CN115478059A - Ketoreductase mutant and application thereof - Google Patents
Ketoreductase mutant and application thereof Download PDFInfo
- Publication number
- CN115478059A CN115478059A CN202110599394.7A CN202110599394A CN115478059A CN 115478059 A CN115478059 A CN 115478059A CN 202110599394 A CN202110599394 A CN 202110599394A CN 115478059 A CN115478059 A CN 115478059A
- Authority
- CN
- China
- Prior art keywords
- gly
- ala
- val
- thr
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a ketoreductase mutant, which can convert 3,4-dihydroxy-2 '-chloroacetophenone into (R) -3,4-dihydroxy-2' -chlorophenethanol so as to prepare noradrenaline and adrenaline. The ketoreductase mutant has the advantages that the concentration of a conversion substrate is up to 120g/L, the conversion rate is up to more than 95.5%, and the ee value is more than 99%, so that the preparation cost of adrenaline and noradrenaline is greatly reduced, and meanwhile, the green production is realized.
Description
The technical field is as follows:
the invention belongs to the technical field of biocatalysis, and particularly relates to a ketoreductase mutant which can be used for preparing noradrenaline and an intermediate (R) -3,4-dihydroxy-2' -chlorophenethanol of adrenaline.
Background art:
norepinephrine (INN name: norepinephrine, also known as Noradrenaline, abbreviated NE or NA), old called "Noradrenaline", chemical name (R) -4- (2-amino-1-hydroxyethyl) -1,2-benzenediol, is a substance formed by adrenaline after removal of the N-methyl group, and also belongs to catecholamine in chemical structure. Norepinephrine is an anti-shock vasoactive drug, and is mainly used for rescuing shock caused by acute hypotension and peripheral vasodilation, and the like.
Patent CN111019981a discloses the use of dehydroreductase to catalyze noradrenaline to obtain noradrenaline (shown in Scheme 1). However, corresponding gene information and chiral values of converted products are not published, and the concentration of conversion substrates is only 25g/L.
Adrenalin can be used for treating cardiac arrest, bronchial asthma, anaphylactic shock, urticaria, hay fever, nasal mucosa or gingival hemorrhage, etc.
Patent CN101906457B discloses that alcohol dehydrogenase is used for catalyzing adrenalin ketone to synthesize adrenalin, but the concentration of a catalytic substrate is only 21g/L, so that the industrial application is difficult.
In order to realize the efficient catalytic synthesis of chiral epinephrine and norepinephrine intermediates by the enzyme method, 3,4-dihydroxy-2 '-chloroacetophenone is selected as a substrate, and (R) -3,4-dihydroxy-2' -chlorophenylethanol is generated under the action of ketoreductase, so that norepinephrine and epinephrine can be prepared.
The literature Tetrahedron: asymmetry,2007,18,1799-1803 discloses an alcohol dehydrogenase YMR226c which can convert 3,4-dihydroxy-2 '-chloroacetophenone into (R) -3,4-dihydroxy-2' -chlorophenethanol, but the ee value is only 97%, and the conversion substrate concentration is only 2.37g/L.
Therefore, the existing ketoreductase needs to be modified, the concentration, the conversion rate, the ee value and the like of the catalytic substrate are improved, and the preparation cost of noradrenaline and adrenaline is greatly reduced.
The invention content is as follows:
the present invention aims to provide a novel ketoreductase mutant against the disadvantages of the prior art.
On one hand, the ketoreductase derived from Lactobacillus kefir is transformed by using a protein engineering technology to obtain 3 ketoreductase mutants A, B and C with high catalytic efficiency.
Further, the amino acid sequences of ketoreductase mutant A, B and C are shown as SEQ ID No.3, 5 and 7, respectively.
Furthermore, the ketoreductase mutant A is obtained by mutating partial sites on the basis of wild type sequences, and specifically comprises the following steps: val at the 64 th site, ile at the 76 th site, gly at the 88 th site, met at the 95 th site, ile at the 96 th site, leu at the 99 th site, gly at the 100 th site, ala at the 117 th site, ser at the 143 th site, ala at the 145 th site, ile at the 147 th site, met at the 153 th site, tyr at the 156 th site, thr at the 159 th site, lys at the 160 th site, ala at the 190 th site, ala at the 197 th site, pro at the 200 th site, phe at the 202 th site, and Cys at the 206 th site.
Furthermore, the ketoreductase mutant B is obtained by carrying out substitution and deletion on the basis of the sequence of the ketoreductase mutant A.
Furthermore, the ketoreductase mutant C is obtained by knocking out multiple Loop on the basis of the ketoreductase mutant B.
Further, the ketoreductase mutant is derived from wild-type Lactobacillus kefir, and the accession number of the wild-type template NCBI is 4RF2_A.
Further, the ketoreductase mutant is constructed in vitro on a recombinant expression vector, preferably a PET series vector.
Further, the host cell of the ketoreductase mutant is Escherichia coli, and the cell is BL21 (DE 3), PLysS or Origami B (DE 3).
Furthermore, after the expression of the host cell under the IPTG induction, the proteins of the three mutants can be obtained, and in order to improve the utilization rate of the ketoreductase mutant, the fermented whole cell can be directly used for carrying out late-stage substrate catalysis.
On the other hand, the ketoreductase mutant provided by the invention can convert 3,4-dihydroxy-2 '-chloroacetophenone into (R) -3,4-dihydroxy-2' -chlorophenethanol, and the adopted technical scheme is as follows:
furthermore, the concentration of 3,4-dihydroxy-2' -chloroacetophenone can reach 120g/L.
Further, the ketoreductase mutant is ketoreductase enzyme powder or a whole cell or cell disruption solution containing the ketoreductase, preferably a ketoreductase whole cell.
Further, the reaction requires the addition of a coenzyme system, preferably NADPH.
Further, the reaction utilizes the reverse reaction of the ketoreductase mutant, and takes isopropanol as a substrate to realize the regeneration of coenzyme NADPH.
Furthermore, the concentration of the isopropanol in the reaction is controlled between 20% and 40%.
Further, the reaction temperature of the reaction is controlled to be 25 to 45 ℃, preferably 37 ℃.
Further, the pH of the reaction is controlled to be between 5.0 and 7.5, preferably 6.0.
The invention has the beneficial effects that the invention provides a novel ketoreductase mutant, the concentration of a conversion substrate is as high as 120g/L, the conversion rate is more than 95.5%, and the chiral ee value is more than 99%.
The preparation cost of the adrenaline and the noradrenaline is greatly reduced, and the green production is realized.
Detailed Description
The technical content of the present invention is further described below with reference to specific examples for better understanding of the content of the present invention, but the scope of the present invention is not limited thereto.
EXAMPLE 1 construction of ketoreductase
A ketoreductase wild type gene sequence derived from Lactobacillus kefiri is obtained from an NCBI website, two upstream and downstream primers are designed by using Primer design software Primer 5, and the two upstream and downstream primers respectively contain restriction enzyme NdeI and XhoI cutting sites, and specific Primer information is shown in Table 1.
TABLE 1 primer sequences for PCR amplification
| Primer name | Primer sequence (5 '→ 3') |
| NdeI-upstream primer | TACGGCTAGCATGACTGATCGTTTAAAAGG |
| XhoI-downstream primer | CATGCTCGAGTTATTGAGCAGTGTATCCACC |
According to the PCR amplification principle, the target gene is synthesized by a PCR instrument in the presence of upstream and downstream primers by utilizing the amplification capability of PrimeSTAR HS DNA Polymerase. The specific PCR system and amplification conditions are shown in Table 2 and Table 3, and 1% agarose gel analysis after about 2h amplification shows that the gene size is correct.
TABLE 2 reaction System for PCR
| Component (A) | Amount of the composition |
| 5 X buffer | 10ul |
| d NTP(2.5mM) | 2ul |
| Upstream primer (10 pmol/ul) | 1ul |
| Downstream primer (10 pmol/ul) | 1ul |
| KRED gene | 50ng |
| PrimeSTAR HS DNA Polymerase | 1ul |
| ddH 2 O | Add to 50ul |
TABLE 3 PCR amplification conditions
EXAMPLE 2 recombinant expression of ketoreductase
The constructed recombinant plasmid pET21a-lkKRED is transformed into DH5 alpha competent cells by a chemical transformation method, and then Amp is contained + Resistant LB plates were grown in 37 ℃ overnight inversion. Selecting positive monoclone to carry out gene sequencing, after the sequence is determined to be correct, transferring the recombinant expression vector into escherichia coli BL21 (DE 3) competent cells, and extracting the monoclone cells to obtain the arthrobacter transaminase gene engineering strain capable of inducing expression.
Inoculating BL21 (DE 3) cells containing a target gene to Amp-containing cells ++ The mixture was cultured overnight at 37 ℃ in a resistant LB tube to obtain a primary seed culture. Inoculating the seed culture solution into 2YT liquid culture medium containing resistance according to the inoculation ratio of 1%, placing the culture medium in a shaking table, culturing at 37 ℃ and 200rpm for 3-5 h, cooling to 20 ℃ when OD reaches 0.6-0.8, adding IPTG (isopropyl-beta-D-thiogalactoside), controlling the concentration to be 0.5mM, and performing overnight inductionAnd (4) expressing. The fermentation broth was centrifuged to collect cells, the collected cells were dissolved in 20mM Tris-HCl buffer (pH 7.5), and the cells were disrupted by sonication. And then centrifuging at 12000rpm for 10min again to obtain supernatant which is the transaminase protein, wherein the protein is in soluble expression.
Example 3 preparation of (R) -3,4-dihydroxy-2' -chlorophenethanol
Adding 0.2g of 3, 4-dihydroxy-2' -chloroacetophenone into a 50mL reaction bottle, dissolving with 4mL of isopropanol, adding 2mg of NADP, adding 16mL of water, adjusting the pH to 7.0 with 0.1M NaOH solution, finally adding 1g of cells (wild-type ketoreductase), stirring and reacting in a water bath at 37 ℃ for 24 hours, adding acetonitrile to terminate the reaction, carrying out rotary evaporation at 40 ℃, and concentrating to obtain the target product, wherein the conversion rate is 65% and the ee value is 45%.
Example 4 preparation of (R) -3,4-dihydroxy-2' -chlorophenethanol
To a 50mL reaction flask was added 0.4g of 3, 4-dihydroxy-2' -chloroacetophenone, dissolved in 5mL of isopropanol, 2mg of NADP coenzyme was added, 16mL of water was added, pH was adjusted to 7.0 with 0.1M NaOH solution, and finally 1g of mutant A cells (containing ketoreductase mutant A) were added, and the reaction was stirred in a water bath at 37 ℃ and pH was controlled to 6.0 with 0.1M NaOH solution during the reaction. After 24 hours of reaction, acetonitrile is added to stop the reaction, rotary evaporation is carried out at 40 ℃, and the target product is obtained by concentration, wherein the conversion rate is 85%, and the ee value is 99.2%.
Example 5 preparation of (R) -3,4-dihydroxy-2' -chlorophenethanol
To a 50mL reaction flask was added 1g of 3, 4-dihydroxy-2' -chloroacetophenone, dissolved in 6mL of isopropanol, 2mg of NADPH was added, 14mL of water was added, the pH was adjusted to 7.0 with 0.1M NaOH solution, and finally 0.8g of ketoreductase mutant B enzyme powder was added, and the mixture was stirred in a water bath at 37 ℃ for reaction for 24 hours. After the reaction is finished, adding acetonitrile for assisting dissolution, carrying out rotary evaporation at 40 ℃, and concentrating to obtain a target product, wherein the conversion rate is 95%, and the ee value is 99.3%.
Example 6 preparation of (R) -3,4-dihydroxy-2' -chlorophenethanol
2.4g of 3, 4-dihydroxy-2' -chloroacetophenone was added to a 50mL reaction flask, dissolved in 8mL of isopropanol, 2mg of NADPH was added, 12mL of water was added, the pH was adjusted to 7.0 with 0.1M NaOH solution, and finally 0.4g of mutant C cells (containing ketoreductase mutant C) were added and reacted in a 37 ℃ water bath with stirring for 24 hours, and acetonitrile was added to terminate the reaction, followed by rotary evaporation at 40 ℃ and concentration to obtain the desired product with a conversion of 95.5% and an ee value of 99.3%.
EXAMPLE 7 preparation of noradrenaline
Taking 180mg of (R) -1- (3,4-dihydroxyphenyl) -2-chloro-ethanol obtained in example 6 to dissolve in 50mL of dimethyl sulfoxide, adding 80mg of urotropine, reacting at 70 ℃ for 18h, then cooling to 25 ℃, adding 5mL of ethanol, stirring for 30min, separating out a solid, directly adding 19mL of concentrated hydrochloric acid, stirring at room temperature for 10h, dropwise adding an ammonia water solution to adjust the pH value to 8, carrying out suction filtration, washing a filter cake with water, and washing with ethanol to obtain 45mg of norepinephrine.
EXAMPLE 8 preparation of epinephrine
20mg of noradrenaline and 60mg of S-adenosyl-methionine in the example 7 were taken, the pH of the system was adjusted to 5 by PBS buffer solution, 10g/L of crude PNMT enzyme solution was added, and the reaction was carried out at 50 ℃ for 12 hours to obtain adrenaline, the conversion rate of which was 96% by HPLC.
Sequence listing
<110> Shang Ke biopharmaceutical (Shanghai) Co., ltd
<120> ketoreductase mutant and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 252
<212> PRT
<213> Lactobacillus kefiri
<400> 1
Met Thr Asp Arg Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly Thr
1 5 10 15
Leu Gly Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala
20 25 30
Lys Val Val Ile Thr Gly Arg His Ala Asp Val Gly Glu Lys Ala Ala
35 40 45
Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln His Asp Ala
50 55 60
Ser Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Thr Thr Glu Glu Ala
65 70 75 80
Phe Gly Pro Val Thr Thr Val Val Asn Asn Ala Gly Ile Ala Val Ser
85 90 95
Lys Ser Val Glu Asp Thr Thr Thr Glu Glu Trp Arg Lys Leu Leu Ser
100 105 110
Val Asn Leu Asp Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg
115 120 125
Met Lys Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Met Ser Ser Ile
130 135 140
Glu Gly Phe Val Gly Asp Pro Thr Leu Gly Ala Tyr Asn Ala Ser Lys
145 150 155 160
Gly Ala Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu
165 170 175
Lys Asp Tyr Asp Val Arg Val Asn Thr Val His Pro Gly Tyr Ile Lys
180 185 190
Thr Pro Leu Val Asp Asp Leu Glu Gly Ala Glu Glu Met Met Ser Gln
195 200 205
Arg Thr Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala
210 215 220
Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly
225 230 235 240
Ala Glu Phe Val Val Asp Gly Gly Tyr Thr Ala Gln
245 250
<210> 2
<211> 759
<212> DNA/RNA
<213> Lactobacillus kefiri
<400> 2
atgactgatc gtttaaaagg caaagtagca attgtaactg gcggtacctt gggaattggc 60
ttggcaatcg ctgataagtt tgttgaagaa ggcgcaaagg ttgttattac cggccgtcac 120
gctgatgtag gtgaaaaagc tgccaaatca atcggcggca cagacgttat ccgttttgtc 180
caacacgatg cttctgatga agccggctgg actaagttgt ttgatacgac tgaagaagca 240
tttggcccag ttaccacggt tgtcaacaat gccggaattg cggtcagcaa gagtgttgaa 300
gataccacaa ctgaagaatg gcgcaagctg ctctcagtta acttggatgg tgtcttcttc 360
ggtacccgtc ttggaatcca acgtatgaag aataaaggac tcggagcatc aatcatcaat 420
atgtcatcta tcgaaggttt tgttggtgat ccaactctgg gtgcatacaa cgcttcaaaa 480
ggtgctgtca gaattatgtc taaatcagct gccttggatt gcgctttgaa ggactacgat 540
gttcgggtta acactgttca tccaggttat atcaagacac cattggttga cgatcttgaa 600
ggggcagaag aaatgatgtc acagcggacc aagacaccaa tgggtcatat cggtgaacct 660
aacgatatcg cttggatctg tgtttacctg gcatctgacg aatctaaatt tgccactggt 720
gcagaattcg ttgtcgatgg tggatacact gctcaataa 759
<210> 3
<211> 252
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Thr Asp Arg Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly Thr
1 5 10 15
Leu Gly Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala
20 25 30
Lys Val Val Ile Thr Gly Arg His Ala Asp Val Gly Glu Lys Ala Ala
35 40 45
Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln His Asp Val
50 55 60
Ser Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Ile Thr Glu Glu Ala
65 70 75 80
Phe Gly Pro Val Thr Thr Val Gly Asn Asn Ala Gly Ile Ala Met Ile
85 90 95
Lys Ser Leu Gly Asp Thr Thr Thr Glu Glu Trp Arg Lys Leu Leu Ser
100 105 110
Val Asn Leu Asp Ala Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg
115 120 125
Met Lys Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Met Ser Ser Ile
130 135 140
Ala Gly Ile Val Gly Asp Pro Thr Met Gly Ala Tyr Asn Ala Thr Lys
145 150 155 160
Gly Ala Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu
165 170 175
Lys Asp Tyr Asp Val Arg Val Asn Thr Val His Pro Gly Ala Ile Lys
180 185 190
Thr Pro Leu Val Ala Asp Leu Pro Gly Phe Glu Glu Met Cys Ser Gln
195 200 205
Arg Thr Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala
210 215 220
Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly
225 230 235 240
Ala Glu Phe Val Val Asp Gly Gly Tyr Thr Ala Gln
245 250
<210> 4
<211> 759
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atgactgatc gtttaaaagg caaagtagca attgtaactg gcggtacctt gggaattggc 60
ttggcaatcg ctgataagtt tgttgaagaa ggcgcaaagg ttgttattac cggccgtcac 120
gctgatgtag gtgaaaaagc tgccaaatca atcggcggca cagacgttat ccgttttgtc 180
caacacgatg tctctgatga agccggctgg actaagttgt ttgatattac tgaagaagca 240
tttggcccag ttaccacggt tggcaacaat gccggaattg cgatgattaa gagtctcgga 300
gataccacaa ctgaagaatg gcgcaagctg ctctcagtta acttggatgc tgtcttcttc 360
ggtacccgtc ttggaatcca acgtatgaag aataaaggac tcggagcatc aatcatcaat 420
atgtcatcta tcgcaggtat cgttggtgat ccaactatgg gtgcatacaa cgctactaaa 480
ggtgctgtca gaattatgtc taaatcagct gccttggatt gcgctttgaa ggactacgat 540
gttcgggtta acactgttca tccaggtgct atcaagacac cattggttgc agatcttcca 600
gggtttgaag aaatgtgctc acagcggacc aagacaccaa tgggtcatat cggtgaacct 660
aacgatatcg cttggatctg tgtttacctg gcatctgacg aatctaaatt tgccactggt 720
gcagaattcg ttgtcgatgg tggatacact gctcaataa 759
<210> 5
<211> 249
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Thr Asp Arg Leu Lys Gly Lys Val Ala Leu Val Thr Gly Gly Thr
1 5 10 15
Leu Ala Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala
20 25 30
Lys Val Val Ile Cys Phe Arg His Ala Asp Val Gly Glu Lys Ala Ala
35 40 45
Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln Tyr Asp Gly
50 55 60
Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Ile Thr Glu Glu Ala Phe
65 70 75 80
Gly Pro Val Thr Thr Val Val Asn Glu Phe Ala Ile Ala Met Leu Lys
85 90 95
Ser Leu Gly Asp Thr Thr Glu Glu Trp Arg Lys Leu Leu Met Val Asn
100 105 110
Leu Asp Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg Met Lys
115 120 125
Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Gly Ser Ser Ile Ala Gly
130 135 140
Ile Ile Gly Asp Pro Thr Met Gly Ala Tyr Asn Ala Thr Lys Gly Ala
145 150 155 160
Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu Lys Asp
165 170 175
Tyr Asp Val Arg Val Asn Thr Val His Thr Ala Gly Leu Lys Thr Gly
180 185 190
Leu Ile Ala Asp Leu Pro Gly Phe Glu Glu Met Cys Ser Gln Arg Thr
195 200 205
Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala Trp Ile
210 215 220
Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly Ala Glu
225 230 235 240
Phe Val Val Gly Gly Phe Thr Ala Gln
245
<210> 6
<211> 750
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atgactgatc gtttaaaagg caaagtagca ttggtaactg gcggtacctt ggcaattggc 60
ttggcaatcg ctgataagtt tgttgaagaa ggcgcaaagg ttgttatttg ctttcgtcac 120
gctgatgtag gtgaaaaagc tgccaaatca atcggcggca cagacgttat ccgttttgtc 180
caatacgatg gtgatgaagc cggctggact aagttgtttg atattactga agaagcattt 240
ggcccagtta ccacggttgt caacgaattt gcaattgcga tgctcaagag tctcggagat 300
accactgaag aatggcgcaa gctgctcatg gttaacttgg atggtgtctt cttcggtacc 360
cgtcttggaa tccaacgtat gaagaataaa ggactcggag catcaatcat caatggatca 420
tctatcgcag gtatcatcgg tgatccaact atgggtgcat acaacgctac taaaggtgct 480
gtcagaatta tgtctaaatc agctgccttg gattgcgctt tgaaggacta cgatgttcgg 540
gttaacactg ttcatacagc tggtttgaag acaggattga ttgcagatct tccagggttt 600
gaagaaatgt gctcacagcg gaccaagaca ccaatgggtc atatcggtga acctaacgat 660
atcgcttgga tctgtgttta cctggcatct gacgaatcta aatttgccac tggtgcagaa 720
ttcgttgtcg gtggatttac tgctcaataa 750
<210> 7
<211> 235
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Met Thr Asp Lys Gly Lys Val Ala Leu Val Thr Gly Gly Thr Leu Ala
1 5 10 15
Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala Lys Val
20 25 30
Val Ile Cys Phe Arg His Ala Asp Val Gly Glu Lys Ala Ala Lys Ser
35 40 45
Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln Tyr Asp Gly Asp Glu
50 55 60
Ala Gly Trp Thr Lys Leu Phe Asp Ile Thr Glu Glu Ala Phe Gly Pro
65 70 75 80
Val Thr Thr Val Val Asn Glu Phe Ala Ile Ala Met Leu Lys Ser Leu
85 90 95
Gly Asp Thr Thr Glu Glu Trp Arg Lys Leu Leu Met Val Asn Leu Asp
100 105 110
Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg Met Lys Asn Lys
115 120 125
Gly Leu Gly Ala Ser Ile Ile Asn Gly Ser Ser Ile Ala Gly Ile Ile
130 135 140
Gly Asp Pro Thr Met Gly Ala Tyr Asn Ala Thr Lys Gly Ala Val Arg
145 150 155 160
Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu Lys Asp Tyr Asp
165 170 175
Val Arg Val Asn Thr Val His Thr Ala Gly Leu Lys Thr Gly Leu Ile
180 185 190
Ala Asp Leu Pro Gly Phe Glu Glu Met Cys Ser Gln Gly Glu Pro Asn
195 200 205
Asp Ile Ala Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe
210 215 220
Ala Glu Phe Val Val Gly Gly Phe Thr Ala Gln
225 230 235
<210> 8
<211> 708
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
atgactgata aaggcaaagt agcattggta actggcggta ccttggcaat tggcttggca 60
atcgctgata agtttgttga agaaggcgca aaggttgtta tttgctttcg tcacgctgat 120
gtaggtgaaa aagctgccaa atcaatcggc ggcacagacg ttatccgttt tgtccaatac 180
gatggtgatg aagccggctg gactaagttg tttgatatta ctgaagaagc atttggccca 240
gttaccacgg ttgtcaacga atttgcaatt gcgatgctca agagtctcgg agataccact 300
gaagaatggc gcaagctgct catggttaac ttggatggtg tcttcttcgg tacccgtctt 360
ggaatccaac gtatgaagaa taaaggactc ggagcatcaa tcatcaatgg atcatctatc 420
gcaggtatca tcggtgatcc aactatgggt gcatacaacg ctactaaagg tgctgtcaga 480
attatgtcta aatcagctgc cttggattgc gctttgaagg actacgatgt tcgggttaac 540
actgttcata cagctggttt gaagacagga ttgattgcag atcttccagg gtttgaagaa 600
atgtgctcac agggtgaacc taacgatatc gcttggatct gtgtttacct ggcatctgac 660
gaatctaaat ttgcagaatt cgttgtcggt ggatttactg ctcaataa 708
Claims (4)
1. A ketoreductase mutant, characterized in that the amino acid sequence of the ketoreductase mutant is shown in SEQ ID No.3, 5 and 7.
2. The ketoreductase mutant of claim 1, wherein the ketoreductase mutant has the gene nucleotide sequence shown in SEQ ID nos. 4, 6 and 8.
3. The ketoreductase mutant of claim 1, which is expressed in BL21 (DE 3), PLysS or Origami B (DE 3).
4. The ketoreductase mutant of claim 1, which can convert 3,4-dihydroxy-2 '-chloroacetophenone to (R) -3,4-dihydroxy-2' -chlorophenethanol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110599394.7A CN115478059A (en) | 2021-05-31 | 2021-05-31 | Ketoreductase mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110599394.7A CN115478059A (en) | 2021-05-31 | 2021-05-31 | Ketoreductase mutant and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115478059A true CN115478059A (en) | 2022-12-16 |
Family
ID=84419114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110599394.7A Pending CN115478059A (en) | 2021-05-31 | 2021-05-31 | Ketoreductase mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115478059A (en) |
-
2021
- 2021-05-31 CN CN202110599394.7A patent/CN115478059A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110564788B (en) | Method for producing ephedrine by using imine reductase | |
| WO2022095591A1 (en) | Compound enzyme and application thereof in preparation of l-ergothioneine | |
| CN113774036B (en) | Imine reductase mutant and application thereof | |
| CN112143764A (en) | Method for preparing intermediate compound of brivaracetam by using biological enzyme catalysis | |
| CN109055324B (en) | Improved ketoreductase and application thereof | |
| CN114164197A (en) | Nitrilase mutant with improved thermal stability and activity and application thereof | |
| CN112813013A (en) | Recombinant escherichia coli for producing hydroxytyrosol and application thereof | |
| CN112029701B (en) | Genetically engineered bacterium and application thereof in preparation of 22-hydroxy-23, 24-bis-cholesta-4-en-3-one | |
| CN113322291A (en) | Synthesis method of chiral amino alcohol compound | |
| CN115478059A (en) | Ketoreductase mutant and application thereof | |
| CN115747183A (en) | Ketoreductase mutant and application thereof | |
| CN115433721A (en) | Carbonyl reductase mutant and application thereof | |
| CN112410353B (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| CN110129382B (en) | Method for catalytic synthesis of chiral ortho-halogenated-alpha-phenylethyl alcohol by carbonyl reductase | |
| CN114940964A (en) | Engineering bacteria and method for producing UDCA (UDCA) by efficiently catalyzing CDCA (cadmium-doped copper-aluminum-calcium) through engineering bacteria | |
| CN113637622A (en) | Pseudomonas proteorns 2-ketogluconate epimerase deletion mutant strain and construction method and application thereof | |
| CN112481229B (en) | Omega transaminase and mutant, recombinant plasmid, genetic engineering bacteria and application thereof | |
| CN115537405B (en) | Ketoreductase and application thereof in preparation of (S) -1- (3-chlorophenyl) -1, 3-propanediol | |
| CN116790569B (en) | Pyruvic acid decarboxylase mutant and application thereof in preparation of alpha-hydroxyketone compound | |
| CN114317631B (en) | Application of monoamine oxidase in preparation of topiroxone | |
| CN114507273B (en) | YH66_07020 protein and application of related biological material thereof in improving arginine yield | |
| CN115029329B (en) | Carbonyl reductase mutant and application thereof in preparation of R-mandelic acid | |
| CN117106836B (en) | Application of phosphatidyl glycerol phosphatase coding gene in fermentation production of cytidine | |
| CN111484986B (en) | Short-chain dehydrogenase and application thereof | |
| CN110343653B (en) | Method for improving yield of 1,2,4-butanetriol by knocking out aldehyde dehydrogenase gene of escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |