CN115552007A

CN115552007A - Multiplex CRISPR/CAS systems for modifying the genome of a cell

Info

Publication number: CN115552007A
Application number: CN202180038118.1A
Authority: CN
Inventors: E·范德尔赫尔姆; V·马丁内斯; A·塔科斯
Original assignee: Snip Bio Formation Co ltd
Current assignee: Snip Bio Formation Co ltd
Priority date: 2020-05-27
Filing date: 2021-05-26
Publication date: 2022-12-30
Also published as: JP2023527819A; GB202007943D0; CA3171200A1; EP4158021A1; FR3110916A1; WO2021239758A1

Abstract

The present invention relates to methods of modifying a cellular genome using multiple CRISPR/Cas systems in concert. The invention also relates to compositions, crrnas, cas proteins, and vectors for performing such methods.

Description

Multiplex CRISPR/CAS systems for modifying the genome of a cell

Technical Field

The present invention relates to methods of modifying a genome of a cell using a plurality of CRISPR/Cas systems. The invention also relates to compositions, crrnas, cas and vectors for performing such methods as disclosed herein.

Background

The prior art describes vectors employing CRISPR/Cas systems and the use of these vectors. For example, reference is made to WO2020078893, WO2019185551, WO2019105821, WO2017118598, US20180140698, US20170246221, US20180273940, US20160115488, US20180179547, US20170175142, US20160024510, US 2016020150064138, US 20170022422499, US20160345578, US 20180155755729, US20180200342, WO 2017112612620, WO2018081502, PCT/EP2018/066954, PCT/EP 2012012018/06698, PCT/EP 2012012012012010718/071454, EP3356533, EP 22533022572, WO2020072253, WO2020072254, WO 2020072252250, WO 2022242248, WO2019236566, WO 2019144020, WO 20171126066119, EP 041610664, WO 2019222580, WO 20133533, EP 336233533, WO 2016233625648, WO 20162922015571, WO 20133922015, WO 20162623, WO 20192201538, WO 201922015, WO 201569, WO 0322016 and WO 4939 and WO 0322016 and WO 3 equivalent U.S.S. Pat. publication (WO 3,4933,033), the disclosure of which is incorporated herein by reference.

Summary of The Invention

The present invention provides the following configurations.

In a first configuration of the above-described type,

a method of modifying the genome of a cell, the method comprising

(a) Modifying a first protospacer of the genome using a first CRISPR/Cas system; and

(b) Modifying a second protospacer of the genome using a second CRISPR/Cas system, wherein the second protospacer is different from the first protospacer;

wherein the system comprises different Cas and is provided simultaneously in the cell.

In a second configuration of the process, the first configuration,

a method of modifying the genome of one or more cells, the method comprising introducing into each cell:

(a) A first and a second crRNA;

(b) A nucleic acid encoding a first and a second crRNA, wherein the nucleic acid is expressed in the cell for production of the crRNA;

(c) A first nucleic acid encoding a first crRNA and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressed in the cell for production of the crRNA; or

(d) A first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressed in the cell for production of the second crRNA;

wherein for each cell

(e) The first crRNA (crRNA 1) is capable of directing a first Cas (C1) to a protospacer sequence (PS 1) comprised by the genome of the cell to modify PS1; and

(f) The second crRNA (crRNA 2) is capable of directing a second Cas (C2) to a protospacer sequence (PS 2) comprised by the genome of the cell to modify PS2;

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is provided with

(i) Providing crRNA1, crRNA2, C1 and C2 in the cell, whereby the genome of the cell is subjected to Cas modification.

In one aspect, the invention uses the method to kill target cells. In another aspect, the invention uses the method to edit the genome of a cell.

In a third configuration of the above-described arrangement,

a composition for use in a method of treatment or prevention of a disease or condition mediated by a target cell in a human or animal subject, the composition comprising component (a), (b) or (d): -

(a) A first and a second crRNA;

(b) A nucleic acid encoding the first and second crrnas, wherein the nucleic acid is expressible in a target cell for producing the crRNA;

(c) A first nucleic acid encoding a first crRNA and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressible in a target cell for producing the crRNA; or

(d) A first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressible in a target cell for producing the second crRNA;

wherein

(e) The first crRNA (crRNA 1) is capable of directing a first Cas (C1) to a protospacer sequence (PS 1) comprised by the target cell genome to modify PS1; and

(f) The second crRNA (crRNA 2) is capable of directing a second Cas (C2) to a protospacer sequence (PS 2) comprised by the target cell genome to modify PS2;

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is provided with

Wherein the method comprises administering the composition to the subject, whereby the components of the composition are introduced into target cells, wherein crRNA1, crRNA2, C1, and C2 are provided in each cell, and the genome of each cell undergoes Cas modification and the disease or condition is treated or prevented.

In a fourth configuration of the device according to the invention,

a composition comprising components (a), (b) or (d): -

(a) First and second crrnas;

(b) A nucleic acid encoding the first and second crrnas, wherein the nucleic acid is expressible in a target cell for production of the crRNA;

(c) A first nucleic acid encoding a first crRNA and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressible in a target cell for producing the crrnas; or

wherein

(e) The first crRNA (crRNA 1) is capable of directing a first Cas (C1) to a protospacer sequence (PS 1) comprised by the genome of the target cell to modify PS1; and

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is

Wherein when the components of the composition are introduced into a target cell, thereby providing crRNA1, crRNA2, C1, and C2 in the cell, the genome of the cell undergoes Cas modification.

Aspects provide: -

Method of the invention for

(a) Generating a coordinated Cas nuclease cleavage of the cell genome;

(b) Reducing the population of cells of the first species or strain by at least 100,000, 1,000,000, or 10,000,000 fold;

(c) Killing at least 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or 99.99999% of cells of a first species or strain comprised by the microbiome;

(d) Generating a synergistic class 1 Cas modification of the genome of the cell; or

(e) Reducing bacterial cells (e.g., e.coli cells) of a first species or strain in a population of cells by at least 105, 106, or 107-fold, wherein the population comprises at least 100,000, respectively; 1,000,000; or 10,000,000 cells.

Aspects also provide pharmaceutical compositions, methods of making such compositions, and medical methods of using such compositions.

Brief Description of Drawings

FIG. 1 type I CRISPR-Cas systems of Escherichia coli and Clostridium difficile targeting Escherichia coli MG1655. Layout of CRISPR-Guided Vector ™ cells, CGV cells. (A) Escherichia coli CRISPR-Cas CGV ColE1 ori,cas3And Cascade, CRISPR arrays of E.coli. (B) Clostridium difficile CRISPR Cas CGV. Plasmid 1: pSC101 ori, of Clostridium difficilecas3And Cascade. Plasmid 2: pCloDF13 ori, CRISPR array of clostridium difficile.

FIG. 2 killing of E.coli MG1655 with the IE type CRISPR-Cas system of E.coli and the I-B type CRISPR-Cas system of Clostridium difficile. Coli MG1655 carrying clostridium difficile Cas gene was transformed with homologous CRISPR array and escherichia coli CRISPR-Cas CGV. The two CRISPR systems together surprisingly kill synergistically 7 logs compared to the empty vector ₁₀ Escherichia coli MG1655. In addition, singleness with CGV was testedAnd (4) transforming. The E.coli CRISPR-Cas system results in about 4-log ₁₀ Reduction; clostridium difficile CRISPR-Cas System results in about 3-log ₁₀ (n=3)。

Detailed description of the invention

The present invention relates to methods of modifying a genome of a cell using a plurality of CRISPR/Cas systems. The invention also relates to compositions, crrnas, cas and vectors for carrying out such methods as disclosed herein.

The present invention may be used to provide one or more of the following advantages:

(a) Generating a coordinated Cas nuclease cleavage of the cell genome;

(e) Reducing bacterial cells of a first species or strain in a cell population by at least 10 ⁵ 、10 ⁶ Or 10 ⁷ A multiple, wherein the populations each comprise at least 100,000;1,000,000; or 10,000,000 cells.

Advantageously, by reducing the number of target cells in a population of cells, this may be beneficial in situations where the cells are not desired (e.g., detrimental to the health of a subject to which the method is applied, or detrimental to the ex vivo environment or in vitro cell sample to which the method is applied or administered the composition). For example, the cells are patient-comprised cancer cells, and the multiple Cas cleavage of the present invention synergistically kills very high numbers (e.g., at least 99.999% or 10) ⁵ Fold) of cells. By reducing the cells in this manner, the number of seed cells to regrow cancer is reduced. In another example, the cells may be bacterial or archaeal cells, and by reducing the cells in this manner, the number of seed cells that regrow an undesirable cell population will be reduced.

In one aspect, the invention provides, in one configuration: -

A method of modifying the genome of a cell, the method comprising

wherein the systems comprise different Cas and are provided simultaneously.

Another aspect of the configuration provides: -

(a) A first and a second crRNA;

(b) A nucleic acid encoding a first and a second crRNA, wherein the nucleic acid is expressed in the cell for the production of crRNA;

(d) A first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressed in the cell for producing the second crRNA;

wherein for each cell

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is

Optionally, C1 and/or C2 is a Cas nuclease, e.g., C1 and C2 are each Cas3. Optionally, C1 and/or C2 is a Cascade Cas, e.g., casA, casB, casC, casD, or CasE. Optionally, C1 is Cas3, e.g., one, more or all of CasA, B, C, D and E, running in a cell with a Cascade Cas.

Optionally, the crRNA of component (a) is introduced simultaneously or sequentially. Optionally, the nucleic acid of component (c) and the crRNA are introduced simultaneously or sequentially. Optionally, the nucleic acids of component (d) are introduced simultaneously or sequentially. However, the method involves the simultaneous presence of crRNA1, crRNA2, cl and C2 in each cell, thereby modifying the genome using multiple CRISPR/Cas systems. crRNA1, crRNA2, C1 and C2 are provided in the cell, whereby PS1 and PS2 are subjected to Cas nuclease modification, wherein the genome of the cell is modified.

Preferably, the first and second protospacers are different or comprised by different genes or intergenic sequences of the genome.

The modification of the genome may be cleavage of nucleic acid of the genome, inhibition of transcription or translation of a gene comprised by the genome, upregulation of transcription or translation of a gene comprised by the genome, or editing of the genome (e.g., to insert and/or delete one or more nucleic acid sequences). The present invention can be advantageously used to cut, modify or edit the genome of each cell synergistically or efficiently. In one example, DNA comprised by the genome is cleaved, modified or edited and/or RNA comprised by the genome is cleaved, modified or edited. In one example, DNA comprised by the genome is degraded (e.g., during a process comprising Cas exo-or endonuclease activity) and/or RNA comprised by the genome is cleaved, modified, or edited (e.g., during a process comprising Cas exo-or endonuclease activity).

In one example, the component is comprised by a nucleic acid vector. In one example, components (a), (b), (c) or (d) are introduced into each cell by transfection, electroporation, transduction or conjugative transfer. For example, the vector is a virus or phage, and the components are introduced by transduction. For example, the vector is a plasmid and the components are introduced by conjugation, transfection or electroporation. For example, the vector is a phagemid (optionally a phagemid comprised by a virus or a bacteriophage) and the components are introduced by conjugation, transduction, transfection or electroporation. For example, the nucleic acid of the component is introduced by electroporation thereof. For example, the bacteriophage herein is a tailed bacteriophage. For example, the bacteriophage herein is a lytic bacteriophage. For example, the bacteriophage herein is a non-lytic bacteriophage.

Optionally, the method is a recombinant engineering method performed in vitro, and for example, the cell is an escherichia coli cell.

Optionally, each of the crrnas is encoded by a CRISPR array comprising first and second repeat sequences and a spacer sequence linking the repeat sequences. Optionally, the nucleic acid of (b) comprises a CRISPR array encoding crRNA1 and crRNA 2. Optionally, the first nucleic acid of (c) comprises a first CRISPR array encoding crRNA1 and the second nucleic acid comprises a second CRISPR array encoding crRNA 2. Optionally, the nucleic acid of (b) comprises a CRISPR array encoding crRNA 2.

In one example, each repeat sequence is gagttccccgcgccagcgggataaaccg or gttttatataactaaggtggtatgtaaat. In one example, each protospacer or spacer sequence consists of 15 to 70, 20 to 50, 17 to 45, 18 to 40, 18 to 35, or 20 to 40 contiguous nucleotides.

Optionally, cas1 and/or Cas2 are not introduced into each cell. Optionally, each nucleic acid does not contain a nucleic acid sequence encoding Cas1 and/or Cas 2. Optionally, further Cas4 is not introduced into each cell, or each nucleic acid does not contain a nucleic acid sequence encoding Cas4. Optionally, the introducing comprises (I) introducing into each cell an operon comprising nucleotide sequences encoding a type I Cas3 (wherein Cas3 is C1) and a Cascade protein under the control of a common constitutive promoter and/or (ii) introducing into each cell an operon comprising nucleotide sequences encoding a type I Cas3 (wherein Cas3 is C2) and a Cascade protein under the control of a common constitutive promoter. In one example, C1 is an IB-type Cas3 and/or C2 is an IE-type Cas3. Examples of suitable operators are disclosed in WO2020078893 or US20200115716, the disclosures of which are expressly incorporated herein by reference for possible uses in the present invention. The term "operon" is known to the skilled person, such as relates to a functional unit of DNA comprising at least 2 expressible nucleotide sequences encoding expression products (e.g. respective translatable mrnas), respectively, wherein said sequences are under the control of a common promoter.

In one example, C1 is a Cas disclosed in WO2019002218 and optionally the first crRNA is encoded by a CRISPR array comprising homologous repeats, such as the homologous repeats disclosed in W02019002218 when C1 is a Cas disclosed in WO2019002218 (e.g. Cas 3). Additionally or alternatively, in one example, C2 is a Cas disclosed in WO2019002218 and optionally the first crRNA is encoded by a CRISPR array comprising a homologous repeat, e.g. when C2 is a Cas disclosed in WO2019002218 (e.g. Cas 3), said repeat is a homologous repeat disclosed in WO 2019002218. In one example, the first crRNA is encoded by an array comprising a repeat sequence disclosed in WO2019002218 and/or the second crRNA is encoded by an array comprising a repeat sequence disclosed in WO 2019002218. For example, one or more nucleotide sequences encoding one or more Cascade Cas (e.g., which is homologous to C1 or C2) are introduced into the cell, wherein the Cascade Cas is the Cascade Cas disclosed in WO 2019002218. All of these disclosures in WO2019002218 are expressly incorporated herein by reference for possible uses in the present invention.

Optionally, the step of (a) is carried out,

(a) C1 is a class 1 Cas and C2 is a class 1 Cas;

(b) C1 is a class 1 Cas and C2 is a class 2 Cas;

(c) C1 is a class 2 Cas and C2 is a class 2 Cas;

(d) C1 is a type I Cas (optionally type I-a, B, C, D, E, F or U) and C2 is a type I Cas (optionally type I-a, B, C, D, E, F or U);

(e) C1 is a type I (optionally type I-a, B, C, D, E, F or U) or type II Cas, and C2 is a type II Cas;

(f) C1 is a type I (optionally type I-A, B, C, D, E, F, or U) or type II Cas, and C2 is a type III Cas (optionally type I-A or B);

(g) C1 is a type I (optionally type I-a, B, C, D, E, F or U) or type II Cas, and C2 is a type IV Cas;

(h) C1 is a type I (optionally type I-a, B, C, D, E, F or U) or type II Cas, and C2 is a type V Cas; or

(i) C1 is a type I or II Cas, and C2 is a type VI Cas.

Optionally, C1 and C2 are different class 1 Cas selected from the Cas disclosed in table 2. Optionally, C1 is an e.coli Cas (e.g., cas 3) and C2 is a Cas selected from the Cas disclosed in table 2. Optionally, C1 is a clostridium difficile (C difficile) Cas (e.g., cas 3) and C2 is a Cas selected from the Cas disclosed in table 2.

Optionally, C1 is a Cas type I-A, B, C, D, E, F, or U. Optionally, C2 is a type I-a, B, C, D, E, F or U Cas.

Optionally, C1 is a type I-A Cas and C2 is a type I-B, C, E, F or U Cas. Optionally, C1 is a type I-B Cas and C2 is a type I-B, C, E, F, or U Cas. Optionally, C1 is a type I-C Cas and C2 is a type I-B, C, E, F, or U Cas. Optionally, C1 is a type I-D Cas and C2 is a type I-B, C, E, F or U Cas. Optionally, C1 is a type I-E Cas and C2 is a type I-B, C, E, F, or U Cas. Optionally, C1 is a type I-F Cas and C2 is a type I-B, C, E, F or U Cas. Optionally, C1 is a type I-U Cas and C2 is a type I-B, C, E, F or U Cas.

Optionally, the first and second coating layers are formed by coating,

(a) C1 is IB or C-type Cas and C2 is I-E or F-type Cas (optionally C1 is IB-type Cas3 and C2 is IE-type Cas);

(b) C1 is an IC or C-type Cas and C2 is an I-E or F-type Cas (optionally C1 is an IC-type Cas3 and C2 is an IE-type Cas 3); or

(c) C1 is a type II Cas9 and C2 is a type I Cas3 (optionally C2 is E.coli IE or a type F Cas3; or Clostridium difficile Cas IB).

Optionally, the step of (a) is carried out,

(a) C1 is Cas3 (optionally type I-a, B, C, D, E, F, or U Cas 3) and C2 is Cas3 (optionally type I-a, B, C, D, E, F, or U Cas 3);

(b) C1 is Cas9 and C2 is Cas3 (optionally an I-a, B, C, D, E, F or U-type Cas 3);

(c) C1 is Cas3 (optionally type I-a, B, C, D, E, F or U Cas 3) and C2 is Cas10 (optionally subtype Cas 10A, B, C or D);

(d) C1 is Cas9 and C2 is Cas10 (optionally Cas 10A, B, C or D subtypes);

(e) C1 is Cas9 and C2 is Cas12 (optionally Cas12 a);

(f) C1 is Cas3 (optionally an I-a, B, C, D, E, F or U-type Cas 3) and C2 is Cas12 (optionally Cas12 a);

(g) C1 is Cas9 and C2 is Cas13 (optionally Cas13a, cas13b, cas13C or Cas13 d); or

(h) C1 is Cas3 (optionally I-a, B, C, D, E, F or U-type Cas 3) and C2 is Cas13 (optionally Cas13a, cas13B, cas13C or Cas 13D).

Optionally, PS1 and PS2 are protospacers consisting of

(a) RNA and RNA, respectively;

(b) DNA and RNA, respectively;

(c) RNA and DNA, respectively; or

(d) DNA and DNA, respectively.

Optionally, C1 is clostridiaceae Cas3 (optionally clostridium difficile Cas3, such as I-B type Cas 3) and C2 is enterobacteriaceae Cas3 (optionally escherichia coli Cas3, such as I-E type Cas 3).

In one alternative, C1 and C2 are the same. In one alternative, C1 and C2 are the same type of Cas, e.g., cas9 each, cas3 each, cas12 each, cas13 each, or a same type of Cascade Cas each.

Optionally, C1 is Biostraticola, buchneri, west, citrobacter, kronospora (Cronobacter), enterobacter (enterobacter), enterobacter, escherichia, frankenella (franconicobacter), gibbsiella (Gibbsiella), ezhakiella (Izhakiella), klebsiella, kluyveromyces, kosakonia, lechleri, lelinobacter, limnobactum, magnarobacter (mangrovebacter), metakokonnia, pluronic, pseudocerabacter (pseucherichia), pseudocitrobacter (pseudociobacter), ralstonia or rosenbergii (rosengiella) Cas (e.g., cassacacas 3 or casacacas).

Optionally, C1 is spCas9 (streptococcus pyogenes: (streptococcus pyogenes) ((ii)S pyogenes) Cas 9) or saCas9 (staphylococcus aureus: (s.), (s.aureus)S aureus) Cas 9), and C2 is a type I Cas3 (optionally C2 is an e.coli type I-E or F Cas 3).

Optionally, the modification is cleavage of the genome, e.g., cleavage of DNA of the genome (e.g., ssDNA or dsDNA), RNA (e.g., mRNA, crRNA, tracrRNA, tRNA, snRNA, or rRNA, preferably mRNA), endonuclease cleavage or exonuclease cleavage, or cleavage of one but not both strands of the dsDNA of the genome (double-stranded DNA), or nicking of the dsDNA of the genome.

Optionally, PS1 is a chromosomal sequence of a cell. Optionally, PS1 is an episomal (e.g., plasmid) sequence from the cell.

Optionally, PS1 is a chromosomal sequence of a cell and PS2 is a chromosomal sequence of a cell. Optionally, PS1 is a chromosomal sequence of a cell and PS2 is an episomal (e.g., plasmid) sequence of a cell.

Optionally, each cell is a human, animal (i.e., non-human), plant, yeast, fungus, amoeba, insect, mammal, vertebrate, bird, fish, reptile, rodent, mouse, rat, livestock animal, cow, pig, sheep, goat, rabbit, frog, toad, protozoa, invertebrate, mollusk, fly, grass, tree, flowering plant, fruiting plant, crop, wheat, corn, maize, barley, potato, carrot or lichen cell. Optionally, each cell is a prokaryotic cell or a eukaryotic cell. For example, each cell is a bacterial or archaeal cell, optionally an escherichia coli cell or a clostridium difficile cell. In one embodiment, the one or more cells are cells of a genus or species disclosed in table 1. In one embodiment, the one or more cells are gram positive cells. In one embodiment, the one or more cells are gram-negative cells.

Optionally, the step of introducing comprises infecting the cell with a virus (optionally a bacteriophage, wherein the cell is a bacterial cell) or introducing a plasmid (optionally a conjugative plasmid) or introducing a phagemid into the cell, wherein the virus, plasmid or phagemid encodes a crRNA. Optionally, the virus, plasmid or phagemid encodes C1 and/or C2. Optionally, the virus, plasmid or phagemid encodes one of the C1 and C2, and the other Cas is an endogenous Cas encoded by the genome of the cell. Optionally, C1 and C2 are each endogenous Cas encoded by the genome of the cell. In one example, the Cas is encoded by a chromosome of the cell.

Optionally, C1 is Cas3 and the virus or plasmid encodes Cas5, cas6, cas7, and Cas8 (and optionally Cas 11) that are homologous to Cas3. Additionally or alternatively, optionally C2 is Cas3 and the virus or plasmid encodes Cas5, cas6, cas7 and Cas8 (and optionally Cas 11) that are homologous to Cas3.

The Cas is present in the cell simultaneously, and the Cas can cleave the genome simultaneously or sequentially.

Optionally, the method comprises introducing or expressing at least 3, 4 or 5 different types of crRNA into each cell, wherein the types target different protospacer sequences (e.g., different chromosomal sequences) comprised by the genome of the cell. In one example, the cell is a bacterial or archaeal cell, and the protospacer is comprised by a cell chromosome. For example, at least one or both of the crRNA types targets a corresponding chromosomal sequence, and at least one or more of the crRNA types targets a sequence comprised by an episome (e.g., a plasmid) of a cell, wherein the cell is a bacterial or archaeal cell. For example, a cell (e.g., a human or mammalian cell) comprises a plurality of chromosomes, and the crRNA targets a protospacer sequence comprised by two or more of the chromosomes (e.g., where the chromosomes are not members of the same diploid chromosome pair).

For example, the methods include introducing a nucleic acid into each cell, wherein the nucleic acid comprises in the 5 'to 3' direction a nucleotide sequence encoding a Cascade nuclease (e.g., cas 3) and one or more sequences encoding one or more Cascade Cas (e.g., cas8e, cas11, cas7, cas5, and Cas6; or Cas6, cas8b, cas7, and Cas 5) operable with the Cascade nuclease to modify the cognate protospacer sequence.

The nucleic acid is preferably free of an adaptor module. Optionally, the module encodes Cas1 and Cas2; or Cas1, cas2, and Cas4.

In one embodiment, the nucleic acid comprises a CRISPR array encoding a crRNA, such as an array comprising at least 3, 4, or 5 spacer sequences that target at least 3, 4, or 5 sequences, respectively, of a cell. For example, multiple chromosomal intergenic regions are targeted. Optionally, each spacer sequence consists of 20 to 50, 20 to 40, 22 to 40, 25 to 40 or 30 to 35 consecutive nucleotides, for example 32 or 37 nucleotides.

In one example, the array comprises the following spacer sequences (spacers 1-3):

separated by a repeating sequence (i.e., spacer 1-repeat-spacer 2-repeat-spacer 3).

In another example, the array comprises 3, 4, or 5 of the following spacer sequences (spacers 4-8):

separated by a repeating sequence (i.e., spacer 4-repeat-spacer 5-repeat-spacer 6-repeat-spacer 7-repeat-spacer 8).

Optionally, each repeat sequence consists of 20 to 50, 20 to 40, 22 to 40, 25 to 40 or 30 to 35 consecutive nucleotides, for example 29 nucleotides. For example, each repeat sequence consists of: gagttccccgcgccagcgggataaaccg (and optionally, the Cas is/is an escherichia coli Cas). In another example, each repeat sequence consists of: (and optionally, the Cas is/is a clostridium difficile Cas).

Optionally, each crRNA is expressed from a nucleic acid under the control of a common or respective constitutive promoter.

Optionally, each Cas is expressed from a nucleic acid under the control of a common or respective constitutive promoter. In one embodiment, the first crRNA and C1 are expressed under the control of a common constitutive promoter and/or the second crRNA and C2 are expressed under the control of a common constitutive promoter. For example, the promoters are the same promoter or they are different promoters. In one example, one, more, or all of the promoters are strong promoters. The promoter may be any of the promoters disclosed in WO2020078893 or US20200115716, the disclosures of such promoters (and of nucleic acids, operons and vectors comprising one or more such promoters) being expressly incorporated herein by reference for possible uses in the present invention.

In one embodiment, a first plurality of different crRNAs is expressed in one or more of each cell, wherein each crRNA is operable with CS1 to direct modification of the genome, and the plurality targets at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 (preferably, at least 2, 3, 4, or 5; or exactly 2, 3, 4, or 5) different protospacers comprised by the genome of the cell; and/or a second plurality of different crrnas is expressed in each cell, wherein each crRNA is operable with CS2 and the second plurality targets at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 (preferably, at least 2, 3, 4, or 5; or exactly 2, 3, 4, or 5) different protospacers comprised by the genome of the cell. For example, the first plurality comprises 2 to 10, e.g., 2 to 7, different crrnas. For example, the second plurality comprises 2 to 10, e.g., 2 to 7, different crrnas.

Optionally, one or more or all of the cells are killed by the method. Optionally, the growth or proliferation of one or more or all of the cells is reduced by the method. Usefully, when the cell is a prokaryotic cell (e.g., a bacterial or archaeal cell), the chromosome of the cell is cleaved by the Cas. For example, bacterial cell chromosomes are cleaved by C1 and C2, and cells are killed.

Optionally, the first crRNA (or each crRNA of the first plurality) is comprised by a guide RNA, wherein the guide RNA further comprises a tracrRNA and/or the second crRNA (or each crRNA of the second plurality) is comprised by a guide RNA, wherein the guide RNA further comprises a tracrRNA. Optionally, the first crRNA (or each crRNA in the first plurality) is comprised by a chimeric guide RNA and/or the second crRNA (or each crRNA in the second plurality) is comprised by a chimeric guide RNA.

For example, the genomic modification of the plurality of cells is cleavage of genomic nucleic acid (e.g., chromosomal DNA) and the cells are killed, wherein the killing of the plurality of cells is synergistic compared to the killing using C1 or C2 alone.

One aspect provides: -

A method of killing or reducing growth or proliferation of a plurality of cells (optionally prokaryotic cells such as bacterial cells) of a first species or strain, the method comprising performing the method of the invention using the cells, wherein C1 and/or C2 is a Cas nuclease and the genome of the cells is cleaved by the Cas nuclease and the cells are killed or growth or proliferation of the cells is reduced.

Optionally, as exemplified herein, the method reduces the number of the plurality of cells by at least 10 ⁵ 、10 ⁶ Or 10 ⁷ Multiples, e.g. 10 ⁵ To 10 ⁷ Multiple, or 10 ⁵ To 10 ⁸ Multiple or 10 times ⁵ To 10 ⁹ And (4) multiplying. The skilled person will be familiar with determining fold killing or reduction in cells, for example, using a cell sample representing a microbiome or cell population. Illustrative examples are given in the following examples. For example, the extent to which growth or proliferation is killed or reduced is determined using a cell sample, e.g., a sample obtained from a subject to whom a composition of the invention has been administered, or an environmental sample (e.g., an aqueous, water, or soil sample) obtained from an environment (e.g., a water source, a waterway, or a field) with which a composition of the invention has been contacted.

For example, the method reduces the number of the plurality of cells by at least 10 ⁵ 、10 ⁶ Or 10 ⁷ And, optionally, the plurality comprises at least 100,000;1,000,000; or 10,000,000 cells.

Optionally, the plurality of cells is comprised by a population of cells, wherein at least 5, 6 or 7 log10 cells of the population are killed by the method, and optionally, the plurality each comprises at least 100,000;1,000,000, or 10,000,000 cells.

When the cell herein is a bacterial cell, it may be of a first species or genus selected from table 1. Similarly, the plurality of cells herein can be cells of a species or genus selected from table 1.

Optionally, as exemplified herein, the method kills at least 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or 99.99999% of the cells in the plurality.

In one example, the method is performed on the population (or the plurality) of cells and kills, modifies, or edits all (or substantially all) cells of the population (or the plurality). In one example, the method is performed on the population (or the plurality) of cells and kills, modifies, or edits 100% (or about 100%) of the cells of the population (or plurality).

Optionally, the species is escherichia coli or clostridium difficile.

One aspect of the present invention provides: -

A method of editing the genome of one or more cells, the method comprising

(a) Modifying the genome of each cell by performing the method of the invention, wherein the genome is subject to Cas cleavage; and

(b) Inserting a nucleic acid at or near the Cas cleavage site in the genome and/or deleting a nucleic acid sequence from the genome at or near the Cas cleavage site in the genome, wherein a cell with an edited genome is produced; and

(c) Optionally isolating a nucleic acid comprising an insertion or deletion from the cell; or sequencing a nucleic acid sequence of the cell, wherein the nucleic acid sequence comprises an insertion or a deletion.

In one example, the method is performed on a population of the cells, wherein the population comprises at least 100 of the cells and at least 90 or 99% of the cells are edited.

In one embodiment, the method is a method of recombinant engineering, e.g., in one or more E.coli cells.

The insertion may be immediately adjacent to or overlapping the cleavage site, or the insertion may be within 1kb, 2kb, or 200, 150, 100, 50, 25, 10, or 5 nucleotides of the cleavage site. For example, the nucleic acid is inserted by homologous recombination. In one embodiment, the nucleic acid inserts and replaces genomic sequence of 1 to 100, 90, 80, 70, 60, 50, 40, 30, 20, 10 or 5kb or 200, 150, 100, 50, 25, 10 or 5 nucleotides of the genome (the sequence is inserted in place of the deleted genomic sequence) by homologous recombination. For example, the deleted genomic sequence flanks the cleavage site on either side, or 5 '-or 3' -side of the cleavage site. In one embodiment, the nucleic acid is inserted by homologous recombination and does not replace any genomic sequence.

The deletion may be immediately adjacent to or overlapping the cleavage site, or the deletion may be within 1kb, 2kb, or 200, 150, 100, 50, 25, 10, or 5 nucleotides of the cleavage site. For example, a deletion is a deletion of 1 to 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2, or 1kb, or 200, 150, 100, 50, 25, 10, or 5 nucleotides of the genome. For example, the deleted genomic sequence flanks the cleavage site, or is 5 'or 3' to the cleavage site.

For example, the inserted nucleic acid is DNA. For example, the deleted nucleic acid is DNA, such as chromosomal or episomal DNA.

For example, the inserted nucleic acid is at least (or no more than) 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2, or 1kb in length; or 200, 150, 100, 50, 25, 10, or 5 consecutive nucleotides. For example, the deleted genomic nucleic acid is at least (or no more than) 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2, or 1kb in length; or 200, 150, 100, 50, 25, 10, or 5 consecutive nucleotides.

For example, the genomic sequence is DNA. For example, genomic DNA is deleted or replaced. For example, genomic DNA is deleted or replaced, and the edits insert DNA sequences into the genome (e.g., at or flanking the cleavage sites).

For example, the genomic sequence is RNA. For example, genomic RNA is deleted or replaced. For example, genomic RNA is deleted or replaced, and the edits insert the RNA sequence into the genome (e.g., at or flanking the cleavage site).

Optionally, the method further comprises

(a) Culturing the modified cell to produce progeny thereof; and optionally isolating progeny cells; or

(b) Inserting the sequence obtained from the cells in step (c) into recipient cells and growing a cell line therefrom.

Optionally, the progeny cell or cell line expresses a protein, wherein the protein is encoded (in whole or in part) by a nucleotide sequence comprising the inserted nucleic acid sequence, the method further comprising obtaining the expressed protein or isolating the expressed protein from the cell or cell line.

Optionally, the method further comprises combining the progeny cells, cell lines, or proteins with a pharmaceutically acceptable carrier, diluent, or excipient, thereby producing a pharmaceutical composition.

In one embodiment, the inserted nucleic acid comprises transcriptional and/or translational regulatory elements for controlling expression of one or more nucleic acid sequences of the editing genome adjacent to the insertion. For example, the inserted nucleic acid comprises a promoter, such as a constitutive or strong promoter. In another example, the element is a transcription or translation terminator, e.g., the inserted sequence comprises a stop codon. In this manner, transcription of the gene (or portion of the gene) adjacent to the inserted sequence in the editing genome is terminated or prevented or reduced.

In one example, the deleted genomic sequence is an RNA (e.g., mRNA) sequence. For example, deletion of an RNA sequence reduces or prevents expression of an amino acid sequence in a cell, wherein the amino acid sequence is encoded by the deleted RNA sequence. This may be useful for reducing or preventing expression of a protein comprising an amino acid sequence in a cell, such as in the case where the protein is undesirable or unwanted or detrimental to the cell or is the subject or environment comprising the cell.

One aspect provides: -

A method of treating or preventing a disease or condition in a human or animal subject, the method comprising (i) administering to the subject a pharmaceutical composition according to the invention, wherein the composition comprises the protein, wherein the protein mediates treatment or prevention of the disease or condition; or (ii) administering to the subject a pharmaceutical composition according to the invention, wherein when the composition comprises the progeny cell or cell line, the cell or cell line expresses a protein or RNA in the subject, and wherein the protein or RNA mediates the treatment or prevention of the disease or condition.

Exemplary diseases and conditions are disclosed below.

For example, the RNA encodes a therapeutic or prophylactic protein expressed in the subject. For example, the protein is a therapeutic or prophylactic protein. The protein may act therapeutically or prophylactically by interacting with another protein (e.g., an endogenously encoded protein) in the subject or by interacting with another cell in the subject.

Optionally, the protein is an antibiotic, an antibacterial agent, an enzyme, a growth factor, an antigen binding protein (e.g., an antibody or fragment thereof), a hormone, a blood component, a cytokine, an immune checkpoint modulator (e.g., an inhibitor or upregulator), an analgesic, a neurotransmitter, an anti-inflammatory agent, or an anti-neoplastic agent.

Optionally, the plurality of cells is comprised by a microbiome sample, wherein the method is performed in vitro and produces a modified cell sample in which cells of the first species or strain have been killed, the method further comprising combining the modified sample with a pharmaceutically acceptable carrier, diluent or excipient, thereby producing the pharmaceutical composition comprising the cell graft. For example, the graft may be administered to the Gastrointestinal (GI) or intestinal tract of a human or animal subject, e.g., by oral administration, or by rectal administration. For example, the graft may be administered by vaginal administration.

Optionally, the microbiome herein is an intestinal, lung, kidney, urinary tract, bladder, blood, vaginal, eye, ear, nose, penis, intestine, liver, heart, tongue, hair or skin microbiome.

One aspect provides: -

A method of treating or preventing a disease or condition in a human or animal subject, the method comprising administering to the subject a pharmaceutical composition of the invention.

One aspect provides: -

An ex vivo or in vitro method of treating an environment or a sample of cells, said method comprising exposing the environment or sample to a composition of the invention, wherein cells comprised by said environment or sample are modified, edited or killed, or the growth or proliferation of cells of said environment or sample is reduced.

For example, the cells are killed. For example, the cells are edited by the editing methods of the invention. Optionally, the treated sample is administered to a human or animal subject or contacted with the environment.

Optionally, the plurality of cells is comprised by an environmental sample (e.g., an aqueous, water, oil, petroleum, soil, or fluid (such as air or liquid) sample). A suitable environment may be the contents of an industrial or laboratory apparatus or vessel (e.g. a fermentation vessel).

Optionally, the method of the invention is carried out in vitro. Optionally, the method of the invention is performed ex vivo.

One aspect provides: -

(a) First and second crrnas;

wherein

(f) The second crRNA (crRNA 2) is capable of directing a second Cas (C2) to a protospacer sequence (PS 2) comprised by the genome of the target cell to modify PS2;

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is

Wherein the method comprises administering the composition to the subject, thereby introducing components of the composition into target cells, wherein crRNA1, crRNA2, C1, and C2 are provided in each cell, and the genome of each cell undergoes Cas modification and the disease or condition is treated or prevented.

Optionally, the treatment or prevention comprises practicing the methods of the invention.

Optionally, the method is for reducing infection of a subject by a target cell (optionally, wherein the target cell is a pathogenic cell, such as a pathogenic prokaryotic cell, such as a pathogenic bacterial cell).

Optionally, the components are comprised by one (or one or more) nucleic acid vectors. In one example, each vector is a virus, phage, plasmid (e.g., a conjugative plasmid), cosmid, phagemid, or nanoparticle (e.g., a liposome).

In one example, any of the methods herein are performed on a population of the cells (or the plurality of cells), wherein the population comprises at least 100 of the cells and at least 90, 99, 99.9, 99.99, 99.999, 99.9999, 99.99999, 99.9999999, 99.9999999999, 99.9999999, 99.99999999, or 99.999999999% of the cells are modified, e.g., subjected to Cas nuclease cleavage. In one embodiment, said population (or said plurality) comprises at least 1000 of said cells. In one embodiment, said population (or said plurality) comprises at least 10,000 of said cells. In one embodiment, said population (or said plurality) comprises at least 100,000 of said cells. In one embodiment, said population (or said plurality) comprises at least 1,000,000 of said cells. In one embodiment, said population (or said plurality) comprises at least 10,000,000 of said cells. In one embodiment, said population (or said plurality) comprises at least 100,000,000 of said cells. In one embodiment, said population (or said plurality) comprises at least 1000,000,000 of said cells. In one embodiment, said population (or said plurality) comprises at least 10,000,000,000 of said cells.

In one example, the population or the plurality is comprised by a microbiome of a human, an animal (e.g., a livestock animal or a companion pet), a plant, or an environment (e.g., a water course, soil, fluid microbiome).

One aspect provides: -

A composition comprising components (a), (b) or (d): -

(a) First and second crrnas;

wherein

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is

Optionally, the genome of each cell is edited or the cells are killed.

Optionally, each cell is a prokaryotic cell (optionally a bacterial or archaeal cell).

Optionally, the nucleic acid is comprised by a virus (e.g., AAV or cytomegalovirus, optionally wherein each cell is a mammalian cell, such as a human cell), a bacteriophage (e.g., wherein each cell is a bacterial cell), a plasmid (optionally conjugated to a plasmid, e.g., wherein each cell is a bacterial cell), a nanoparticle (e.g., a liposome or a gold particle), or a phagemid (e.g., wherein each cell is a bacterial cell).

When the nucleic acid is comprised by a virus, the cell may be a mammalian (e.g., human or rodent, mouse or rat) cell, a bacterial cell, an archaeal cell, or a amoeba cell. When the nucleic acid is comprised by a bacteriophage, the cell may be a bacterial cell.

Optionally, the nucleic acid encodes C1 and/or C2.

Optionally, C1 is a type I Cas and the nucleic acid encodes one or more Cascade Cas operable with C1 and/or wherein C2 is a type I Cas and the nucleic acid encodes one or more Cascade Cas operable with C2.

One aspect provides: -

A pharmaceutical composition according to the invention, wherein the composition comprises a pharmaceutically acceptable excipient, diluent or carrier.

The composition may be an aqueous composition. The composition may be a lyophilized or freeze-dried composition, for example, in a formulation suitable for inhalation delivery to a patient.

Optionally, the composition is comprised by a sterile drug administration device, optionally a syringe, an IV bag, an intranasal delivery device, an inhaler, a nebulizer, or a rectal administration device). Optionally, the composition is comprised by a cosmetic product, dental hygiene product, personal hygiene product, laundry product, oil or petroleum additive, water additive, shampoo, conditioner, skin moisturizer, soap, hand sanitizer, laundry detergent, cleanser, environmental remediation agent, coolant (e.g., air cooler), or air treatment agent.

In one example, the composition is contained by a device for delivering the composition as a liquid or dry powder spray. This may be useful for topical application to a patient or to a large environmental area such as a field or waterway.

Optionally, the cell is comprised by the gut, lung, kidney, urethra, bladder, blood, vagina or skin microbiome of the subject.

Optionally, the method is performed on a human or animal subject, wherein the cells are killed by the method, and the killing up-regulates or down-regulates immune cells in the subject (optionally (i) up-regulates CD8 ⁺ 、CD4 ⁺ TH1, TH2, TH17, NK cells, TILS, T regulatory or T effector cells; or (ii) downregulation of CD8 ⁺ 、CD4 ⁺ TH1, TH2, TH17, T regulatory or T effector cells), thereby treating or preventing a disease or condition in a subject. In a preferred embodiment, CD8 ⁺ NK or TILS cells are upregulated, e.g., wherein the disease or condition is cancer. In a preferred embodiment, CD8 ⁺ Or NK cells are upregulated, e.g., wherein the disease or condition is a viral infection. In a preferred embodiment, TH1, TH2 or TH17 cells are down-regulated, e.g., wherein the disease or condition is an autoimmune or inflammatory disease or condition. For example, the disease or condition is cancer or an autoimmune disease or condition. For example, the disease or condition is cancer and CD8 ⁺ Or T effector cells are up-regulated in the subject and/or T regulatory cells are down-regulated in the subject. For example, the disease or condition is an autoimmune disease or condition and CD8 ⁺ Or T effector cells are down-regulated in the subject and/or T regulatory cells are up-regulated in the subject.

Optionally, the method comprises introducing or expressing into or in each cell at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 (preferably, at least 2, 3, 4 or 5; or exactly 2, 3, 4 or 5, or exactly 8, or at least 8) different types of crRNA, wherein the different types target different protospacer sequences comprised by the genome of the cell; and optionally wherein C1 and C2 are Cas class 1 nucleases, e.g., cas3 nucleases.

Optionally, the method comprises introducing into each cell a nucleic acid encoding Cas3, cas8e, cas11, cas7, cas5 and Cas6 (optionally, cas is an e.

In another example, the method comprises introducing into each cell a Cas3, cas8e, cas11, cas7, cas 5-encoding nucleic acid and a Cas 9-encoding nucleic acid. In another example, the method comprises introducing into each cell a nucleic acid encoding Cas3, cas6, cas8b, cas7, and Cas5 and a nucleic acid encoding Cas9.

One aspect provides:

a method of modifying the genome of a cell, the method comprising

Optionally, the method comprises modifying a third protospacer of the genome using a third CRISPR/Cas system, wherein the third protospacer is different from the first and second protospacers. For example, 3 different Cas3 are used; 3 different Cas9 were used; using one Cas3 and two different Cas9; or use two different Cas3 and one Cas9.

The method of claim 51, wherein the method is according to any one of claims 1 to 35.

In certain aspects: -

The method of the present invention is a method as follows

(a) Generating a coordinated Cas nuclease cleavage of the cellular genome;

(e) Bacterial cells of a first species or strain in a cell population (e.g., large intestine)Bacillus cell) is reduced by at least 10 ⁵ 、10 ⁶ Or 10 ⁷ Wherein the populations each comprise at least 100,000;1,000,000; or 10,000,000 cells.

Diseases and conditions

Optionally, the disease or condition is selected from:

(a) A neurodegenerative disease or condition;

(b) A brain disease or condition;

(c) A CNS disease or condition;

(d) Memory loss or impairment;

(e) Heart or cardiovascular diseases or conditions, such as heart attack, stroke, or atrial fibrillation;

(f) A liver disease or condition;

(g) Kidney diseases or conditions, such as Chronic Kidney Disease (CKD);

(h) A pancreatic disease or condition;

(i) Pulmonary diseases or conditions, such as cystic fibrosis or COPD;

(j) A gastrointestinal disease or condition;

(k) Throat or oral diseases or conditions;

(l) An ocular disease or condition;

(m) genital diseases or conditions, such as vaginal, labial, penile, or scrotal diseases or conditions;

(n) sexually transmitted diseases or conditions, such as gonorrhea, HIV infection, syphilis or chlamydia infection;

(o) an otic disease or condition;

(p) a skin disease or condition;

(q) a cardiac disease or condition;

(r) nasal diseases or conditions

(s) hematological diseases or conditions, such as anemia, e.g., anemia of chronic disease or cancer;

(t) viral infection;

(u) pathogenic bacterial infection;

(v) Cancer;

(w) autoimmune diseases or conditions, e.g., SLE;

(x) Inflammatory diseases or conditions, such as rheumatoid arthritis, psoriasis, eczema, asthma, ulcerative colitis, crohn's disease or IBD;

(y) autism;

(z) ADHD;

(aa) bipolar disorder;

(bb) ALS [ amyotrophic lateral sclerosis ];

(cc) osteoarthritis;

(dd) a congenital or developmental defect or condition;

(ee) abortion;

(ff) a coagulation condition;

(gg) bronchitis;

(hh) dry or wet AMD;

(ii) Neovascularization (e.g., of a tumor or in the eye);

(jj) common cold;

(kk) epilepsy;

(ll) fibrosis, such as liver or pulmonary fibrosis;

(mm) fungal diseases or conditions, such as thrush;

(nn) metabolic diseases or conditions, such as obesity, anorexia, diabetes, type I or type II diabetes.

(oo) ulcers, such as gastric or skin ulcers;

(pp) dry skin;

(qq) sjogren's syndrome;

(rr) cytokine storm;

(ss) deafness, hearing loss or impairment;

(tt) slow or fast metabolism (i.e., slower or faster than average for subject weight, gender, and age);

(uu) pregnancy disorders, such as infertility or sub-fertility;

(vv) jaundice;

(ww) rash;

(xx) Kawasaki disease;

(yy) lyme disease;

(zz) allergies, such as nut, grass, pollen, dust mites, cat or dog fur or dander allergies;

(aaa) malaria, typhoid, tuberculosis or cholera;

(bbb) depression;

(ccc) mental retardation;

(ddd) microcephaly;

(eee) malnutrition;

(fff) conjunctivitis;

(ggg) pneumonia;

(hhh) pulmonary embolism;

(iii) Pulmonary hypertension;

(jjj) bone disorders;

(kkk) sepsis or septic shock;

(lll) rhinitis (Sinusitus);

(mmm) pressure (e.g., occupational pressure);

(nnn) thalassemia, anemia, von willebrand disease or hemophilia;

(ooo) herpes zoster or herpes labialis;

(ppp) menstruation;

(qqqq) sperm count is low.

Neurodegenerative or CNS diseases or conditions for treatment or prevention

In one example, the neurodegenerative or CNS disease or condition is selected from alzheimer's disease, senile psychosis, down syndrome, parkinson's disease, creutzfeldt-Jakob disease, diabetic neuropathy, parkinsonism, huntington's disease, machado-Joseph disease, amyotrophic lateral sclerosis, diabetic neuropathy, and Creutzfeldt-Jakob disease. For example, the disease is alzheimer's disease. For example, the disease is parkinsonism.

In one example in which the methods of the invention are practiced on a human or animal subject for treating a CNS or neurodegenerative disease or condition, the methods cause down-regulation of Treg cells in the subject, thereby promoting systemic monocyte-derived macrophages and/or Treg cells to cross the choroid plexus into the brain of the subject, thereby treating, preventing, or reducing progression of the disease or condition (e.g., alzheimer's disease). In one embodiment, the method causes an increase in IFN- γ in the CNS system (e.g., brain and/or CSF) of the subject. In one example, the method restores nerve fibers and/or reduces progression of nerve fiber damage. In one example, the method restores neuropsychomyelin and/or reduces the progression of neuropsychomyelin damage. In one example, the methods of the invention for treating or preventing a disease or condition disclosed in WO2015136541 and/or the methods may be used with any method disclosed in WO2015136541 (the disclosure of which is incorporated herein by reference in its entirety, e.g., for providing potential therapeutic agents, e.g., agents, such as immune checkpoint inhibitors, e.g., anti-PD-1, anti-PD-L1, anti-TIM 3 or other antibodies disclosed therein, that disclose such methods, diseases, conditions and that may be administered to a subject to effect treatment and/or prevention of CNS and neurodegenerative diseases and conditions).

Cancer treatment or prevention

Treatable cancers include non-vascularized, or substantially non-vascularized tumors as well as vascularized tumors. The cancer may comprise a non-solid tumor (such as a hematological tumor, e.g., leukemia and lymphoma) or may comprise a solid tumor. The types of cancer to be treated by the present invention include, but are not limited to, carcinoma, blastoma, and sarcoma; and certain leukemias or lymphoid malignancies; benign and malignant tumors; and malignant tumors such as sarcomas, carcinomas, and melanomas. Also included are adult tumors/cancers and pediatric tumors/cancers.

Hematological cancers are cancers of the blood or bone marrow. Examples of hematologic (or hematopoietic) cancers include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelogenous leukemia and myeloblasts, promyelocytes, myelomonocytic, monocytic, and erythroleukemia), chronic leukemias (such as chronic myelogenous (granulocytic) leukemia, chronic myelogenous leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphomas, hodgkin's disease, non-hodgkin's lymphoma (low grade and high grade forms), multiple myeloma, waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia, and myelodysplasia.

A solid tumor is an abnormal mass of tissue that generally does not contain cysts or fluid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the cell types that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors, such as sarcomas and carcinomas, include: fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma and other sarcomas, synovioma, mesothelioma, ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic carcinoma, breast carcinoma, lung carcinoma, ovarian carcinoma, prostate carcinoma, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, wilms' tumor, cervical carcinoma, testicular tumor, seminoma, bladder carcinoma, melanoma, and CNS tumors (such as gliomas (such as brain stem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme), astrocytoma, CNS lymphoma, blastomas, medulloblastomal tumors, schwannoma, ependymoma, neuroblastoma, angioblastoma, hemangioblastoma, and oligodendroglioma.

For the treatment or prevention of autoimmune diseases

Acute Disseminated Encephalomyelitis (ADEM)

Acute necrotizing hemorrhagic leukoencephalopathy

Addison's disease

Globulinemia

Alopecia areata

Amyloidosis

Ankylosing spondylitis

anti-GBM/anti-TBM nephritis

Antiphospholipid syndrome (APS)

Autoimmune angioedema

Autoimmune aplastic anemia

Autoimmune autonomic nervous dysfunction

Autoimmune hepatitis

Autoimmune hyperlipidemia

Autoimmune immunodeficiency

Autoimmune Inner Ear Disease (AIED)

Autoimmune myocarditis

Autoimmune oophoritis

Autoimmune pancreatitis

Autoimmune retinopathy

Autoimmune Thrombocytopenic Purpura (ATP)

Autoimmune thyroid disease

Autoimmune urticaria

Axon and neuron neuropathies

Balo disease

Behcet's disease

Bullous pemphigoid

Cardiomyopathy

Castleman disease

Celiac disease

Chagas disease

Chronic fatigue syndrome

Chronic Inflammatory Demyelinating Polyneuropathy (CIDP)

Chronic Relapsing Multifocal Osteomyelitis (CRMO)

Churg-Strauss syndrome

Cicatricial/benign mucosal pemphigoid

Crohn's disease

Cogans syndrome

Cold agglutinin disease

Congenital heart block

Coxsackiemyocarditis

CREST disease

Essential mixed cryoglobulinemia

Demyelinating neuropathy

Dermatitis herpetiformis

Dermatomyositis

Devkk disease (neuromyelitis optica)

Discoid lupus

Dressler syndrome

Endometriosis

Eosinophilic esophagitis

Eosinophilic fasciitis

Erythema nodosum

Experimental allergic encephalomyelitis

An Evens syndrome

Fibromyalgia

Fibrosing alveolitis

Giant cell arteritis (temporal arteritis)

Giant cell myocarditis

Glomerulonephritis

Goodpasture's syndrome

Granulomatosis with polyangiitis (GPA) (formerly known as Wegener's granulomatosis)

Graves' disease

Guillain-Barre syndrome

Hashimoto encephalitis

Hashimoto's thyroiditis

Hemolytic anemia

Henoch-Schonlein purpura

Herpes gestationis

Globulinemia of hypogalactia

Idiopathic Thrombocytopenic Purpura (ITP)

IgA nephropathy

IgG 4-related sclerosing diseases

Immunomodulatory lipoproteins

Inclusion body myositis

Interstitial cystitis

Arthritis of juvenile type

Juvenile onset diabetes mellitus (type 1 diabetes)

Juvenile myositis

Kawasaki syndrome

Lambert-eaton syndrome

Vasculitis due to leucocyte clastic

Lichen planus

Lichen sclerosus

Ligneous conjunctivitis

Linear IgA disease (LAD)

Lupus (SLE)

Chronic lyme disease

Meniere's disease

Polyangiitis under microscope

Mixed Connective Tissue Disease (MCTD)

Mooren's ulcer

Disease of Mucha-Habermann

Multiple sclerosis

Myasthenia gravis

Myositis, myositis

Narcolepsy

Neuromyelitis optica (Devic's)

Neutropenia

Ocular cicatricial pemphigoid

Optic neuritis

Palindromic rheumatism

PANDAS (pediatric autoimmune neuropsychiatric disorder associated with streptococcus)

Paraneoplastic cerebellar degeneration

Paroxysmal Nocturnal Hemoglobinuria (PNH)

Parry Romberg syndrome

Parsonnage-Turner syndrome

Pars plana inflammation (peripheral uveitis)

Pemphigus

Peripheral neuropathy

Perivenous encephalomyelitis (Perivenous encephalomyelitis)

Pernicious anemia

POEMS syndrome

Polyarteritis nodosa

Autoimmune polyglandular syndrome types I, II and III

Polymyalgia rheumatica

Polymyositis

Post-myocardial infarction syndrome

Postpericardiotomy syndrome

Dermatitis caused by progesterone

Primary biliary cirrhosis

Primary sclerosing cholangitis

Psoriasis

Psoriatic arthritis

Idiopathic pulmonary fibrosis

Pyoderma gangrenosum

Pure red blood cell aplasia

The phenomenon of Raynauds

Reactive arthritis

Reflex sympathetic dystrophy

Reiter's syndrome

Recurrent polychondritis

Restless leg syndrome

Retroperitoneal fibrosis

Wind-damp-heat syndrome

Rheumatoid arthritis

Sarcoidosis, sarcoidosis

Schmidt syndrome

Scleritis (Schlemm)

Scleroderma

Sjogren's syndrome

Sperm and testis autoimmunity

Stiff person syndrome

Subacute Bacterial Endocarditis (SBE)

Susac's syndrome

Sympathetic ophthalmia

Takayasu's arteritis

Temporal arteritis/giant cell arteritis

Thrombocytopenic Purpura (TTP)

Tolosa-Hunt syndrome

Transverse myelitis

Type 1 diabetes mellitus

Ulcerative colitis

Undifferentiated Connective Tissue Disease (UCTD)

Uveitis

Vasculitis

Blistering skin disease

Vitiligo

Wegener's granulomatosis (now known as granulomatosis with polyangiitis (GPA)).

For the treatment or prevention of inflammatory diseases

Alzheimer's disease

Ankylosing spondylitis

Arthritis (osteoarthritis, rheumatoid Arthritis (RA), psoriatic arthritis)

Asthma, asthma

Atherosclerosis

Crohn's disease

Colitis

Dermatitis of skin

Diverticulitis

Fibromyalgia

Hepatitis

Irritable Bowel Syndrome (IBS)

Systemic Lupus Erythematosus (SLE)

Nephritis

Parkinson's disease

Ulcerative colitis.

Optionally, the cell is a clostridium difficile, pseudomonas aeruginosa, klebsiella pneumoniae (e.g., carbapenem-resistant klebsiella pneumoniae or extended spectrum beta-lactamase (ESBL) -producing klebsiella pneumoniae), escherichia coli (e.g., ESBL-producing escherichia coli or escherichia coli ST131-025b h 4), helicobacter pylori, streptococcus pneumoniae, or staphylococcus aureus cell.

The vector herein may be a high copy number plasmid or phagemid comprising a constitutive promoter for controlling expression of the crRNA and optionally one or more Cas proteins.

In one example, the promoter is a medium strength promoter. In another example, the promoter is a repressible promoter or an inducible promoter cell. Examples of suitable repressible promoters are Ptac (repressed by lacI) and the left promoter (pL) of lambda phage (repressed by the lambda cI repressor). In one example, the promoter comprises a repressible operator (e.g., tetO or lacO) fused to the promoter sequence. Optionally, the promoter has an Andersen Score (AS) of 0.5 >.

Features generally applicable:

any cell herein can be a bacterial cell, an archaeal cell, an algal cell, a fungal cell, a protozoan cell, an invertebrate cell, a vertebrate cell, a fish cell, an avian cell, a mammalian cell, a companion animal cell, a dog cell, a cat cell, an equine cell, a mouse cell, a rat cell, a rabbit cell, a eukaryotic cell, a prokaryotic cell, a human cell, an animal cell, a rodent cell, an insect cell, or a plant cell. Preferably, the cell is a bacterial cell. Alternatively, the cell is a human cell.

Optionally, C1 and C2 are any Cas of a type I system (e.g., cas2, 3, 4, 5, or 6). In this example, in one embodiment, the Cas can be fused or conjugated to a moiety operable to increase or decrease transcription of a gene comprising the target protospacer sequence. For example, a Cas-encoding nucleic acid introduced into a cell may comprise a nucleotide sequence encoding the portion, wherein the Cas and the portion are expressed as a fusion protein in a host cell. In one embodiment, the Cas is N-terminal to the moiety; in another embodiment, it is at the C-terminus of the moiety.

In one example, the vector herein is a DNA vector, e.g., an ssDNA vector or a dsDNA vector. Optionally, the vector comprises a second nucleotide sequence encoding one or more Cascade proteins. For example, the Cascade protein is homologous to C1 or C2, which is Cas3.

In one example, cas1 or Cas2 is Cas3 homologous to a Cascade protein encoded by the cell.

Optionally, the Cas3 is Cas3 encoded by a CRISPR/Cas locus of the first bacterial or archaeal species, wherein in the locus the Cas 3-coding sequence is 3 'to the Cascade protein coding sequence (i.e., the latter is between Cas3 and the most 5' promoter of the locus). Optionally, the Cas3 is a ygcB protein.

Optionally, the Cascade protein comprises or consists of: cas5 (cas d, csy 2), cas6 (cas 6f, cse3, cas), cas7 (csc 2, csy3, cse4, cas c) and cas8 (cas a, cas8a1, cas8b1, cas8c, cas10d, cas8e, cse1, cas8f, csy 1).

Optionally, herein, the promoter and the sequence encoding Cas3 or encoding crRNA are separated by no more than 150, 100, 50, 40, 30, 20, or 10bp, e.g., 30-45, or 30-40, or 39, or about 39bp. Optionally, herein, the ribosome binding site and the sequence encoding Cas3 or encoding crRNA are separated by no more than 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 4 or 3bp, e.g., by 10-5, 6 or about 6bp.

In one example, the promoter herein is combined with the Shine-Dalgamo sequence comprising sequence 5 'aaaggagagaaaa-3' (SEQ ID NO: 5) or a ribosome binding site homologue thereof. Optionally, the promoter has an Anderson Score (AS) of 0.5 or greater; or 0.5 >; or an Andersen Score (AS) of ≦ 0.1.

Optionally, the first crRNA-encoding nucleic acid sequence, the second crRNA-encoding nucleic acid sequence, or the operon is comprised by a mobile genetic element. Suitable mobile genetic elements, such as transposons, are disclosed in WO2016177682 and US20170246221, the disclosures of which are expressly incorporated herein to make possible use in the present invention and to provide one or more features for the claims herein.

Optionally, the vector is free of nucleotide sequences encoding one, more or all of Cas1, cas2, cas4, cas6 (optionally Cas6 f), cas7 and Cas8 (optionally Cas8 f). Optionally, the vector is free of Cas6 (optionally Cas6 f) encoding sequences. Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas11, cas7 and Cas8a 1. Optionally, the vector comprises a nucleotide sequence encoding Cas3' and/or Cas3 ". In one embodiment, the vector comprises a nucleotide sequence (in the 5' to 3' direction) encoding Cas3 (e.g., cas3' and/or Cas3 "), cas11, cas7, and Cas8 al.

Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas11 sequence. Optionally, the vector comprises a type IA CRISPR array or one or more nucleotide sequences encoding single guide RNAs (grnas), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA is operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

Optionally, each cell comprises a type IA CRISPR array homologous to Cas3 (C1 or C2). Optionally, each cell comprises an endogenous type IB, C, U, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas8b1, cas7 and Cas 5. In one embodiment, the vector comprises a nucleotide sequence (in the 5 'to 3' direction) encoding Cas3, cas8b1, cas7, and Cas 5. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas8b1 sequence. Optionally, the vector comprises a type IB CRISPR array or one or more nucleotide sequences encoding single guide RNAs (grnas), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA and the Cas and Cascade proteins are operable to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

Optionally, the cell comprises a type IB CRISPR array homologous to Cas3. Optionally, the cell comprises an endogenous type IA, C, U, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas5, cas8c and Cas 7. In one embodiment, the vector comprises nucleotide sequences (in the 5 'to 3' direction) encoding Cas3, cas5, cas8c, and Cas 7. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas5 sequence. Optionally, the vector comprises an IC-type CRISPR array or one or more nucleotide sequences encoding single guide RNAs (grnas), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA is operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

Optionally, the host cell comprises an IC-type CRISPR array homologous to Cas3. Optionally, the host cell comprises an endogenous type IA, B, U, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas8U2, cas7, cas5 and Cas 6. In one embodiment, the vector comprises nucleotide sequences (in the 5 'to 3' direction) encoding Cas3, cas8U2, cas7, cas5, and Cas 6. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas8U2 sequence.

Optionally, the vector comprises an IU-type CRISPR array or one or more nucleotide sequences encoding single guide RNAs (grnas), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA is operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in a host cell, optionally thereby killing the host cell.

Optionally, the host cell comprises an IU-type CRISPR array homologous to Cas3. Optionally, the host cell comprises an endogenous type IA, B, C, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas10d, cas7 and Cas 5. Optionally, the vector comprises a nucleotide sequence encoding Cas3' and/or Cas3 ″. In one embodiment, the vector comprises nucleotide sequences encoding Cas3, cas10d, cas7, and Cas5 (in the 5 'to 3' direction). Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas10d sequence. Optionally, the vector comprises an ID-type CRISPR array or one or more nucleotide sequences encoding single guide RNAs (grnas), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA is operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

Optionally, the host cell comprises a type ID CRISPR array homologous to Cas3.

Optionally, the host cell comprises an endogenous type IA, B, C, U, E or F CRISPR/Cas system.

Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas8e, cas11, cas7, cas5 and Cas 6. In one embodiment, the vector comprises a nucleotide sequence (in the 5 'to 3' direction) encoding Cas3, cas8e, cas11, cas7, cas5, and Cas 6. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas11 sequence. Optionally, the vector comprises an IE-type CRISPR array or one or more nucleotide sequences encoding a single guide RNA (gRNA), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA is operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

Optionally, the host cell comprises an IE-type CRISPR array homologous to Cas3.

Optionally, the host cell comprises an endogenous type IA, B, C, D, U or F CRISPR/Cas system.

Optionally, the vector comprises (optionally in the 5 'to 3' direction) a nucleotide sequence encoding one, more or all of Cas8f, cas5, cas7 and Cas6 f. In one embodiment, the vector comprises nucleotide sequences (in the 5 'to 3' direction) encoding Cas3, cas8f, cas5, cas7, and Cas6 f. Optionally, the nucleotide sequence encoding Cas6 is between the Cas3 sequence and the Cas8f sequence. Optionally, the vector comprises an IF-type CRISPR array or one or more nucleotide sequences encoding single guide RNAs (grnas), wherein the array and each gRNA comprise a repeat sequence homologous to Cas3. Thus, when the vector has been introduced into a cell to produce a guide RNA, the array is operable in a host cell, wherein the guide RNA is operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, in one embodiment, the single guide RNA encoded by the vector may be operable with the Cas and the Cascade proteins to target and modify (e.g., cleave) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

Optionally, the host cell comprises an IF-type CRISPR array homologous to Cas3.

Optionally, the host cell comprises an endogenous type IA, B, C, D, U or E CRISPR/Cas system.

Optionally, the Cas and the Cascade are type IA Cas and Cascade proteins.

Optionally, the Cas and the Cascade are type IB Cas and Cascade proteins.

Optionally, the Cas and the Cascade are IC-type Cas and Cascade proteins.

Optionally, the Cas and the Cascade are ID-type Cas and Cascade proteins.

Optionally, the Cas and the Cascade are IE-type Cas and Cascade proteins.

Optionally, cas and Cascade are IF-type Cas and Cascade proteins.

Optionally, cas and Cascade are IU-type Cas and Cascade proteins.

Optionally, cas and Cascade are e.coli (optionally of IE or IF type) Cas and Cascade proteins, optionally wherein e.coli is ESBL producing e.coli or e.coli ST 131-025b.

Optionally, the Cas and the Cascade are clostridial (e.g., clostridium difficile) Cas and Cascade proteins, optionally clostridium difficile is resistant to one or more antibiotics selected from the group consisting of aminoglycosides, lincomycin, tetracyclines, erythromycin, clindamycin, penicillins, cephalosporins, and fluoroquinolones.

Optionally, the Cas and the Cascade are pseudomonas aeruginosa Cas and Cascade proteins, optionally the pseudomonas aeruginosa is resistant to one or more antibiotics selected from the group consisting of carbapenems, aminoglycosides, cefepime, ceftazidime, fluoroquinolones, piperacillin and tazobactam.

Optionally, cas and Cascade are klebsiella pneumoniae (e.g., carbapenem-resistant klebsiella pneumoniae or klebsiella pneumoniae that produces extended spectrum beta-lactamase (ESBL)) Cas and Cascade proteins.

Optionally, cas and Cascade are e.coli, clostridium difficile, pseudomonas aeruginosa, klebsiella pneumoniae, pyrococcus furiosus or bacillus halophilus Cas and Cascade proteins.

Optionally, each crRNA or gRNA comprises a spacer sequence capable of hybridizing to a cellular protospacer nucleotide sequence, wherein the protospacer sequence is adjacent to a PAM that is homologous to C1 or C2, wherein C1 or C2 is a Cas nuclease, e.g., cas3. Thus, the spacer hybridizes to the protospacer to direct Cas3 to the protospacer. Optionally, the Cas3 cleaves the protospacer, e.g., using exo-and/or endonuclease activity of Cas3. Optionally, the Cas3 removes a plurality (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10) of nucleotides from the protospacer.

Optionally, the vector is a bacteriophage or a non-replicative transduction particle. The bacteriophage or particle comprises a bacteriophage coat protein encapsulating DNA, wherein the DNA comprises a vector. Suitable examples of bacteriophages and particles are disclosed in US2019/0160120, the disclosure of which is incorporated by reference herein for possible use in the present invention and for providing one or more features that may be included in the claims herein. The phage or particle is capable of infecting a cell, thereby introducing the vector into the cell.

It should be understood that the specific embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications, and all U.S. equivalent patent applications and patents, are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Reference is made to publications mentioned herein and the United States Patent and Trademark Office (USPTO) or equivalent publications to WIPO, the disclosures of which are incorporated herein by reference to provide a disclosure that may be used in the present invention and/or to provide a characterization of one or more of the features (e.g., of the carrier) that may be included in one or more of the claims herein.

The use of the terms "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but is also consistent with the meaning of "one or more," at least one, "and" one or more than one. The use of the term "or" in the claims is intended to mean "and/or" unless it is explicitly stated that it refers only to alternatives, or that alternatives are mutually exclusive, but the present disclosure supports definitions that refer only to alternatives and "and/or". Throughout this application, the term "about" is used to indicate that a value includes the inherent variation in error of the device, the method used to determine the value, or the variation present in the subject under study.

As used in this specification and the claims (including the claims), the word "comprising" (and any form comprising such as "comprises" and "comprising"), "having" (and any form having such as "has" and "has"), "including" (and any form including such as "includes" and "includes"), "containing" (and any form containing (containing) such as "contains" and "contains (contains))," and no additional, unrecited elements or method steps are excluded.

As used herein, the term "or combinations thereof" or similar terms refer to all permutations and combinations of the listed items preceding the term. For example, "a, B, C, or a combination thereof" is intended to include at least one of: A. b, C, AB, AC, BC, or ABC, and if order is important in a particular context, BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, explicitly included are combinations that contain repetitions of one or more items or entries, such as BB, AAA, MB, BBC, aaabccccc, CBBAAA, CABABB, and the like. The skilled person will appreciate that there is generally no limitation on the number of items or items in any combination, unless otherwise apparent from the context.

Any portion of the present disclosure may be read in combination with any other portion of the present disclosure, unless otherwise apparent from the context.

In light of the present disclosure, all of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

The invention is described in more detail in the following non-limiting examples.

Examples

Example 1 combination of type I CRISPR-Cas systems synergistically targeting multiple genomic protospacers

A plasmid (we call CRISPR Guided Vector) was constructed ^TM , CGV ^TM ) Comprising an operon having nucleotide sequences encoding a type I Cas3 and a Cascade protein under the control of a constitutive promoter. Coli IE-type Cas3 and Cascade were used. Homologous CRISPR arrays comprising an e.coli direct repeat and a spacer for targeting to the e.coli host cell chromosome are also cloned in the vector. The adapter module containing Cas1 and Cas2 was omitted from the vector (see fig. 1A).

Plasmids were constructed comprising an operon having nucleotide sequences encoding a type I Cas3 and a Cascade protein under the control of a constitutive promoter. Clostridium difficile IB-type Cas3 and Cascade were used. The adapter module containing Cas1, cas2 and Cas4 is omitted from the vector (see fig. 1B). A homologous CRISPR array comprising clostridium difficile repeats and spacers for targeting the chromosome of an e.coli host cell under the control of a constitutive promoter was cloned in a second vector (see figure 1B).

CGV encoding clostridium difficile IB-type Cas3 and Cascade were transformed into e.coli MG1655. Subsequently, vectors encoding clostridium difficile arrays and CGV encoding the e.coli IE-type CRISPR-Cas system were transformed into cells. The CFU assay is shown in figure 2. In fig. 2, CRISPR killing of the target strain escherichia coli MG1655 by a combination of clostridium difficile CRISPR-Cas system and escherichia coli CRISPR-Cas system is shown. When the two systems were combined, essentially 100% killing of the population was achieved (7-log reduction in viable cells of E.coli MG1655 ₁₀ A little more). However, transformation of only the E.coli CRISPR-Cas system resulted in about a 4-log reduction in bacterial populations ₁₀ And transformation of the C.difficile array resulted in a 3-log reduction ₁₀ Less than that. These results indicate that the e.coli CRISPR-Cas system and clostridium difficile CRISPR-Cas system are compatible and their combination greatly synergistically improves the killing efficiency of the target strain, impeding the growth of the escaped bacteria.

Materials and methods

Escherichia coli MG1655 was grown in a Lysogen (LB) with shaking (250 rpm) at 37 ℃. When necessary, the cultures were supplemented with tetracycline (10. Mu.g/mL), kanamycin (50. Mu.g/mL) and spectinomycin (100. Mu.g/mL).

To construct a plasmid containing the E.coli CRISPR-Cas system under a constitutive promoter, E.coli-derived plasmids were usedcas3、cas8e、cas11、cas7、cas5Andcas6the gene was amplified and cloned in ColE 1-type plasmid pZE21 (Lutz and Bujard, 1997).Nucleic Acids Research25, 1203-1210) under the control of a promoter. cas3 is located at the beginning of the operon, followed bycas8e、cas11、cas7、cas5 andcas6. The adaptation module is omitted in the carrier (bycas1Andcas2composition). In addition, a 3-spacer array targeting 3 chromosomal intergenic regions in E.coli MG1655 under the control of a promoter is included in the CGV. It contains 32 nucleotides/target site (TGATTGACGGCATCGGTAAACCGGCAAACGTTC; GCTGTTAACGTACGTACCGCCGCATCCGGC; and CGGACTTAGTGCCAAAACATG) from the genome of Escherichia coli MG1655GCATCGAAATT) separated by 29 bp direct repeats (each repeat is gagttccccgcgccagggggataaaccg). In addition, a 3' -AAG Protospacer Adjacent Motif (PAM) is located near a selected target sequence in the genome of e.coli MG1655 (fig. 1A).

The clostridium difficile CRISPR-Cas system was constructed in a two plasmid system. To construct a plasmid containing the cas gene of Clostridium difficile, a plasmid derived from Clostridium difficilecas3、cas6、cas8b、cas7Andcas5the gene was amplified and cloned in the pSC101 backbone, under the control of a promoter.cas3At the beginning of the operator, followed bycas6、cas8b、cas7Andcas5. The adaptation module is omitted in the carrier (bycas1、cas2Andcas4composition) (fig. 1B). A second plasmid containing an array of 5-spacers was cloned in the CloDF13 ori backbone, under the control of promoter J23100. It contains 37 nucleotides/target sites from the genome of E.coli MG1655 (GCCATAACTGTGATCAGGAAGTCTTCCTTATCCATAT; GGCTTTACGCCAGCGAGGTATGCCAGGAATAACT; GGGGGGATAGCGCCTGAGCGATAGACTTTG; GGCATTTACCGAGCCCAGCATCAGTACAGCAAAC; and TCCTGAATCAATCCGCCCTCGTGGCAGGCCATCCCGG), separated by 29 bp direct repeats (each repeat is GTTTTATATTAACTAAGTGGTATGTAAAT). In addition, a 3' -CCT Protospacer Adjacent Motif (PAM) is located near a selected target sequence in the genome of e.coli MG1655 (fig. 1B).

For the killing assay, C.difficile-carrying bacteria were electroporatedcas3And the cascade gene into E.coli MG1655. Transformants were grown to mid-log phase in liquid LB with antibiotics and further electroporated with plasmids carrying clostridium difficile arrays and plasmids with the e. Controls with empty vector and each CGV were performed separately. Killing efficiency was determined by plating the transformants onto LB with antibiotics. Viability was calculated by counting Colony Forming Units (CFU) on the plate and data was calculated as viable cell concentration (CFU/ml).

Table 2: example Cas

C1 can be a Cas selected from the following types (e.g., cas3 or Cascade Cas). Additionally or alternatively, C2 may be a Cas selected from the following types (e.g., cas3 or a Cascade Cas). The Cascade Cas may be selected from the following types.

Bacteria/bacteriophages	CRISPR-Cas type
		Clostridium botulinum	I-B type
Clostridium tetani	I-B type
		Eggerthella lenta	I-C type
Moraxella bovis	I-C type
		Streptococcus mutans	I-C type
Streptococcus mutans	I-C type
		Streptococcus pyogenes	I-C type
Salt-tolerant bacillus	I-C type
		Inhibition of Prevotella	I-C type
Bacteroides fragilis	I-C type
		Pseudomonas aeruginosa	I-C type
Nostoc sp. CENA543	I-D type
		Escherichia coli	I-E type
Vibrio cholerae	I-E type
		Citrobacter freundii	I-E type
Salmonella enterica	I-E type
		Klebsiella pneumoniae	I-E type
Streptococcus mutans	I-E type
		Pseudomonas aeruginosa	Form I-F
Yersinia pestis	Form I-F
		Serratia marcescens	Form I-F
Geobacillus thioreductase (Bdelbrueckii)	I-U type
		Rare marine actinomyces	I-U type
Vibrio phage ICP1	Form I-F

Table 3: example Cas, type and Category

Sequence listing

<110> SNIPR BIOME APS.

<120> multiplex CRISPR/CAS system for modifying cellular genome

<130> SNB0007-1 WO

<150> GB2007943.0

<151> 27.05.2020

<160> 11

<210> 1

<211> 29

<212> DNA

<213> of bacteria

<400> 1

gagttccccg cgccagcggg gataaaccg 29

<210> 2

<211> 29

<212> DNA

<213> of bacteria

<400> 2

gttttatatt aactaagtgg tatgtaaat 29

<210> 3

<211> 32

<212> DNA

<213> of bacteria

<400> 3

tgattgacgg ctacggtaaa ccggcaacgt tc 32

<210> 4

<211> 32

<212> DNA

<213> of bacteria

<400> 4

gctgttaacg tacgtaccgc gccgcatccg gc 32

<210> 5

<211> 12

<212> DNA

<213> of bacteria

<400> 5

aaagaggaga aa 12

<210> 6

<211> 32

<212> DNA

<213> of bacteria

<400> 6

cggacttagt gccaaaacat ggcatcgaaa tt 32

<210> 7

<211> 37

<212> DNA

<213> of bacteria

<400> 7

gccataatct ggatcaggaa gtcttcctta tccatat 37

<210> 8

<211> 37

<212> DNA

<213> of bacteria

<400> 8

ggctttacgc cagcgacgta ttgccacagg aataact 37

<210> 9

<211> 37

<212> DNA

<213> of bacteria

<400> 9

ggggatagcg cgcctggagc gtgcgataga gactttg 37

<210> 10

<211> 37

<212> DNA

<213> of bacteria

<400> 10

ggcatttacc gaccagccca tcagcagtac agcaaac 37

<210> 11

<211> 37

<212> DNA

<213> of bacteria

<400> 11

tcctgaatca aatccgcctg tggcaggcca tagcccg 37

Claims

1. A method of modifying the genome of one or more cells, the method comprising introducing into each cell:

(a) A first and a second crRNA;

wherein for each cell

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is

2. The method of claim 1, wherein

(a) C1 is a class 1 Cas, and C2 is a class 1 Cas;

(b) C1 is a class 1 Cas and C2 is a class 2 Cas;

(c) C1 is a class 2 Cas and C2 is a class 2 Cas;

(d) C1 is a type I Cas (optionally type I-a, B, C, D, E, F or U), and C2 is a type I Cas (optionally type I-a, B, C, D, E, F or U);

(i) C1 is a type I or II Cas, and C2 is a type VI Cas.

3. The method of any preceding claim, wherein

(a) C1 is an IB or C-type Cas and C2 is an I-E or F-type Cas (optionally C1 is an IB-type Cas3 and C2 is an IE-type Cas);

(b) C1 is IC or C-type Cas and C2 is I-E or F-type Cas (optionally C1 is IC-type Cas3 and C2 is IE-type Cas 3); or

(c) C1 is a type II Cas9 and C2 is a type I Cas3 (optionally C2 is E.coli IE or a type F Cas3; or C.difficile Cas IB).

4. The method of any preceding claim, wherein

(d) C1 is Cas9 and C2 is Cas10 (optionally Cas 10A, B, C or D subtypes);

(e) C1 is Cas9 and C2 is Cas12 (optionally Cas12 a);

(h) C1 is Cas3 (optionally I-a, B, C, D, E, F, or U-type Cas 3) and C2 is Cas13 (optionally Cas13a, cas13B, cas13C, or Cas 13D).

5. The method of any preceding claim, wherein PS1 and PS2 are protospacers consisting of

(a) RNA and RNA, respectively;

(b) DNA and RNA, respectively;

(c) RNA and DNA, respectively; or

(d) DNA and DNA, respectively.

6. The method of any preceding claim, wherein C1 is clostridiaceae Cas3 (optionally clostridium difficile Cas3, such as I-B type Cas 3) and C2 is enterobacteriaceae Cas3 (optionally escherichia coli Cas3, such as I-E type Cas 3).

7. The method of any preceding claim, wherein C1 is spCas9 or saCas9 and C2 is type I Cas3 (optionally C2 is E.

8. The method of any preceding claim, wherein PS1 and PS2 are subjected to Cas modification by C1 and C2.

9. The method of any preceding claim, wherein the modification is cleavage of the genome.

10. The method of any preceding claim, wherein PS1 is a chromosomal sequence of a cell.

11. The method of any preceding claim, wherein PS2 is a chromosomal sequence of the cell.

12. The method of any preceding claim, wherein each cell is a bacterial or archaeal cell, optionally an E.

13. The method of any preceding claim, wherein the step of introducing comprises infecting the cells with a virus (optionally a bacteriophage, wherein the cells are bacterial cells) or introducing a plasmid (optionally a conjugative plasmid) or introducing a phagemid into the cells, wherein the virus, plasmid or phagemid encodes the crRNA.

14. The method of claim 13, wherein said virus, plasmid or phagemid encodes C1 and/or C2.

15. The method of claim 13, wherein the virus, plasmid or phagemid encodes one of the C1 and C2 and the other Cas is an endogenous Cas encoded by the genome of the cell.

16. The method of claim 13, wherein each of C1 and C2 is an endogenous Cas encoded by the genome of the cell.

17. The method of any preceding claim, when dependent on claim 1 (b) or (c), wherein each crRNA is expressed under the control of a constitutive promoter.

18. The method of any preceding claim, wherein each Cas is expressed under the control of a constitutive promoter.

19. The method of any preceding claim, when dependent on claim 1 (b) or (c), wherein each crRNA is expressed under the control of a strong promoter.

20. The method of any preceding claim, wherein a first plurality of different crrnas is expressed in one or more of the cells, wherein each crRNA is operable with CS1 and the plurality targets at least 2 different protospacers comprised by the genome of the cell; and/or a second plurality of different crrnas are expressed in one or more of the cells, wherein each crRNA is operable with CS2 and the second plurality targets at least 2 different protospacers comprised by the genome of the cell.

21. The method of any preceding claim, wherein one or more cells are killed by the method.

22. The method of any preceding claim, wherein the first crRNA is comprised by a guide RNA, wherein the guide RNA further comprises a tracrRNA, and/or the second crRNA is comprised by a guide RNA, wherein the guide RNA further comprises a tracrRNA.

23. A method of killing a plurality of cells (optionally prokaryotic cells) of a first species or strain, the method comprising using the cells to perform the method of any preceding claim, wherein C1 and/or C2 is a Cas nuclease and the genome of the cell is cleaved by Cas nuclease cleavage and the cell is killed.

24. The method of claim 23, which reduces the number of cells in said plurality by at least 10 ⁵ And (4) doubling.

25. The method of claim 23, which kills at least 99.999% of the cells in the plurality.

26. The method of any one of claims 23 to 25, wherein the species is escherichia coli or clostridium difficile.

27. A method of editing the genome of one or more cells, the method comprising

(a) Modifying the genome of each cell by performing the method of any one of claims 1 to 22, wherein the genome is subject to Cas cleavage; and

28. The method of claim 27, further comprising

(a) Culturing the modified cell to produce progeny thereof; and optionally isolating the progeny cells; or

29. The method of claim 28, wherein the progeny cell or cell line expresses a protein, wherein the protein is encoded by a nucleotide sequence comprising the inserted nucleic acid sequence, the method further comprising obtaining the expressed protein or isolating the expressed protein from the cell or cell line.

30. The method of claim 28 or 29, further comprising combining the progeny cells, cell lines, or proteins with a pharmaceutically acceptable carrier, diluent, or excipient, thereby producing a pharmaceutical composition.

31. A method of treating or preventing a disease or condition in a human or animal subject, the method comprising (i) administering to the subject a pharmaceutical composition obtained by claim 30, wherein the composition comprises the protein, wherein the protein mediates treatment or prevention of the disease or condition; or (ii) administering to the subject the pharmaceutical composition obtained by claim 30, wherein when the composition comprises the progeny cell or cell line, the cell or cell line expresses a protein or RNA in the subject, wherein the protein or RNA mediates treatment or prevention of the disease or condition.

32. The method of claim 29, 30 or 31, wherein the protein is an antibiotic, antibacterial agent, enzyme, growth factor, antibody or fragment thereof, hormone, blood component, cytokine, immune checkpoint modulator (e.g., inhibitor), analgesic, neurotransmitter, anti-inflammatory agent, or anti-neoplastic agent.

33. The method of any one of claims 23 to 26, wherein a plurality of cells are comprised by the microbiome sample and a modified cell sample is produced in which cells of the first species or strain have been killed, the method further comprising combining the modified sample with a pharmaceutically acceptable carrier, diluent or excipient, thereby producing the pharmaceutical composition comprising the cell graft.

34. A method of treating or preventing a disease or condition in a human or animal subject, the method comprising administering to the subject a pharmaceutical composition obtained by claim 33.

35. The method of any one of claims 23 to 26, wherein the plurality of cells are comprised by an environmental sample (e.g., an aqueous, water, oil, petroleum, soil, or fluid sample).

36. A composition for use in a method of treatment or prevention of a disease or condition mediated by a target cell in a human or animal subject, the composition comprising component (a), (b) or (d):

(a) A first and a second crRNA;

wherein

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is provided with

37. The composition of claim 36, wherein the treating or preventing comprises subjecting the cell to the method of any one of claims 1 to 35.

38. The composition of claim 36 or 37, wherein the method is for reducing infection of a subject by a target cell (optionally, wherein the target cell is a pathogenic cell).

39. A composition comprising component (a), (b) or (d):

(a) A first and a second crRNA;

wherein

(g) C1 and C2 are different;

(h) PS1 and PS2 are different; and is

40. The composition of any one of claims 36 to 39, wherein the genome of each cell is edited or the cells are killed.

41. The composition of any one of claims 36 to 40, wherein each cell is a prokaryotic cell (optionally a bacterial or archaeal cell).

42. The composition-of-matter or method of any preceding claim, wherein said nucleic acid is comprised by a virus, a bacteriophage, a plasmid (optionally a conjugative plasmid), a nanoparticle or a phagemid.

43. The composition-of-matter or method of any preceding claim, wherein said nucleic acid encodes C1 and/or C2.

44. The composition or method of any preceding claim, wherein C1 is a type I Cas and the nucleic acid encodes one or more Cascade Cas operable with C1 and/or wherein C2 is a type I Cas and the nucleic acid encodes one or more Cascade Cas operable with C2.

45. A pharmaceutical composition according to any one of claims 36 to 43, wherein the composition comprises a pharmaceutically acceptable excipient, diluent or carrier.

46. The composition of any one of claims 36 to 45, wherein the composition is comprised by a sterile drug administration device, optionally a syringe, an IV bag, an intranasal delivery device, an inhaler, a nebulizer, or a rectal administration device).

47. The composition-of-matter or method of any preceding claim, wherein said cells are comprised by the gut, lung, kidney, urethra, bladder, blood, vagina or skin microbiome of the subject.

48. The composition or method of any preceding claim, wherein the method is carried out on a human or animal subject, wherein the cells are killed by the method and the killing up-regulates or down-regulates immune cells in the subject (optionally (i) up-regulates CD 8) ⁺ 、CD4 ⁺ TH1, TH2, TH17, T regulatory or T effector cells; or (ii) downregulation of CD8 ⁺ 、CD4 ⁺ TH1, TH2, TH17, T regulatory or T effector cells), thereby treating or preventing a disease or condition in a subject.

49. The composition or method of any preceding claim, wherein the method comprises introducing or expressing at least 3 different types of crRNA into each cell, wherein the different types target different protospacer sequences comprised by the genome of the cell; and optionally wherein C1 and C2 are Cas-type 1 nucleases.

50. The composition or method of any preceding claim, wherein the method comprises introducing into each cell a nucleic acid encoding Cas3, cas8e, cas11, cas7, cas5 and Cas6 and/or a nucleic acid encoding Cas3, cas6, cas8b, cas7 and Cas 5.

51. A method of modifying the genome of a cell, the method comprising

52. The method of claim 51, wherein the method is according to any one of claims 1 to 35.

53. The following method

(a) Generating a coordinated Cas nuclease cleavage of the cell genome;

(e) Reducing bacterial cells (e.g., E.coli cells) of a first species or strain in a cell population by at least 10 ⁵ 、10 ⁶ Or 10 ⁷ Wherein the populations each comprise at least 100,000;1,000,000; or 10,000,000 cells;

wherein the method is according to any one of claims 1 to 35, 51 and 52.