CN115404271A

CN115404271A - Kit for identifying sex of human

Info

Publication number: CN115404271A
Application number: CN202210497969.9A
Authority: CN
Inventors: 赵凌; 赵鸣雷; 商必志
Original assignee: Zhongshan Ophthalmic Center
Current assignee: Zhongshan Ophthalmic Center
Priority date: 2022-05-07
Filing date: 2022-05-07
Publication date: 2022-11-29

Abstract

The invention provides a primer combination for PCR for identifying human sex, which consists of a first primer pair and a second primer pair, wherein the first primer pair comprises nucleotide sequences shown as SEQ ID NO. 5 and SEQ ID NO. 7, and the second primer pair comprises nucleotide sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14. The PCR primer combination for identifying the sex of the human has good specificity and high amplification efficiency, and can be well applied to the sex identification of the human; the identification method is simple and convenient to operate, high in identification efficiency and high in sensitivity, specificity, accuracy and applicability; the accuracy of the identification method can reach 100%.

Description

Kit for identifying sex of human

Technical Field

The invention relates to the technical field of gene identification, in particular to a primer, a kit and a method for identifying human sex.

Background

The method for identifying the sex of human individuals and human cell strains by utilizing the PCR technology is the most widely applied method at present. PCR, polymerase Chain Reaction (Polymerase Chain Reaction), refers to a process of in vitro copying daughter strand DNA complementary to the DNA of a mother strand template by denaturing, annealing, extending, etc. steps using the mother strand DNA as a template and a specific primer as an extension origin under the catalysis of DNA Polymerase. The technology is a DNA in vitro synthesis amplification technology, and can rapidly and specifically amplify target DNA in vitro. The method is used for carrying out amplification detection on sex-specific genes (such as Y chromosome SRY genes), and the detection result analysis is carried out according to the sizes of different fragments or the intensity of signals of amplification products in the sex of men and women so as to judge the sex of the detected individual. Currently, the conventional PCR sex determination method can be classified into a general PCR method, a double or multiple PCR method, a nested PCR method, a fluorescent quantitative PCR method, etc. according to the difference between the amplification method and the cycle parameters.

Wherein, the duplex or multiplex PCR method is that a pair of sex-specific primers and at least one pair of internal reference primers for amplification of housekeeping genes are designed and synthesized, trace DNA is used as a template, two or more pairs of primers are simultaneously amplified and detected in a PCR reaction system under certain conditions, and the amplification product of the internal reference primers is used as a positive control for the occurrence or non-occurrence of the amplification reaction (if the band of the internal reference primers does not appear, the PCR reaction is considered not to occur, and the detection is invalid): on the premise of the appearance of the reference substance bands, the male specific bands appear at the same time, and the female specific bands appear at the same time, so that the male specific bands are male, and if the female specific bands appear, the female specific bands appear.

The dual or multiple PCR method is used for detecting the sex, although the occurrence of false negative results can be reduced, the amplification reaction of two or more pairs of primers is carried out in one PCR reaction system, the competition effect in the primer, between the primers and the template is increased, the difficulty of detection and analysis is increased, and the accurate and rapid detection of the sex is not facilitated. In the method, the occurrence of false negative results is avoided by setting the internal reference primer, but only the sex-specific primer of male or female is added in one PCR reaction, and two times of PCR are sometimes needed to determine whether the sample is from male or female. Therefore, it is a technical problem to be solved in the art to find a simple and fast method for determining the sex of a sample by one-time PCR.

Disclosure of Invention

In order to solve the above-mentioned purpose, the invention provides a PCR primer combination for identifying human sex by one-step method, the primer combination has good specificity and high amplification efficiency, and can be well applied to identification of human sex, thereby avoiding the occurrence of false negative and improving the accuracy of identification.

The first purpose of the invention is to provide a primer combination of PCR for identifying human sex, which comprises a first primer pair and a second primer pair, wherein the first primer pair comprises nucleotide sequences shown as SEQ ID NO. 5 and SEQ ID NO. 7, and the second primer pair comprises nucleotide sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14.

Generally speaking, the primer specificity increases 4-fold for each additional nucleotide, so that the shortest primer length for most applications is 18 nucleotides. The upper limit of the length of the primer is not critical and is mainly related to the efficiency of the reaction. In the sequence of the general primers, the G + C content is generally 40% -60%, and the GC content and Tm value of a pair of primers should be coordinated. The content of the primer G + C in the primer combination is controlled in a proper range, and the base distribution is random, so that the primer combination has a moderate melting temperature and is convenient for amplification.

Preferably, the target segment amplified by the first primer pair is a nucleotide sequence shown as SEQ ID NO. 16; the target fragment amplified by the second primer pair is a nucleotide sequence shown as SEQ ID NO. 15.

The second purpose of the invention is to provide a method for identifying the sex of a human, which comprises the following steps: extracting DNA of a sample to be detected as a template, carrying out PCR amplification on the DNA by using a first primer pair and a second primer pair, carrying out electrophoretic analysis on a PCR product after the amplification reaction is finished, and identifying that the result is male when two bands appear in the PCR product and female when only one band appears in the PCR product.

The identification method is simple and convenient to operate, high in identification efficiency, high in sensitivity, specificity, accuracy and applicability, can be well used for identifying the sex of the human, and is very suitable for wide popularization and application in a large range.

Preferably, a female is identified if a 403bp band appears in the DNA of the sample to be detected, and a male is identified if 403bp and 248bp bands appear simultaneously.

Preferably, in the PCR reaction, the concentration of the DNA is 15 ng-15 pg/μ l.

Preferably, in the PCR reaction, the concentration of the primer is 5-20 mu mol/L.

The third object of the present invention is to provide a gene for identifying human sex comprising the nucleotide sequence shown in SEQ ID NO. 15 and the nucleotide sequence shown in SEQ ID NO. 16. The target amplification fragment selected by the invention has better specificity, the sensitivity and the accuracy of amplification can be improved by using the target fragment and the primer of the invention in a combined way, and the DNA template with the DNA concentration of only 15 pg/mu l can be amplified with the highest sensitivity.

The fourth purpose of the invention is to provide a kit for identifying the sex of a human, which comprises a primer combination for identifying the genes.

Preferably, the primer combination comprises a first primer pair and a second primer pair, wherein the first primer pair comprises the nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 7, and the second primer pair comprises the nucleotide sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14.

The fifth purpose of the invention is to provide the primer combination of PCR for identifying human sex or the application of the gene in identifying human sex.

Compared with the prior art, the invention has the following beneficial effects: (1) The PCR primer combination for identifying the sex of the human has good specificity and high amplification efficiency, and can be well applied to the sex identification of the human; (2) The identification method is simple and convenient to operate, has high identification efficiency, and has high sensitivity, specificity, accuracy and applicability; (3) The accuracy of the identification method can reach 100%.

Drawings

FIG. 1 is an electrophoresis diagram showing the result of PCR amplification of primer set 1 designed according to the present invention.

FIG. 2 is an electrophoresis diagram showing the PCR amplification result of the primer set 2 designed according to the present invention.

FIG. 3 is an electrophoresis diagram showing the PCR amplification result of the primer set 3 designed according to the present invention.

FIG. 4 is an electrophoresis diagram showing the PCR amplification result of the primer set 4 designed according to the present invention.

FIG. 5 is an electrophoresis diagram showing the PCR amplification result of the primer set 5 designed according to the present invention.

FIG. 6 is an electrophoresis diagram showing the PCR amplification result of the primer set 6 designed in the present invention.

FIG. 7 is an electrophoresis chart showing the PCR amplification result of the primer set 7 designed according to the present invention.

FIG. 8 is an electrophoresis diagram showing the PCR amplification result of the primer set 8 designed according to the present invention.

FIG. 9 is an electrophoresis diagram showing the PCR amplification result of the primer set 9 designed according to the present invention.

FIG. 10 is an electrophoresis diagram showing the PCR amplification result of the primer set 10 designed according to the present invention.

FIG. 11 shows the results of the verification experiment of the primer set 8 designed in the present invention.

FIG. 12 shows the PCR target bands of 48 human peripheral blood samples

FIG. 13 is the electrophoresis diagram of the PCR amplification result of the primer pair 8 with different concentrations of DNA template.

FIG. 14 is the electrophoresis diagram of the PCR amplification result of the control group with different concentrations of DNA template.

Detailed Description

In order to more concisely and clearly show the technical scheme, the purpose and the advantages of the invention, the technical scheme of the invention is described in detail by combining specific embodiments. Unless otherwise specified, the reagents used in the examples of the present invention are commercially available products, and all of them can be purchased from commercial sources.

Example 1 screening, primer design and optimization of fragments to identify X, Y chromosomes

The invention designs primers according to the selected fragments on Y and X chromosomes respectively. Designing 7 primers (3 are forward sequences and 4 are reverse sequences) on a Y chromosome, designing 7 primers (3 are forward sequences and 4 are reverse sequences) on an X chromosome, and specifically designing the primer sequences as shown in the following table 1:

primer sequences designed in Table 1

Based on the designed primer sequence and the size of the target product, 10 pairs of primer pairs (each pair includes a forward primer and a reverse primer on X; and a forward primer and a reverse primer on Y) were designed, and the specific combinations and corresponding product sizes are as shown in the following Table 2:

primer pair combinations designed in Table 2

1) Preparing a DNA template: peripheral blood of healthy male and female is taken, and the whole blood genome DNA rapid extraction kit is used for extracting blood DNA to respectively obtain male and female DNA. The male and female DNA were diluted to 7 concentrations of 50 ng/. Mu.l, 5 ng/. Mu.l, 0.5 ng/. Mu.l, 50 pg/. Mu.l, 5 pg/. Mu.l, 2.5 pg/. Mu.l, 0.5 pg/. Mu.l, respectively.

2) Ordinary PCR: respectively taking the seven DNA concentrations as templates, respectively and simultaneously adding the primer combinations of the 10 pairs in the table above, and carrying out PCR amplification; the reaction system is carried out according to the instruction of a kit Easy Taqmix: 20 mu l of systems are adopted in the PCR reaction, wherein the amount of the DNA template in each reaction system is 50ng,5ng,0.5ng,50pg,5pg,2.5pg and 0.5pg respectively; the amounts of forward and reverse primers were 10. Mu. Mol, the amount of Easy Taqmix was 10. Mu.l, and the volume was made up to 20. Mu.l with pure water without RNase and DNase. The PCR reaction procedure is shown in Table 3 below.

Table 3: PCR reaction procedure

1	95℃	3:00
			2	95℃	0:30
3	55℃	0:30
			4	72℃	0:30
5	GoTo step 2	37×
			6	72℃	3:00
7	4℃	∞

3) Analysis and determination of results

As shown in FIGS. 1 to 10, the PCR amplification results show that, in the case where the amounts of the templates are 50ng,5ng,0.5ng,50pg,5pg,2.5pg, and 0.5pg, the primer set for amplifying the fragment A and the primer set for amplifying the fragment B of the present invention have a significant amplification effect on the template DNA in the same reaction system, and the amplification effect is marked for both females and males with a single band a and a band B on the basis of the band a. As shown in the figure (FIG. 8), the primer pair 8 can amplify a 403bp band which is female, and if the 403bp and 248bp bands occur simultaneously, the male is identified. The band is clear and definite, the impurity band is less, and the clear band is amplified at 50 pg. Therefore, the primer pair 8 selected by the invention is used for detecting the accuracy and the sensitivity of identification, and amplifying the A segment on the X chromosome and the B segment on the Y chromosome, so that the detection result is reliable, and the sex of the individual from which the sample is derived can be accurately identified in one PCR reaction.

Example 2

The following detection takes the primer pair 8 as a detection primer pair, and the primer sequences and amplification product fragments for amplification are as follows:

1. selecting the amplified target fragment:

the nucleotide sequence of the fragment selected as A on the human X chromosome is as follows:

CATTCCAGCTTCACCATTGGCTttcctgacacagagcctactcagtggaa

aacgccttgctgtcatgcgttccaagaaggtgatggtgccatacaacatg

tagcagcaggagcaaaaccaagcatctctcccgggctttgtggtttcctc

cgctggtatcacaaagctggagggagactgcagggaaaggcacactctcc

aaggtaactctgagaactgctttgaggagcaggagaaaatcatctgagta

tcaaaatactaggtcttctggaaacagaatgtaacacagagcttgttata

caggtgatacactgaggaggtgctctcaggagaaactcagatggggttat

caggcaaaacaagggaaaagaagataccaaggAGTCTCAGCCTGATCCCA

CAG(SEQ ID NO:15)。

a single fragment of human Y chromosome is selected as a B fragment as an amplified target fragment, and the nucleotide sequence of the B fragment is as follows:

GTTTGCGCAAGGAATTCGCTGCagcatataaaactttcaggaccctgaaa

tacagaactgcaaagaaacggcctaagatggttgaatgctctttattttt

ctttaatttagacatgttcaaacgttcaatgtcttacatacttagttatg

taagtaaggtagcgcttacttcattatgcatttcaatactcaaaaaaaat

tcctttgtgaaatgttgaaatattttTCTAATCTGTTTCACGAGCTTC

(SEQ ID NO:16)。

2. selection of primers

For the above amplification results, primer pair 8 was selected for amplification of fragments a and B, and the information is shown in table 4 below.

TABLE 4 primer information

3. Verification of the Effect of the primers and the target Gene of the present invention in sex determination

1) Preparing a DNA template: peripheral blood of healthy male and female is taken, and the whole blood genome DNA rapid extraction kit is used for extracting blood DNA to respectively obtain male and female DNA. The male and female DNA were diluted to 2 ng/. Mu.l, respectively.

2) Ordinary PCR: respectively taking the DNAs with the three concentrations as templates, and respectively and simultaneously adding an X chromosome A fragment primer pair (13, 14) and a Y chromosome B fragment primer pair (5, 7) for PCR amplification; the reaction system is carried out according to the instruction of a kit Easy Taqmix: the PCR reaction employed 20. Mu.l of each reaction system with a DNA template amount of 2ng, forward and reverse primer amounts of 10. Mu. Mol, easy Taqmix amount of 10. Mu.l, and a volume of 20. Mu.l was filled up with pure water without RNase and DNase. The PCR reaction procedure is shown in Table 5 below.

Table 5: PCR reaction procedure

3) Analysis and determination of results

It can be seen that (as shown in FIG. 11) the amplified target gene B fragment selected in the present invention is male-specific gene, which exists only in male genome, and therefore the B fragment is designed to amplify a 248bp band, while the A fragment is human-specific gene, which exists in male genome, and therefore, in the reaction system in which two pairs of primers exist simultaneously, the B primer cannot amplify a band because the female sample does not contain the B fragment.

Example 3 accuracy test

48 samples of human peripheral blood were taken for testing, DNA template preparation was performed by the method of example 2, and the samples were individually subjected to PCR for sex determination using the primer pair 8 of the present invention, and the accuracy of the primers of the present invention and the target gene selected was examined, wherein the concentration of DNA in the samples in this test was 2 ng/. Mu.l, and the PCR process was performed using example 1, and the results are shown in Table 6 and FIG. 12:

table 6: results of PCR-purpose bands for 48 human peripheral blood samples (FIG. 12)

Note: the "+" in the table indicates that the desired band was amplified.

As can be seen from the above table 6 and FIG. 12, the success rate of the detection of the present invention reaches 100% and the accuracy reaches 100% under the condition that the concentration of the DNA template is 2 ng/. Mu.l.

Example 4 sensitivity test

Taking human peripheral blood samples (male and female) for testing, dividing the human peripheral blood samples into a control group and an experimental group, and carrying out PCR (polymerase chain reaction) on the control group by using primers in the patent with the application number of 90102940.8 to identify the sex of the samples; the experiment group adopts the primer pair 8 and the method of the embodiment 2 to carry out PCR to identify the sex of the sample, and the DNA concentrations of the sample in the control group and the experiment group are respectively set as the following concentrations: 15 ng/. Mu.l, 1.5 ng/. Mu.l, 0.15 ng/. Mu.l, 15 pg/. Mu.l, 1.5 pg/. Mu.l, 0.15 pg/. Mu.l. The results are shown in table 7 and fig. 13 and 14:

table 7: bands of interest for PCR at different concentrations showed results (FIGS. 13 and 14)

Note: in the table, "+" indicates that the desired band was amplified, and "-" indicates that the desired band was not amplified.

As can be seen from the above table and FIGS. 13 and 14, when the concentration of the DNA template is 0.15 pg/. Mu.l, the primers for identifying the male fragments in the male sample in the control group cannot amplify the target band; meanwhile, in the concentration of 15 ng/mul and 1.5 ng/mul, the primers for identifying the female fragments in the female sample of the control group can not amplify the target band; at concentrations of 0.15ng/μ l, 15pg/μ l, 1.5pg/μ l and 0.15pg/μ l, the control group can also amplify male fragments in female samples, and the identification result is unknown. The primer group of the invention can still amplify target bands, even when the concentration of the DNA template is 15 pg/mu l, the target bands can be well amplified, and the bands are clear and definite and have no more miscellaneous bands. Thus, it was demonstrated that the sensitivity of amplification can be affected by the selection of the target gene to be amplified and the design of the primers. The primers for amplifying the human specific genes selected in the control group can only amplify 124bp target bands, while the primers for amplifying the human specific genes selected in the invention can amplify 403bp target bands, so that the control group is more stable and the sensitivity of the control group is improved; and because the male specific gene only exists in the male genome but does not exist in the female genome, the amplified target fragment can be properly shortened, the reaction time is shortened, and the reaction time is saved.

In conclusion, the primer, the kit and the method provided by the invention can accurately identify the sex of human individuals and human cell strains, are simple and convenient to operate, have high sensitivity, strong specificity, clear results and few required DNA samples, and have good application prospects.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Zhongshan ophthalmic center of Zhongshan university

<120> a kit for identifying human sex

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 1

ggaatgttgc tggcaagaca ct 22

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 2

gtggacttta cgaaccaacc t 21

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

gatgagcaac agttgtgaca gt 22

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

gcaccaaagg tcatttgtgg t 21

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

gtttgcgcaa ggaattcgct gc 22

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

gaagtaagcg ctaccttact t 21

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

gaagctcgtg aaacagatta ga 22

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

gtgcacccaa ccgtagtcca t 21

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 9

gatcatgata cctgcccaac at 22

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

cactggagtc tgcatctccc aat 23

<210> 11

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 11

ctgcagatct cagagtcttc tgt 23

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 12

gagtacggat tatcctcagc t 21

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 13

cattccagct tcaccattgg ct 22

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 14

ctgtgggatc aggctgagac t 21

<210> 15

<211> 403

<212> DNA

<213> Artificial sequence (Artificial)

<400> 15

cattccagct tcaccattgg ctttcctgac acagagccta ctcagtggaa aacgccttgc 60

tgtcatgcgt tccaagaagg tgatggtgcc atacaacatg tagcagcagg agcaaaacca 120

agcatctctc ccgggctttg tggtttcctc cgctggtatc acaaagctgg agggagactg 180

cagggaaagg cacactctcc aaggtaactc tgagaactgc tttgaggagc aggagaaaat 240

catctgagta tcaaaatact aggtcttctg gaaacagaat gtaacacaga gcttgttata 300

caggtgatac actgaggagg tgctctcagg agaaactcag atggggttat caggcaaaac 360

aagggaaaag aagataccaa ggagtctcag cctgatccca cag 403

<210> 16

<211> 248

<212> DNA

<213> Artificial sequence (Artificial)

<400> 16

gtttgcgcaa ggaattcgct gcagcatata aaactttcag gaccctgaaa tacagaactg 60

caaagaaacg gcctaagatg gttgaatgct ctttattttt ctttaattta gacatgttca 120

aacgttcaat gtcttacata cttagttatg taagtaaggt agcgcttact tcattatgca 180

tttcaatact caaaaaaaat tcctttgtga aatgttgaaa tatttttcta atctgtttca 240

cgagcttc 248

Claims

1. A primer combination for PCR for identifying human sex is characterized in that the primer combination comprises a first primer pair and a second primer pair, the first primer pair comprises nucleotide sequences shown as SEQ ID NO. 5 and SEQ ID NO. 7, and the second primer pair comprises nucleotide sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14.

2. The primer combination of claim 1, wherein the fragment of interest amplified by the first primer pair is a nucleotide sequence as set forth in SEQ ID No. 16; the target fragment amplified by the second primer pair is a nucleotide sequence shown as SEQ ID NO. 15.

3. A method of sexing a person, comprising the steps of: extracting DNA of a sample to be detected as a template, carrying out PCR amplification on the DNA by using a first primer pair and a second primer pair, carrying out electrophoretic analysis on a PCR product after the amplification reaction is finished, and identifying that the result is male when two bands appear in the PCR product and is female when only one band appears in the PCR product.

4. The method according to claim 3, wherein the sex determination method is characterized in that a female is determined if a 403bp band appears in the DNA of the sample to be tested, and a male is determined if 403bp and 248bp bands appear simultaneously.

5. The method for sexing a human according to claim 3, wherein the concentration of DNA in the PCR reaction is 15ng to 15pg/μ l.

6. The method for sexing a human according to claim 3, wherein the primer concentration in the PCR reaction is 5 to 20. Mu. Mol/L.

7. The gene for identifying the sex of a human is characterized by comprising a nucleotide sequence shown as SEQ ID NO. 15 and a nucleotide sequence shown as SEQ ID NO. 16.

8. A kit for sex determination of a human, comprising a primer set for identifying the gene of claim 7.

9. The kit of claim 8, wherein the primer combination comprises a first primer pair comprising the nucleotide sequences set forth in SEQ ID NO. 5 and SEQ ID NO. 7 and a second primer pair comprising the nucleotide sequences set forth in SEQ ID NO. 13 and SEQ ID NO. 14.

10. Use of the primer set for PCR for human gender identification as claimed in claim 1 or the gene as claimed in claim 7 for human gender identification.