CN115611970A - Brazilian sweet mutant and application thereof - Google Patents

Brazilian sweet mutant and application thereof Download PDF

Info

Publication number
CN115611970A
CN115611970A CN202110798053.2A CN202110798053A CN115611970A CN 115611970 A CN115611970 A CN 115611970A CN 202110798053 A CN202110798053 A CN 202110798053A CN 115611970 A CN115611970 A CN 115611970A
Authority
CN
China
Prior art keywords
mutant
seq
sweet
amino acid
brazzein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110798053.2A
Other languages
Chinese (zh)
Inventor
康丽华
程斯达
李宾
张静静
郭瑞
葛菁华
刘维和
张干
单凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Vland Biotech Group Co Ltd
Original Assignee
Qingdao Vland Biotech Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Vland Biotech Group Co Ltd filed Critical Qingdao Vland Biotech Group Co Ltd
Priority to CN202110798053.2A priority Critical patent/CN115611970A/en
Publication of CN115611970A publication Critical patent/CN115611970A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C07K14/43—Sweetening agents, e.g. thaumatin, monellin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/30—Artificial sweetening agents
    • A23L27/31—Artificial sweetening agents containing amino acids, nucleotides, peptides or derivatives
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention relates to the technical field of genetic engineering and protein modification, and particularly relates to a Brazilian sweet mutant and application thereof. The applicant screens gene mutation sites for obviously improving the Brazzein sweetness through a protein engineering technology, and excessively expresses Brazzein in pichia pastoris. The mutant can be used as a sweetening agent and widely applied to the field of feed or food processing.

Description

Brazilian sweet mutant and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, and particularly relates to a brazilian sweet mutant and application thereof.
Background
Sweeteners are important additives indispensable in the field of food processing. The traditional sweetening agents such as sucrose, fructose, maltose and glucose have edible safety and nutritive value, but have the defects of low sweetness and high calorie, and are easy to cause diseases such as dental caries, obesity, cardiovascular and cerebrovascular diseases and the like after being taken for a long time. Because of these drawbacks, non-caloric artificial sweeteners were developed in succession, such as: aspartame, acesulfame potassium, saccharin, neotame. The sweeteners are widely used, but adverse reactions such as dizziness, headache and the like still exist, and the safety of metabolites of the sweeteners to the environment and the human health is difficult to detect. Therefore, a natural sweet substance is urgently needed to be found to meet the living needs of people.
The plant sweet protein is a natural product, and is concerned by people because of the advantages of high safety, high sweetness and low calorie. These properties of vegetable sweet protein make it an ideal substitute for the current artificial sweetener with low calorie and high sweetness. Eight plant sweet proteins were discovered in succession, which are among the best alternatives to both traditional and artificial sweeteners. Wherein Brazzein is a sweet protein extracted from West non-climax plants, has 500-2000 times of sweetness than sucrose, and has a sweet taste sensation more similar to that of sucrose than other sweet proteins. The product has good stability and heat resistance within the pH range of 2.5-8.0, is easily soluble in water, and is suitable for various food processing techniques. The sweet protein content in the plant is low, the extraction is difficult, and the large-scale production is difficult.
In order to solve the problems of low yield and difficult industrialization of plant sweet protein, in recent years, students at home and abroad use microbes to heterologously express sweet protein, and more reports are provided for increasing the yield of the sweet protein. Such as Escherichia coli, filamentous fungi, animal cells and the like, but all have the problem of insufficient yield for production, which is also a bottleneck that the sweet protein is difficult to industrialize.
Disclosure of Invention
In order to solve the problems in the prior art, the invention screens a gene mutation site capable of improving the Brazzein sweetness through a protein engineering technology, and excessively expresses Brazzein in pichia pastoris so as to meet the industrial requirement.
On one hand, the invention relates to brazzein, the amino acid sequence of which is SEQ ID NO. 1, and the coding nucleotide sequence of which is SEQ ID NO. 2.
One aspect of the present invention relates to a mutant of brazzein, which has the amino acid sequence of SEQ ID NO. 1, wherein the 14 th amino acid of brazzein is changed from Ser to Arg.
The amino acid sequence of the mutant is SEQ ID NO. 3, and the coding nucleotide sequence is SEQ ID NO. 4.
One aspect of the present invention relates to a mutant brazzein, which is a brazzein having the amino acid sequence of SEQ ID NO. 3, wherein the amino acid at position 22 of the brazzein is changed from Cys to Ala.
The amino acid sequence of the mutant is SEQ ID NO. 5, and the coding nucleotide sequence is SEQ ID NO. 6.
One aspect of the present invention relates to a brazzein mutant, wherein the 48 th amino acid of brazzein with the amino acid sequence of SEQ ID NO. 5 is changed from Ile to Tyr.
The amino acid sequence of the mutant is SEQ ID NO. 7, and the coding nucleotide sequence is SEQ ID NO. 8.
The invention also provides a recombinant expression plasmid carrying the coding nucleotide sequence of the mutant
The invention also relates to a host cell containing the recombinant expression plasmid.
In some embodiments of the invention, the host cell is pichia pastoris (a: (b))Pichia pastoris）。
The recombinant expression plasmid is transferred into a pichia host cell for recombinant expression, and the sweetness of the obtained brazilian sweet mutant is obviously improved.
The invention also relates to application of the brazilian sweet mutant in the field of feed or food processing.
After the batixiant mutants B1-2, B1-3 and B1-4 provided by the invention are expressed in pichia pastoris, the sweetness of the batixiant mutants is respectively improved by 133%, 233% and 300% compared with that of brazilian sweet B1 before mutation, and unexpected technical effects are achieved. The mutant can be widely applied to the fields of feed, food processing and the like as a sweetening agent, and has wide application prospect.
Detailed Description
The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.
Strain and carrier: coli DH 5. Alpha. Deposited from Invitrogen, pichia pastoris GS115, vector pPIC9k, amp, G418, zeocin were purchased from Invitrogen.
Enzyme and kit: DNA polymerase was purchased from Takara, T4 ligase and restriction enzyme were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech.
The formula of the culture medium is as follows:
coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH7.0;
LB + Amp medium: adding 100 mu g/mL ampicillin into LB culture medium;
yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
YPD + Zeocin medium: adding 100 mu g/ml Zeocin into YPD culture medium;
yeast screening medium (MD medium): 1.34% YNB, 4X 10 -5 Biotin, 1% glycerol, 2% agarose;
BMGY medium: 2% peptone, 1% yeast extractExtract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4X 10 -5 % biotin, 1% glycerol;
BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4X 10 -5 % biotin, 0.5% methanol.
The invention is further illustrated by the following examples.
Example 1 Gene Synthesis of Brazilian sweet B1
Looking up the gene sequence in GenBank, a brazzein gene is found in Pentadiplandra brazzeana, named B1, and GenBank number is P56552.1. The amino acid sequence of the brazzein is SEQ ID NO. 1, and the coding nucleotide sequence is SEQ ID NO. 2. The Huada Gene Co Ltd for the synthesis of the whole gene; the total length of the B1 gene is 165bp.
Example 2 screening of Brazilian sweet B1 mutants
In order to further improve the sweet activity of the brazilian sweet B1, a great deal of mutation screening is carried out on the gene by the directed evolution technology; performing PCR amplification by using a primer 1 (F) and a primer 1 (R) and a GeneMorph II random mutation PCR kit (Stratagene) by using the B1 gene as a template;
primer 1 (F): GCGCGAATTCCAAGATAAATGTAAGAAGGTGTACG；
Primer 1 (R): TAAAGCGGCCGCTCAATATTCACAATAATCACA。
The PCR product is recovered by glue and,EcoRI、Noti, performing enzyme digestion treatment, connecting the enzyme digested product with a pET21a vector, transforming the enzyme digested product into escherichia coli BL21 (DE 3), coating the escherichia coli BL21 (DE 3) in an LB + Amp plate, and performing inverted culture at 37 ℃; after the transformants appear, the transformants are picked to a 96-well plate one by using toothpicks, 150 ul LB + Amp culture medium containing 0.1mM IPTG is added into each well, the culture is carried out for about 6 h at 37 ℃ and 220rpm, the supernatant is discarded by centrifugation, the thalli are resuspended by using buffer solution, and the walls are broken by repeated freeze thawing, so as to obtain the Brazilian sweet escherichia coli cell lysate. Then, the cells were centrifuged to remove the cells, and the supernatant was subjected to measurement of the sweetness activity of brazzein.
The experimental results show that some mutations have no influence on the sweetness activity of brazilian sweet B1, and some mutations even make the sweetness activity of brazilian sweet B lower. Finally, applicants screened mutant sites and combinations thereof with significantly improved sweet taste activity: single point mutation of S14R, two point mutation of S14R/C22A and three point mutation of S14R/C22A/I48Y.
The Brazilian sweet mutant containing the single point mutation S14R is named as B1-2, the amino acid sequence of the mutant is SEQ ID NO. 3, and the coding nucleotide sequence of the mutant is SEQ ID NO. 4.
The Brazilian sweet mutant containing two point mutations of S14R/C22A is named as B1-3, the amino acid sequence of the mutant is SEQ ID NO. 5, and the coding nucleotide sequence of the mutant is SEQ ID NO. 6.
The Brazilian sweet mutant containing S14R/C22A/I48Y three-point mutation is named as B1-4, the amino acid sequence of the Brazilian sweet mutant is SEQ ID NO. 7, and the coding nucleotide sequence of the Brazilian sweet mutant is SEQ ID NO. 8.
The genes of the above mutants were synthesized by Huada Gene Co.
The three mutants were subjected to PCR amplification using primer 1 (F) and primer 1 (R) under the following conditions: denaturation at 94 deg.C for 5min; then, the mixture is denatured at 94 ℃ for 30s, renatured at 56 ℃ for 30s, extended at 72 ℃ for 1min, and after 35 cycles, the mixture is kept at 72 ℃ for 10min. The results show that the length of three genes of the mutant B1-2, B1-3 and B1-4 is the same as that of the B1 gene, and the total length is 165bp.
Example 3 construction of Pichia engineering bacteria recombinantly expressing Brazilian sweet
1. Construction of recombinant plasmid
The cloned brazilian sweet gene B1 and three mutant genes (B1-2, B1-3 and B1-4) are respectively treated with restriction enzymesEcoR is andNoti, carrying out double digestion, wherein 100 mu l of digestion system is as follows: 40. Mu.l of PCR product of Brazilian sweet gene B1 (B1-2, B1-3, B1-4), 10. Mu.l of 10 XH buffer, 10. Mu.l of 10 XBSA,EcoR I 5 μl、Not I 5 μl、ddH 2 O30. Mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis.
The expression vector pPIC9K is firstly applied with restriction enzymeEcoR I is subjected to single enzyme digestion, and a 100-microliter digestion system is as follows: 20. Mu.l of expression vector pPIC9K, 10 XH buffer 10. Mu.l,EcoR I 5 μl、ddH 2 O65. Mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis. Reuse of the recovered fragments with restriction enzymesNotI carrying out the monooxygenaseThe cleavage, 100. Mu.l of the cleavage system, was as follows: pPIC9K fragments 20. Mu.l, 10 XH buffer 10. Mu.l, 10 XBSA 10. Mu.l, 10 XTUTON 10. Mu.l,Not I 5 μl、ddH 2 O45. Mu.l. After digestion at 37 ℃ for 4 h, the product was recovered by agarose gel electrophoresis.
Will be passedEcoR I andNotthe B1 fragment, the B1-2 fragment, the B1-3 fragment and the B1-4 fragment which are subjected to double enzyme digestion are respectively connected with an expression vector pPIC9K subjected to the same enzyme digestion to construct recombinant expression plasmids pPIC9K-B1, pPIC9K-B1-2, pPIC9K-B1-3 and pPIC9K-B1-4. The linking system is as follows: expression vector pPIC9K double enzyme digestion product 5 mul, B1 (B1-2, B1-3, B1-4) gene double enzyme digestion product 3 mul, 10 XT 4 ligase buffer 1 μl、T 4 1 μ l of ligase. 22. The ligation was carried out overnight, transformed into E.coli DH 5. Alpha. And transformants were picked for sequencing. And (3) transferring the transformant which is verified to be correct by sequencing into an LB + Amp liquid culture medium, carrying out overnight culture at 37 ℃, and obtaining the quality-improved grains, namely the recombinant yeast expression plasmid pPIC9K-B1 (pPIC 9K-B1-2, pPIC9K-B1-3 and pPIC 9K-B1-4).
2. Transformation and selection
The recombinant yeast expression plasmids pPIC9K-B1, pPIC9K-B1-2, pPIC9K-B1-3 and pPIC9K-B1-4 are respectively usedSalI, linearization, purifying a linearization product by using a column purification kit, converting pichia pastoris GS115 by an electroporation method, and coating an MD plate. The colony grown on the MD plate is the pichia pastoris engineering strain, and then YPD plates containing different concentrations of geneticin G418 are coated to screen multi-copy transformants.
3. Shake flask fermentation validation
Single multi-copy transformants were picked and inoculated into BMGY medium, respectively, after shaking culture at 30 ℃ and 220rpm for 24 hours, transferred into BMMY medium, and shaking culture at 30 ℃ and 220rpm with 0.5% methanol added every 24 hours. After the induction expression for 4d, the thalli are removed by centrifugation, and the supernatant is subjected to the activity determination of the sweet protein.
The result shows that the sweetness of the brazilian sweet B1 in the transformant under the shake flask level is up to 300 times of that of the standard cane sugar, the protein content is 1.50g/l, and the transformant is numbered as B1-33;
the sweetness of the bacitracin B1-2 is up to 700 times that of the standard cane sugar, the protein content is 1.63g/l, and the transformant is numbered as B1-2-78;
the sweetness of the bacitracin B1-3 is up to 1000 times of that of standard cane sugar, the protein content is 1.43g/l, and the transformant is numbered as B1-3-46;
the sweetness of the balantime B1-4 is up to 1200 times of that of the standard cane sugar, the protein content is 1.49g/l, and the transformant is numbered as B1-4-24.
The results show that after the patatin mutants B1-2, B1-3 and B1-4 provided by the invention are expressed in pichia pastoris, the sweetness is respectively improved by 133%, 233% and 300% compared with that of brazilian sweet B1 before mutation, and unexpected technical effects are achieved.
1. Sweet taste detection method of sweet protein
The sweet taste of the sweet protein is identified by blind test. The blind test experiment control group adopts 10% of sucrose aqueous solution, samples to be detected of the sweet protein are prepared into different concentration gradients and then are numbered randomly, 10 persons form an evaluation group to taste the samples, and samples with the same or similar sweetness to the 10% of sucrose aqueous solution in the samples with different concentration gradients are judged, so that the sweetness of the samples is calculated.
The formula is as follows: relative sweetness factor of sucrose =10 × dilution factor
Preparation of different concentration gradient samples of sweet protein: firstly weighing 1.0g of sweet protein sample, adding distilled water to dilute to 100ml, and obtaining 1.0% sample solution; then, 1.0% sample solution is measured and further diluted with distilled water into the solution to be measured with different dilution times, such as 2 times, 4 times, 6 times, 8 times, 10 times, 20 times, 50 times, 100 times, 200 times, 300 times and the like.
2. Coomassie brilliant blue method for detecting protein content
1. Reagent
(1) Coomassie brilliant blue G-250 staining solution: dissolving Coomassie brilliant blue G-250 100mg in 50ml 95% ethanol, adding 100ml 85% phosphoric acid, diluting with water to 1L, and using at normal temperature for 1 month;
(2) Standard protein solution: measuring the protein content by using bovine serum albumin through a trace Kjeldahl method in advance, and preparing a 1 mg/ml protein standard solution according to the purity of the protein;
(3) Preparation of standard stock solution: accurately weighing 0.05g of crystallized bovine serum albumin on an analytical balance, adding a small amount of distilled water into a small beaker, dissolving, transferring into a 50ml volumetric flask, washing residual liquid in the beaker with a small amount of distilled water for several times, pouring the washing liquid into the volumetric flask together, and finally fixing the volume to the scale with the distilled water. A standard stock solution was prepared, in which the concentration of bovine serum albumin was 1000. Mu.g/ml.
2. And (5) drawing a standard curve.
(1) The 6 test tubes are respectively numbered, the reagents are added according to the following table, and the mixture is uniformly mixed.
Pipe number 1 2 3 4 5 6
Sample (ml) 0 0.1 0.2 0.3 0.4 0.5
Water (ml) 2.0 1.9 1.8 1.7 1.6 1.5
Protein content (mg/ml) 0 0.05 0.1 0.15 0.2 0.25
Accurately sucking 2.5ml of Coomassie brilliant blue solution into 6 dry test tubes, accurately sucking 0.1ml of the solution from each tube, placing the test tubes in respective numbers, mixing uniformly by vortex, standing at room temperature for 5min, zeroing with test tube No. 1, measuring at 595nm, comparing color, and recording light absorption value.
(2) Drawing a standard curve: the absorbance values read by the 1-6 tubes were recorded, and a standard curve was drawn with the protein content (μ g) as the abscissa and the absorbance as the ordinate. Note that the cuvette had to be cleaned due to the strong staining ability of coomassie brilliant blue. Cannot be measured with a quartz cup.
3. Determination of samples
Preparation of samples:
(1) Liquid sample: diluting a sample to be detected to the protein content of 0.1-0.3mg/ml, and controlling the light absorption value (after blank is subtracted) after blank is removed to be 0.2-0.4;
(2) Solid sample: accurately weighing 1.0000g of sample into a 100ml triangular flask, adding 20ml of deionized water by using a pipette, magnetically stirring for 10min, centrifuging at 4000rpm for 10min, taking the supernatant, and further diluting to determine the protein content, wherein the diluting method refers to liquid samples.
Sample detection:
adding a clean test tube into a Coomassie brilliant blue solution containing 2.5ml, adding a sample to be tested, vortexing, shaking uniformly, standing at room temperature for 5min, taking a blank of a standard curve as a control, measuring absorbance at 595nm by using a micro cuvette with an optical path of 1cm, and obtaining the protein content according to the standard curve.
4. Protein content calculation
Protein content = X dilution fold × standard conversion factor.
X: protein content (mg/ml) determined from standard;
reduced value of standard sample: the standard sample was 47mg/ml, and a coefficient was converted from the measured value.
The brazilian sweet mutant provided by the invention can be widely applied to the fields of feed, food processing and the like as a sweetening agent, and has a wide application prospect.
Sequence listing
<110> Islands blue biological group Co Ltd
<120> Brazilian sweet mutant and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 54
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Gln Asp Lys Cys Lys Lys Val Tyr Glu Asn Tyr Pro Val Ser Lys Cys
1 5 10 15
Gln Leu Ala Asn Gln Cys Asn Tyr Asp Cys Lys Leu Asp Lys His Ala
20 25 30
Arg Ser Gly Glu Cys Phe Tyr Asp Glu Lys Arg Asn Leu Gln Cys Ile
35 40 45
Cys Asp Tyr Cys Glu Tyr
50
<210> 2
<211> 165
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caagataaat gtaagaaggt gtacgagaat taccctgttt caaagtgcca gcttgcaaac 60
caatgtaact atgattgtaa acttgataaa catgcaagat caggagaatg tttctacgac 120
gagaagcgga atcttcaatg tatctgtgat tattgtgaat attga 165
<210> 3
<211> 54
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Gln Asp Lys Cys Lys Lys Val Tyr Glu Asn Tyr Pro Val Arg Lys Cys
1 5 10 15
Gln Leu Ala Asn Gln Cys Asn Tyr Asp Cys Lys Leu Asp Lys His Ala
20 25 30
Arg Ser Gly Glu Cys Phe Tyr Asp Glu Lys Arg Asn Leu Gln Cys Ile
35 40 45
Cys Asp Tyr Cys Glu Tyr
50
<210> 4
<211> 165
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
caagataaat gtaagaaggt gtacgagaat taccctgtta gaaagtgcca gcttgcaaac 60
caatgtaact atgattgtaa acttgataaa catgcaagat caggagaatg tttctacgac 120
gagaagcgga atcttcaatg tatctgtgat tattgtgaat attga 165
<210> 5
<211> 54
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Gln Asp Lys Cys Lys Lys Val Tyr Glu Asn Tyr Pro Val Arg Lys Cys
1 5 10 15
Gln Leu Ala Asn Gln Ala Asn Tyr Asp Cys Lys Leu Asp Lys His Ala
20 25 30
Arg Ser Gly Glu Cys Phe Tyr Asp Glu Lys Arg Asn Leu Gln Cys Ile
35 40 45
Cys Asp Tyr Cys Glu Tyr
50
<210> 6
<211> 165
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
caagataaat gtaagaaggt gtacgagaat taccctgtta gaaagtgcca gcttgcaaac 60
caagctaact atgattgtaa acttgataaa catgcaagat caggagaatg tttctacgac 120
gagaagcgga atcttcaatg tatctgtgat tattgtgaat attga 165
<210> 7
<211> 54
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Gln Asp Lys Cys Lys Lys Val Tyr Glu Asn Tyr Pro Val Arg Lys Cys
1 5 10 15
Gln Leu Ala Asn Gln Ala Asn Tyr Asp Cys Lys Leu Asp Lys His Ala
20 25 30
Arg Ser Gly Glu Cys Phe Tyr Asp Glu Lys Arg Asn Leu Gln Cys Tyr
35 40 45
Cys Asp Tyr Cys Glu Tyr
50
<210> 8
<211> 165
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
caagataaat gtaagaaggt gtacgagaat taccctgtta gaaagtgcca gcttgcaaac 60
caagctaact atgattgtaa acttgataaa catgcaagat caggagaatg tttctacgac 120
gagaagcgga atcttcaatg ttattgtgat tattgtgaat attga 165

Claims (10)

1. The brazilian sweet is characterized in that the amino acid sequence of the brazilian sweet is SEQ ID NO. 1, and the coding nucleotide sequence is SEQ ID NO. 2.
2. A brazzein mutant characterized in that the 14 th amino acid of brazzein having the amino acid sequence of SEQ ID NO. 1 is changed from Ser to Arg.
3. The mutant of claim 2, wherein the amino acid sequence of the mutant is SEQ ID No. 3 and the coding nucleotide sequence is SEQ ID No. 4.
4. A mutant of brazzein, which is characterized in that the 22 nd amino acid of brazzein having the amino acid sequence of SEQ ID NO. 3 is changed from Cys to Ala.
5. The mutant of claim 4, wherein the amino acid sequence of the mutant is SEQ ID NO 5 and the coding nucleotide sequence is SEQ ID NO 6.
6. A brazzein mutant characterized in that the 48 th amino acid of brazzein having the amino acid sequence of SEQ ID NO. 5 is changed from Ile to Tyr.
7. The mutant of claim 6, wherein the amino acid sequence of the mutant is SEQ ID NO. 7 and the coding nucleotide sequence is SEQ ID NO. 8.
8. A recombinant expression plasmid carrying a nucleotide sequence encoding a mutant according to any one of claims 2 to 7.
9. A host cell comprising the recombinant expression plasmid of claim 8.
10. Use of the mutant brazzein according to any of claims 2 to 7 in the field of feed or food processing.
CN202110798053.2A 2021-07-15 2021-07-15 Brazilian sweet mutant and application thereof Pending CN115611970A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110798053.2A CN115611970A (en) 2021-07-15 2021-07-15 Brazilian sweet mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110798053.2A CN115611970A (en) 2021-07-15 2021-07-15 Brazilian sweet mutant and application thereof

Publications (1)

Publication Number Publication Date
CN115611970A true CN115611970A (en) 2023-01-17

Family

ID=84854595

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110798053.2A Pending CN115611970A (en) 2021-07-15 2021-07-15 Brazilian sweet mutant and application thereof

Country Status (1)

Country Link
CN (1) CN115611970A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102690340A (en) * 2012-03-30 2012-09-26 广州医学院第二附属医院 Recombined Brazil nut allergen and mutant and preparation method and applications thereof
CN112011494A (en) * 2020-07-03 2020-12-01 江南大学 Recombinant escherichia coli and application thereof in synthesis of aspartame through whole-cell transformation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102690340A (en) * 2012-03-30 2012-09-26 广州医学院第二附属医院 Recombined Brazil nut allergen and mutant and preparation method and applications thereof
CN112011494A (en) * 2020-07-03 2020-12-01 江南大学 Recombinant escherichia coli and application thereof in synthesis of aspartame through whole-cell transformation

Similar Documents

Publication Publication Date Title
JPH05501356A (en) Identification of methionine N-alpha-acetyltransferase
LOPES et al. Fermentation properties of a wine yeast over‐expressing the Saccharomyces cerevisiae glycerol 3‐phosphate dehydrogenase gene (GPD2)
CN110295159A (en) A kind of enzyme mutant
CN105316310B (en) A kind of alkaline pectin enzyme mutant of specific enzyme activity and thermal stability raising
CN104232611B (en) A kind of recombination muscardine Proteinase K and its industrialized production and purification process
CN115611970A (en) Brazilian sweet mutant and application thereof
CN109706130A (en) Fructoamino-acid-oxidase mutant, detection kit and detection method
CN112760300B (en) Aflatoxin degrading enzyme mutant and production strain thereof
CN115611969A (en) Thaumatin mutant and application thereof
CN115247158B (en) Glycerol phosphate oxidase mutant and screening method, preparation method and application thereof
CN112175980A (en) Method for improving activity of polymerase large fragment by site-directed mutagenesis and application
CN116333080A (en) Novel sweet protein mutant and application thereof
CN106636049B (en) A kind of alkaline pectin enzyme mutant that secernment property improves
CN108642024B (en) CK-MB expression and purification method
CN110885801B (en) Glucose oxidase M5GOD and coding gene and application thereof
Chen et al. Functional expression, purification, and characterization of the extra stable human placental alkaline phosphatase in the Pichia pastoris system
CN113736762A (en) alpha-L-rhamnosidase mutant and application thereof in preparation of praonine
CN109006917B (en) Application of wheat catalase in improving flour processing quality
CN115975990B (en) High specific activity medium temperature amylase mutant
AU2019329357A1 (en) Mutant strain of trichoderma reesei and method for producing protein using same
CN111235122B (en) 3 alpha hydroxysteroid dehydrogenase mutant and application thereof in total bile acid detection
KR102073338B1 (en) Method for expression and purification of human sweet taste receptor
CN114891079B (en) French phoenix tree pollen allergen and application thereof
CN114807193B (en) Carbonic anhydrase gene and application thereof
CN112779238B (en) DNA polymerase mixture for hepatitis C virus detection

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination