyanocobalamin 0.02mg/L, p-aminobenzoic acid 0.02mg/L, pantothenic acid 0.02mg/L, choline 0.1mg/L, inositol 0.08mg/L, menadione 0.02mg/L, lutein 0.04mg/L, folic acid 0.01mg/L;
the trace elements include: feCl 2 0.9mg/L、H 3 BO 4 0.08mg/L、ZnCl 2 0.07mg/L、CuCl 2 0.01mg/L、MnCl 2 0.06mg/L、CoCl 2 0.07mg/L、NiCl 2 0.01mg/L、Na 2 SeO 3 0.02mg/L、Na 2 WO 4 ·2H 2 O 0.03mg/L、Na 2 MoO 4 0.02mg/L；
Adopting a fed-batch culture mode, wherein the components of a fed-batch liquid are the same as those of a carbon source and a nitrogen source in a basic culture medium, wherein the concentration of the carbon source is 60.3g/L, the concentration of the nitrogen source is 8.31g/L, after all fed-batch, the final concentration of the carbon source in the culture medium is 40.2g/L, and the concentration of the nitrogen source is 5.54g/L;
the culture temperature is as follows: 20-40 ℃;
pH＝5.5～8.0；
protective gas: n is a radical of hydrogen 2 :CO 2 20 (v/v) or N =80 2 :CO 2 :H 2 =80 (v/v/v), and the pressure is 182kPa.
3. A composition comprising akkermansia muciniphila ww001 according to claim 1, wherein the composition comprises one or more pharmaceutically acceptable excipients or carriers.
4. A complex microbial inoculum comprising the Akkermansia muciniphila ww001 as set forth in claim 1, wherein the complex microbial inoculum includes Akkermansia muciniphila (Akkermansia muciniphila), bifidobacterium animalis (Bifidobacterium animalis), lactobacillus rhamnosus (Lactobacillus rhamnosus) and Lactobacillus reuteri (Lactobacillus reuteri).
5. The complex bacterial agent of claim 4, wherein the complex bacterial agent comprises the following components of akkermansia muciniphila: bifidobacterium animalis: lactobacillus rhamnosus: the ratio of viable bacteria of lactobacillus reuteri is 3.
6. A composition containing the complex microbial inoculum of claim 4, wherein the composition comprises ellagitannin and dihydromyricetin, and the weight ratio of the ellagitannin to the dihydromyricetin is 3:1; the adding amount of the ellagitannin and the dihydromyricetin is 5 times of the mass of the composite microbial inoculum.
7. Use of the akkermansia muciniphila ww001 according to claim 1 for the preparation of a medicament for the treatment and/or prevention of liver damage.
8. The use of the complex microbial inoculum of claim 4 in the preparation of medicaments for treating and/or preventing liver injury.
9. Use of a composition according to claim 6 for the preparation of a medicament for the treatment and/or prevention of liver injury.
10. The use of any one of claims 7 to 9, wherein the liver injury is alcoholic liver injury.
CN202210720843.3A 2022-06-23 2022-06-23 Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof Pending CN115612635A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210720843.3A CN115612635A (en) 2022-06-23 2022-06-23 Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210720843.3A CN115612635A (en) 2022-06-23 2022-06-23 Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof

Publications (1)

Publication Number Publication Date
CN115612635A true CN115612635A (en) 2023-01-17

Family

ID=84857018

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210720843.3A Pending CN115612635A (en) 2022-06-23 2022-06-23 Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof

Country Status (1)

Country Link
CN (1) CN115612635A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110079474A (en) * 2019-04-12 2019-08-02 沈阳药科大学 A kind of method of the thermophilic mucin bacterium of High Density Cultivation Ai Keman
KR102128287B1 (en) * 2019-08-23 2020-06-30 주식회사 엔테로바이옴 NEW Akkermansia muciniphila EB-AMDK19 strain AND uses thereof
CN113116936A (en) * 2021-04-02 2021-07-16 上海市第六人民医院 Application of akkermansia muciniphila in preparation of beta-chenodeoxycholic acid inhibitor
CN113862193A (en) * 2021-10-28 2021-12-31 江西普瑞森基因科技有限公司 Ackermanella muciniphila and application thereof in preparation of antitumor drugs
CN114276960A (en) * 2015-09-10 2022-04-05 卢万天主教大学 Use of pasteurised akkermansia for the treatment of metabolic disorders

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114276960A (en) * 2015-09-10 2022-04-05 卢万天主教大学 Use of pasteurised akkermansia for the treatment of metabolic disorders
CN110079474A (en) * 2019-04-12 2019-08-02 沈阳药科大学 A kind of method of the thermophilic mucin bacterium of High Density Cultivation Ai Keman
KR102128287B1 (en) * 2019-08-23 2020-06-30 주식회사 엔테로바이옴 NEW Akkermansia muciniphila EB-AMDK19 strain AND uses thereof
CN113116936A (en) * 2021-04-02 2021-07-16 上海市第六人民医院 Application of akkermansia muciniphila in preparation of beta-chenodeoxycholic acid inhibitor
CN113862193A (en) * 2021-10-28 2021-12-31 江西普瑞森基因科技有限公司 Ackermanella muciniphila and application thereof in preparation of antitumor drugs

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHRISTOPH GRANDER等: "Recovery of ethanol-induced Akkermansia muciniphila depletion ameliorates alcoholic liver disease", GUT MICROBIOTA, vol. 67, no. 5, pages 891 - 900 *
JAYANT S LONDHE等: "Geraniin and amariin, ellagitannins from Phyllanthus amarus, protect liver cells against ethanol induced cytotoxicity", FITOTERAPIA, vol. 83, no. 8, pages 1562 - 1568 *
SEJEONG KIM等: "Akkermansia muciniphila Prevents Fatty Liver Disease, Decreases Serum Triglycerides, and Maintains Gut Homeostasis", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 86, no. 7, pages 03004 - 19 *
刘利敏等: "嗜黏蛋白阿克曼氏菌与肝损伤关系的研究进展", 临床肝胆病杂志, no. 09, pages 223 - 226 *
李杜等: "二氢杨梅素的肝病药理机制研究进展", 中西医结合肝病杂志, vol. 29, no. 2, pages 190 - 192 *

Similar Documents

Publication Publication Date Title
US10968495B2 (en) Lactobacillus reuteri and use thereof
CN110604749B (en) Bifidobacterium animalis A12 and its application in controlling diabetes or hyperlipidemia, especially weight gain or obesity
LeBlanc et al. B‐Group vitamin production by lactic acid bacteria–current knowledge and potential applications
US11260082B2 (en) Faecalibacterium prausnitzii and Desulfovibrio piger for use in the treatment or prevention of diabetes and bowel diseases
US10487305B2 (en) Food grade bacteria for the removal of toxic compounds
US20210254023A1 (en) Saccharomyces cerevisiae kwon p-1, 2, 3 which produce aldehyde dehydrogenase and glutathione
JP7219801B2 (en) Compositions and methods for preventing and/or treating vitamin B12 deficiency
CN111280252B (en) Bifidobacterium longum subspecies, compositions containing them and uses thereof
JP2019517992A (en) Christensenella intestinihominis and its use
CN116254190A (en) Lactobacillus paracasei subspecies and application thereof
CN109983115B (en) Lactobacillus gasseri and culture method and application thereof
Malik et al. Bacteria remediate the effects of food additives on intestinal function in an in vitro model of the gastrointestinal tract
CN115612635A (en) Excheriscus muciniphila ww001 and composition, composite microbial inoculum and application thereof
EP3511406A1 (en) Faecalibacterium longum and application thereof
CN117025452A (en) High-density culture method of bifidobacterium longum subspecies infantis B2-01
CN116656542A (en) Lactobacillus mucilaginosus with function of relieving alcoholic liver injury and application thereof
CN114774335B (en) Bifidobacterium longum 070103 with effects of targeting glucokinase and remarkably reducing blood sugar and blood fat and application thereof
Tsao et al. Clonal isolation of populations of γ-glutamyl transpeptidase-positive and-negative cells from rat liver epithelial cells chemically transformed in vitro
CN113122471B (en) Bifidobacterium pseudocatenulatum with high utilization of galactooligosaccharides and application thereof
CN115074276A (en) Clostridium pralatanorum capable of relieving non-alcoholic fatty liver and application thereof
EP3498819A1 (en) Faecalibacterium butyricigenerans and method for cultivation thereof and application thereof
WO2018107364A1 (en) Collinsella shenzhenensis and applications thereof
CN114990004B (en) Secretory immunoglobulin A-packaged lactobacillus reuteri and application thereof in preventing and treating gestational diabetes
CN116590181B (en) Lactobacillus paracasei for improving inflammatory reaction caused by microplastic pollution and application thereof
CN112236155A (en) Composition and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination