CN115386624B - Single cell complete sequence marking method and application thereof - Google Patents
Single cell complete sequence marking method and application thereof Download PDFInfo
- Publication number
- CN115386624B CN115386624B CN202211315126.9A CN202211315126A CN115386624B CN 115386624 B CN115386624 B CN 115386624B CN 202211315126 A CN202211315126 A CN 202211315126A CN 115386624 B CN115386624 B CN 115386624B
- Authority
- CN
- China
- Prior art keywords
- sequence
- cell
- rna
- detected
- single cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of gene sequencing, and particularly relates to a single cell complete sequence marking method and application thereof, wherein the single cell complete sequence marking method comprises the following steps: providing an RNA to be detected, wherein the RNA to be detected is from a plurality of cells; obtaining a double-chain product; performing transposition reaction on the double-chain product by using transposase to obtain a plurality of fragmentation products of a plurality of cells; connecting a plurality of fragmentation products with a plurality of cell tags in a one-to-one correspondence; and connecting a plurality of fragmentation products of the same cell with the same cell tag, and connecting a plurality of fragmentation products of different cells with different cell tags to obtain a labeled single cell complete sequence. In the invention, the double-chain product is fragmented by transposase and introduced into a transposon sequence, and the fragmented product is connected with a specific cell tag, so that the cell tag marking of a single cell gene sequence is realized, the subsequent detection of a single cell complete sequence is convenient to realize, and the total amount of single cell gene acquisition is also improved.
Description
Technical Field
The invention belongs to the field of gene sequencing, and particularly relates to a single cell complete sequence labeling method and application thereof.
Background
As is well known, complex living organisms are composed of a plurality of cells with specific properties, and the types and the quantities of nucleic acids and proteins expressed by each cell are different under specific conditions, so that the detection of the nucleic acid and protein indexes on the single cell level is of great significance to the biomedical research. The single cell sequencing mainly comprises single cell genome sequencing, single cell RNA sequencing, single cell epigenome sequencing and space single cell sequencing from the detection index; from the detection flux, the method is mainly divided into low-flux single cell sequencing (detecting 1-500 cells at a time) and high-flux single cell sequencing (detecting 1000-10000 cells at a time).
The current commercialized high-throughput single-cell RNA sequencing mainly analyzes the expression quantity of RNA in a single cell, the detection of the full-length sequence of the RNA is not realized, and compared with the low-throughput single-cell RNA sequencing technology smart-seq or quartz-seq, the current commercialized high-throughput single-cell RNA sequencing has the problems that the number of genes detected by a single cell is low, and the low-expression RNA is missed.
Disclosure of Invention
The invention aims to provide a single cell complete sequence marking method and application thereof, aiming at obtaining high-throughput single cell complete sequence information and improving gene detection number in subsequent detection steps.
In order to achieve the above object, the present invention provides a method for single cell full sequence labeling, comprising the following steps:
step S1, providing RNA to be detected, wherein the RNA to be detected comes from a plurality of cells;
step S2, obtaining the double-stranded product by adopting any one mode of the step (a) or the step (b):
adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain an mRNA/cDNA heterozygous chain, namely the double-stranded product;
adding a reverse transcription reaction system into the RNA to be detected, carrying out reverse transcription reaction to obtain a first cDNA chain, and carrying out double-chain synthesis by using the first cDNA chain as a template to obtain a double-chain product;
s3, performing transposition reaction on the double-chain product by using transposase to obtain a plurality of fragmentation products of a plurality of cells;
and S4, connecting the plurality of fragmentation products with a plurality of cell tags in a one-to-one correspondence manner, wherein the plurality of fragmentation products of the same cell are connected with the same cell tag, and the plurality of fragmentation products of different cells are connected with different cell tags, so that a labeled single cell complete sequence is obtained.
Optionally, the step (b) comprises the steps of:
step S201, adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain a first cDNA chain;
and S202, taking the first strand of the cDNA as a template, and adopting a primer containing a random sequence or an RNA strand after digestion to start double-strand synthesis to obtain the double-stranded product.
Optionally, the step S1 includes the following steps:
step S101, providing an enrichment body;
step S102, providing cell RNA containing target RNA, and enriching the target RNA in the cell RNA on the enrichment body to obtain the RNA to be detected.
Optionally, the concentrate is coupled with a reverse transcription primer and a template switch sequence homology sequence, and step (b) comprises the steps of:
step S201, adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain a cDNA first chain, wherein the reverse transcription reaction system contains a template switching sequence and reverse transcriptase, and the template switching sequence contains a sequence which is the same as a homologous sequence of the template switching sequence;
and S202, carrying out in-situ amplification by taking the first cDNA chain as a template and the homologous sequence of the template switching sequence as a primer to obtain the double-stranded product.
Optionally, the step S1 includes:
step S101, providing a plurality of cells to be detected and a plurality of detection areas, and depositing the cells to be detected in the detection areas in a one-to-one correspondence manner;
and S102, in each detection area, cracking each cell to be detected, and enriching target RNA to obtain the RNA to be detected.
Optionally, in step S3, the transposase comprises a transposon sequence; the step S4 includes:
step S401, providing a plurality of labeled microbeads, wherein each labeled microbead comprises a microbead body and a plurality of functional sequences containing the same cell label, the cell labels of the functional sequences of the labeled microbeads are different, each functional sequence further comprises a joint 1 'connected with the transposon sequence, the joint 1' is connected with one end of the cell label, and the microbead body is connected with the other end of the cell label and can be conditionally broken away from the cell label;
step S402, mixing a plurality of fragmentation products of a plurality of cells with a plurality of labeled microbeads, connecting the adaptor 1' with the transposon sequence, applying conditions to break the microbead body and the cell label to obtain a labeled single cell complete sequence, wherein the fragmentation products of the same cell are correspondingly mixed with the same labeled microbeads, and the fragmentation products of different cells are mixed with different labeled microbeads.
In addition, the invention also provides a method for constructing the high-throughput single-cell complete-sequence transcriptome library, which comprises the following steps:
obtaining a marked single cell complete sequence by adopting the method;
and performing index PCR on the marked single cell complete sequence, enriching the marked single cell complete sequence, and introducing a sequencing linker sequence and a library label to obtain the high-throughput single cell complete sequence transcriptome library.
In addition, the invention also provides a sequencing method of the whole sequence of the high-throughput single cell, which comprises the following steps:
constructing a high-throughput single-cell complete sequence transcriptome library by adopting the method;
sequencing the high-throughput single-cell full-sequence transcriptome library by using a sequencing platform.
In addition, the invention also provides a kit for realizing the method for constructing the high-throughput single-cell complete-sequence transcriptome library, which comprises the following steps:
a reverse transcription system for reverse transcription of RNA to obtain double DNA strands or mRNA/cDNA hybrid strands;
a transposase system for cleaving the DNA duplex or the mRNA/cDNA hybrid strand to obtain a fragmentation product;
a labeling system, wherein the labeling system can connect a plurality of the fragmentation products of the same cell with the same cell tag, and connect a plurality of the fragmentation products of different cells with different cell tags to obtain a labeling product;
and the Index PCR system is used for enriching the marked products and introducing sequencing joint sequences and library labels to form the high-throughput single-cell complete-sequence transcriptome library.
In the invention, the double-chain product is fragmented by transposase and introduced into a transposon sequence, and the fragmented product is connected with a specific cell tag, so that the cell tag marking of a single cell gene sequence is realized, the subsequent detection of a single cell complete sequence is convenient to realize, and the total amount of single cell gene acquisition is also improved.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other related drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a flowchart of a single cell full sequence tagging method according to an embodiment of the present invention;
FIG. 2 is a schematic diagram of the reaction of the present invention;
FIG. 3 is a labeled microbead map;
FIG. 4 is a schematic diagram of a library product;
FIG. 5 is a diagram in which A is the nucleic acid distribution obtained in example 1 and B is the nucleic acid distribution obtained in comparative example 1;
FIG. 6 shows the distribution of nucleic acids obtained in example 2;
FIG. 7 shows the numbers of genes measured in examples 1 to 2 and comparative example 1.
The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. It is to be understood that the described embodiments are merely a few embodiments of the invention, and not all embodiments.
It should be noted that those whose specific conditions are not specified in the examples were performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially. In addition, the meaning of "and/or" appearing throughout includes three juxtapositions, exemplified by "A and/or B" including either A or B or both A and B. In addition, technical solutions between various embodiments may be combined with each other, but must be realized by a person skilled in the art, and when the technical solutions are contradictory or cannot be realized, such a combination should not be considered to exist, and is not within the protection scope of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In view of the technical defects that the existing high-throughput single cell sequencing cannot obtain full sequence information and the total amount of single cell genes is low, referring to fig. 1 and fig. 2, the invention provides a single cell full sequence marking method, which comprises the following steps:
step S1, providing RNA to be detected, wherein the RNA to be detected comes from a plurality of cells;
step S2, obtaining the double-stranded product by adopting any one mode of the step (a) or the step (b):
adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain an mRNA/cDNA heterozygous chain, namely the double-stranded product;
adding a reverse transcription reaction system into the RNA to be detected, carrying out reverse transcription reaction to obtain a first cDNA chain, and carrying out double-chain synthesis by using the first cDNA chain as a template to obtain a double-chain product;
s3, performing transposition reaction on the double-chain product by using transposase to obtain a plurality of fragmentation products of a plurality of cells;
and S4, connecting the plurality of fragmentation products with a plurality of cell tags in a one-to-one correspondence manner, wherein the plurality of fragmentation products of the same cell are connected with the same cell tag, and the plurality of fragmentation products of different cells are connected with different cell tags, so that a labeled single cell complete sequence is obtained.
In the invention, under the action of transposase, the double-stranded product is fragmented and introduced into a transposon sequence, and the fragmented double-stranded product is connected with a specific cell tag, so that the cell tag marking of a single cell gene sequence is realized, the subsequent detection of a single cell full sequence is facilitated, and the total amount of single cell gene acquisition is also improved.
In some embodiments, the step S1 comprises:
step S101, providing an enrichment body;
step S102, providing cell RNA containing target RNA, and enriching the target RNA in the cell RNA on the enrichment body to obtain the RNA to be detected. Through enrichment, RNA in a sample can be extracted, and non-target genes can be removed.
In some embodiments, the concentrate comprises an enrichment entity and a capture probe attached to the enrichment entity, wherein the capture probe specifically binds to RNA, thereby capturing RNA to be detected. Specifically, the capture probe is oligo- (dT) n And n is 10 to 100, and the sequence corresponds to the structure of the Poly A in the eukaryotic cell.
In some embodiments, the capture probe is modified with a blocking group at the end to allow it to be enriched only, without performing a reverse transcription reaction, and a primer specific to the gene of interest is added to the reverse transcription reaction system for extension. This allows the selective acquisition of a full sequence library of the gene of interest, which is no longer required by the capture method.
It should be noted that the enrichment body may be made of a flexible material or a rigid material.
In some embodiments, the step S102 includes:
step S1021, providing a plurality of cells to be detected;
and S1022, cracking a plurality of cells to be detected to release RNA, and then enriching the target RNA by using the enrichment body to obtain the RNA to be detected. The RNA in the cells to be detected can be fully released through the steps.
In some embodiments, the step S1 comprises:
step S101, providing a plurality of cells to be detected and a plurality of detection areas, and depositing the cells to be detected in the detection areas in a one-to-one correspondence manner;
and S102, in each detection area, cracking each cell to be detected, and enriching target RNA to obtain the RNA to be detected.
Specifically, by providing a microfluidic chip provided with a plurality of deposition wells, each deposition well is a deposition area. The microwell chip may contain from 100 to 10000000 deposition areas, and the diameter of each microwell of the same chip is the same, which may be between 10-200 um. The number of cells put into the micro-porous chip should not exceed 1/5 of the number of the deposition areas, and the cells can be naturally settled to the deposition areas by gravity.
In step S20, when the double-stranded product obtained in step (a) is used, the library building process can be further shortened without reducing the base factor; it should be noted that, because RNA is easy to degrade, transposase treatment is required immediately after reverse transcription;
when the double-stranded product obtained in the step (b) is adopted, the double-stranded product obtained by adopting the method is DNA, and is more stable than RNA, easy to store and higher in experimental flexibility.
In some embodiments, the concentrate is coupled with a reverse transcription primer and a template switch sequence homology sequence; referring to fig. 2, the step S2 includes the steps of:
step S201, adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain a cDNA first chain, wherein the reverse transcription system contains a template switching sequence and reverse transcriptase, and the template switching sequence contains a sequence which is the same as a homologous sequence of the template switching sequence; the reverse transcriptase has a template switching function;
and S202, carrying out in-situ amplification by using the first cDNA strand as a template and the template conversion homologous sequence as a primer to obtain a double-stranded product.
The term "template switching function" as used herein means that the terminal transferase activity of reverse transcriptase adds some extra bases to the 3' end of the newly synthesized cDNA.
The term "template switching sequence" as used herein refers to a sequence complementary-paired with an additional base portion added to the 3' end of cDNA and extended as a template, thereby achieving the addition of a universal primer at the other end for facilitating the subsequent PCR reaction.
Referring to fig. 2, the double-stranded DNA formed by the method has both ends connected to the enrichment body, and compared with the conventional double-stranded DNA, the method omits a purification step after a transposition reaction, and simplifies an experimental process. The double-stranded DNA obtained by the method has increased gene copy number due to amplification reaction, avoids gene loss in the purification process after index PCR, and can improve the detection base factor and the detection sensitivity.
Referring to fig. 2, in some embodiments, the step S2 includes:
step S201, adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain a first cDNA chain;
step S202, using cDNA as a template, and adopting a primer containing a random sequence or RNA chain digested by RNaseH to start cDNA double-chain synthesis.
The primers containing random sequences were used to generate a plurality of cDNA fragments, which together constituted the cDNA, and which covered the sequence information of the first strands of the cDNA. The specific coverage mode can comprise:
the part of the plurality of cDNA fragments can be divided into a plurality of sets, after the plurality of cDNA fragments in each set are spliced, the formed single-chain information is consistent with one cDNA first chain, and the sequence information of all single-chains formed after the plurality of sets are spliced comprises all the cDNA first chain information;
of course, partial fragments of a plurality of cDNA fragments may also each have sequence information of the first strand of the complete cDNA. Specifically, they are not described one by one.
In some embodiments, in step S3, the transposase contains a transposon sequence. The transposon sequences can be used as a linker for subsequent ligation of cell tags.
Specifically, in some embodiments, the transposase further comprises a transposase comprising two transposon sequences, wherein one transposon sequence is a first transposon sequence comprising all or part of a read1 sequence primer and a first transposase recognition sequence, the read1 sequence primer comprising linker 1 attached to a cell tag, the transposase being attached to one end of the first transposase recognition sequence, and the read1 sequence primer being attached to the other end of the first transposase recognition sequence.
It will be understood, of course, that the other transposon sequence is a second transposon sequence comprising a second transposase recognition sequence identical to the first transposase recognition sequence and all or part of the read2 sequence primer.
In some embodiments, the step S4 comprises the steps of:
step S401, providing a plurality of labeled microbeads, referring to FIG. 3, wherein each labeled microbead comprises a microbead body 1 and a plurality of functional sequences 2 containing the same cell tag 201, and the cell tags 201 of the functional sequences of the labeled microbeads are different, each functional sequence further comprises a linker 1 'connected with the transposon sequence, the linker 1'202 is connected with one end of the cell tag 201, and the microbead body 1 is connected with the other end of the cell tag 201 and can be conditionally broken away from the cell tag;
step S402, mixing a plurality of fragmentation products of a plurality of cells with a plurality of labeled microbeads, connecting a joint 1' with the transposon sequence, applying conditions to break the microbead body and the cell label to obtain a labeled single cell complete sequence, wherein the plurality of fragmentation products of the same cell are correspondingly mixed with the same labeled microbead.
Connecting the linker 1 'to the transposon sequence, specifically, the linker 1 and the linker 1', so that it can introduce the cell tag by means of labeled microbeads, can connect a plurality of cell tags at one time, thereby improving the connection efficiency of the cell tags, for example, 10^ per microbead attached to the body 5 -10^ 10 A function sequence can realize 10^ s 5 -10^ 10 Individual sequence tags. It should be noted that the material of the bead body may be a flexible material or a rigid material.
In some embodiments, a cleavable group X203 is disposed between the bead body and the cell tag, wherein X can be released from the bead under a specific stimulation condition, such as light stimulation or chemical stimulation. The bead bodies can be dissolved or not dissolved in the micropores in the process.
In some embodiments, referring to fig. 3, a primer binding sequence 204 is further disposed between the cell tag and the bead body. And setting a primer binding sequence to complete subsequent library enrichment and introduction of a sequencing joint sequence and a library label.
In some embodiments, in step S402, linker 1 and linker 1 'are ligated under the mediation of a Reverse primer comprising a first region complementary to linker 1 and a second region complementary to linker 1'.
In addition, the invention provides a method for constructing a high-throughput single-cell complete-sequence transcriptome library, which comprises the following steps:
a10, obtaining a marked single cell complete sequence by adopting the single cell complete sequence marking method;
and A20, performing index PCR on the marked whole sequence of the single cell, and introducing a sequencing adaptor sequence and a library label in the process of the index PCR to obtain the high-throughput whole sequence transcriptome library of the single cell.
In some embodiments, index PCR is performed using amplification primers comprising a first primer and a second primer, wherein the first primer comprises the same sequence as the primer binding sequence (204), further wherein the primer binding sequence is a P5 sequence recognizable by the illumina sequencing platform;
the second primer comprises a transposon combination sequence, a library tag and a second sequencing adapter sequence, wherein the transposon combination sequence is the same as the second transposon sequence, the library tag is arranged between the second sequencing adapter sequence and the transposon combination sequence, and the second sequencing adapter sequence is a P7 sequence which can be identified by an illumina sequencing platform.
Through the steps, library tags are introduced into the whole sequence of the single cell for distinguishing samples. It should be noted that the sequencing tag may be added according to needs, and is not particularly limited. Specifically, in some embodiments, sequencing adaptor sequences and library tags are introduced by index PCR. The library products thus constructed are shown in FIG. 4.
In addition, the invention also provides a sequencing method of the whole sequence of the high-throughput single cell, which comprises the following steps:
b10, constructing a high-throughput single-cell complete sequence transcriptome library by adopting the method;
and B20, sequencing the high-throughput single-cell complete sequence transcriptome library by adopting a sequencing platform. By the method, after the library is sequenced, corresponding sequence information is determined, and sequencing is completed.
In some embodiments, in step B20, the sequencing platform comprises illumina NovaSeq 6000.
In addition, the invention also provides a kit for realizing the method for constructing the high-throughput single-cell complete-sequence transcriptome library, which comprises the following steps:
a reverse transcription system for reverse transcription of RNA to obtain double DNA strands or mRNA/cDNA hybrid strands;
a transposase system for cleaving the DNA duplex or the mRNA/cDNA hybrid strand to obtain a fragmentation product;
a labeling system, wherein the labeling system can connect a plurality of the fragmentation products of the same cell with the same cell tag, and connect a plurality of the fragmentation products of different cells with different cell tags to obtain a labeling product;
and the Index PCR system is used for enriching the marked products and introducing sequencing joint sequences and library labels to form the high-throughput single-cell complete-sequence transcriptome library.
It is understood that the reverse transcription system includes a reverse transcriptase, a reverse transcription primer, and a reverse transcription reaction solution, thereby performing a reverse transcription reaction.
In some embodiments, the reverse transcription primer can also be used to capture the RNA to be detected; for example, oligo- (dT) n, n is 10 to 100, so the reverse transcription primer can also be attached to a capture body to prepare a capture body.
Of course, when the reverse transcription primer does not have the function of capturing RNA, the reverse transcription primer may also be grafted to the capture entity, and correspondingly a capture sequence may be additionally grafted to the capture entity.
In some embodiments, the capture volume further comprises a template switch sequence homology sequence; accordingly, the reverse transcriptase has a template switching activity, such as Superscript II reverse transcriptase, and is used for template switching in a reverse transcription reaction. It is understood that in the process of template switching, a template switching sequence is required to be added to the reverse transcription system, and the template switching sequence comprises a sequence homologous to the template switching sequence. Thus, subsequent in situ amplification to form double-stranded DNA product is facilitated.
In some embodiments, the transposase system comprises a transposase comprising a first transposon sequence and a second transposon sequence.
The transposon sequences can serve as a linker for subsequent ligation by a cell tag.
Specifically, the transposase further comprises a transposase body, wherein the transposase body comprises two transposon sequences, one transposon sequence is a first transposon sequence, and comprises all or part of a sequence of a read1 sequence primer and a first transposase recognition sequence, the read1 sequence primer comprises a linker 1 connected with a cell tag, the transposase body is connected with one end of the first transposase recognition sequence, and the read1 sequence primer is connected with the other end of the first transposase recognition sequence.
It will be understood, of course, that the other transposon sequence is a second transposon sequence comprising a second transposase recognition sequence identical to the first transposase recognition sequence and all or part of the read2 sequence primer.
In some embodiments, the labeling system comprises a plurality of labeled microbeads and a linking reaction solution, each labeled microbead comprises a microbead body and a plurality of functional sequences containing the same cell tag, and the cell tags of the functional sequences of the labeled microbeads are different, each functional sequence further comprises a linker 1' linked to the first transposon sequence, the linker 1' is linked to one end of the cell tag, the microbead body is linked to the other end of the cell tag and is conditionally cleavable with the cell tag, and the linking reaction solution links the linker 1' to the transposon sequence.
In some embodiments, the index PCR line includes amplification primers and a PCR reaction solution.
In some embodiments, the amplification primers comprise a first primer and a second primer, wherein the first primer comprises a sequence identical to the primer binding sequence (204), further wherein the primer binding sequence is a P5 sequence recognizable by the illumina sequencing platform; the second primer comprises a transposon combination sequence, a library tag and a second sequencing adapter sequence, wherein the transposon combination sequence is the same as the second transposon sequence, the library tag is arranged between the second sequencing adapter sequence and the transposon combination sequence, and the second sequencing adapter sequence is a P7 sequence which can be identified by an illumina sequencing platform.
The amplification primer sequences are as follows:
a first primer N5: AATGATACGGCGACCGCGA
A second primer N7: CAAGCAGAGACGGCATACGAGAGAGATACGAGATxxxxxxxxGTCTCGTGGGCTCGG, wherein CAAGCAGAGACGGCATACGAGAGAAT is a P7 sequence, xxxxxxxx is a library tag, and GTCTCGTGGGCTCGG is a Read2 Sequencing primer partial sequence;
the technical solutions of the present invention are further described in detail below with reference to specific examples and drawings, it should be understood that the following examples are merely illustrative of the present invention and are not intended to limit the present invention.
Example 1
1. Capturing cellular RNA and reverse transcription in microwell chips using magnetic beads
1.1 Peripheral blood was drawn and fresh PBMC cells were obtained, resuspended in PBS;
1.2 Processing the chip according to the micropore chip instruction provided in the construction kit of SeekOne MM 3' single cell transcriptome library which is already sold by the Ministry of seeking, 3000 incubated PBMC cells were added;
1.3 Adding oligo (dT) coupled with PBS washing 25 400 mu L of 3um magnetic beads are put into the microporous plate, and redundant magnetic beads are cleaned after the magnetic attraction of the pores;
1.4 Adding lysis solution for 2min;
1.5 Configuring a reverse transcription system of 400 mu L according to the following formula in the SeekOne MM 3' single cell library construction kit and uniformly mixing:
1.6 Adding the prepared reverse transcription reaction system into a microporous plate, sealing the opening, and reacting at the following temperature condition;
1.7 After completion, the chip chamber was emptied by injecting 450. Mu.L of air using a pipette, and then 450. Mu.L of 1 XPBS was added to rinse the chip; after repeating the steps twice, the microporous chip is horizontally placed to 4 ℃ for storage in a refrigerator. Care was taken not to invert the chip to prevent the exchange of the capture beads between the microwells causing RNA contamination between cells.
2. Double-stranded synthesis of cDNA on magnetic beads in microporous chip
2.1 Preparing a double-chain synthetic reagent according to the following formula of a kit (NEB # E7770S) and mixing uniformly:
2.2 The microwell chip in which reverse transcription was completed in example 1 was taken out, and 450. Mu.L of air was injected using a pipette to empty the cavity of the chip; then 400. Mu.L of prepared double-chain synthesis reagent is injected, and after sealing, the reaction is carried out for 1 hour at the temperature of 16 ℃:
2.3 After completion, the chip chamber was emptied by injecting 450. Mu.L of air using a pipette, and then 450. Mu.L of 1 XPBS was added to rinse the chip; after repeating the steps twice, the microporous chip is horizontally placed to 4 ℃ for storage in a refrigerator. Care was taken not to invert the chip to prevent the exchange of the capture beads between the microwells causing RNA contamination between cells.
3. Disruption of cDNA and ligation of cell tags Using transposase
3.1 The transposase reaction solution was prepared in 400. Mu.L and mixed well according to the following protocol:
3.2 Removing the microwell chip which has completed reverse transcription or duplex synthesis in example 1 or example 2, and injecting 450. Mu.L of air using a pipette to empty the chip chamber; then 400 mul of prepared transposase reaction liquid is injected, the chip is placed on a PCR instrument for reaction at 55 ℃ for 15 minutes and then is cooled to 10 ℃;
3.3 After the reaction is finished, washing the chamber of the chip for 3 times by using PBS (phosphate buffer solution) and adding 450 mu L of cell barcoded beads with the diameter of about 30 mu m, wherein the beads can be magnetic beads or hydrogel microbeads; specific nucleic acid sequences carried by the cell barcode beads are shown in the following table, wherein a cleavable group can be a PClinker which can be cleaved by light or an S-S bond which can be cleaved by a reducing agent, and the two nucleic acid modifications are synthesized by Shanghai primer synthesizers;
3.4 A linking reaction system is configured according to the following system and added into a microporous plate, and the linking reaction is completed by cracking for 1min by using ultraviolet light and then reacting for 15min at 22 ℃.
4. Amplification, library construction and sequencing analysis
4.1 The magnetic plate was placed on top of the microwell chip after the ligation was completed in example 3, a pipettor was used to rapidly inject 1000 μ LPBS to blow out the magnetic beads suspended in the chip chamber, and 10mM Tris solution was used to wash twice and then added to the following amplification reaction system for amplification after blowing up uniformly to add the library adaptor and the sample tag:
sorting the PCR products by using DNA clean beads to obtain a library, wherein the size of the library is shown in FIG. 5;
example 2
This example provides the construction of a single cell full sequence transcriptome library from PBMC. The difference from example 1 lies in step 2 and step 4.
The difference of step 2 is that in this example, the step 1 is directly followed by step 3 without performing the double-strand synthesis.
The difference part of the step 4 is only the difference of an amplification enzyme system, and the amplification system is as follows:
comparative example 1
The PBMC cells were subjected to library construction according to the operating method described in SeekOne MM 3' single cell transcriptome kit of Beijing Ming science and technology.
Test examples
The sequencing strategy of the illumina NovaSeq 6000 is shown in FIG. 4. The positions of the detected nucleic acid sequences in the RNA and the gene factors detected for each cell were analyzed using bioinformatics methods. As shown in FIGS. 5 to 7, the distribution of the obtained nucleic acids in example 1 is shown in FIG. 5A, the distribution of the obtained nucleic acids in comparative example 1 is shown in FIG. 5B, the distribution of the nucleic acids in example 2 is shown in FIG. 6, and the numbers of genes measured in examples 1 to 2 and comparative example 1 are shown in FIG. 7, it was shown that the method of the present invention is more uniformly distributed over the entire length of RNA than the conventional 3' single cell library (SeekOne MM 3' transcriptome library), and the number of genes measured per cell is significantly higher than that of the 3' single cell library.
The above is only a preferred embodiment of the present invention, and it is not intended to limit the scope of the invention, and various modifications and changes will occur to those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention shall be included in the scope of the present invention.
Claims (3)
1. A method for labeling the complete sequence of a single cell, which is characterized by comprising the following steps:
step S1, providing RNA to be detected, wherein the RNA to be detected comes from a plurality of cells;
step S2, obtaining the double-stranded product by adopting any one mode of the step (a) or the step (b):
adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain an mRNA/cDNA heterozygous chain, namely the double-stranded product;
adding a reverse transcription reaction system into the RNA to be detected, carrying out reverse transcription reaction to obtain a first cDNA chain, and carrying out double-chain synthesis by using the first cDNA chain as a template to obtain a double-chain product;
s3, performing transposition reaction on the double-stranded product by using transposase to obtain a plurality of fragmentation products of a plurality of cells, wherein the transposase contains a transposon sequence;
s4, connecting the plurality of fragmentation products with a plurality of cell tags in a one-to-one correspondence manner, wherein the plurality of fragmentation products of the same cell are connected with the same cell tag, and the plurality of fragmentation products of different cells are connected with different cell tags, so as to obtain a marked single cell complete sequence;
wherein the step S1 includes the steps of:
step S101, providing a plurality of cells to be detected and a plurality of detection areas, and depositing the cells to be detected in the detection areas in a one-to-one correspondence manner;
s102, cracking each cell to be detected in each detection area, and enriching target RNA to obtain the RNA to be detected;
step S103, providing an enrichment body, wherein a reverse transcription primer and a template conversion sequence homologous sequence are coupled to the enrichment body;
step S104, providing cell RNA containing target RNA, and enriching the target RNA in the cell RNA on the enrichment body to obtain the RNA to be detected;
the step S2 includes the steps of:
step S201, adding a reverse transcription reaction system into the RNA to be detected, and performing reverse transcription reaction to obtain a cDNA first chain, wherein the reverse transcription reaction system contains a template switching sequence and reverse transcriptase, and the template switching sequence contains a sequence which is the same as a homologous sequence of the template switching sequence;
step S202, carrying out in-situ amplification by taking the first cDNA chain as a template and the homologous sequence of the template switching sequence as a primer to obtain a double-chain product;
the step S4 includes:
step S401, providing a plurality of labeled microbeads, wherein each labeled microbead comprises a microbead body and a plurality of functional sequences containing the same cell label, the cell labels of the functional sequences of the labeled microbeads are different, each functional sequence further comprises a joint 1 'which can be connected with the transposon sequence, the joint 1' is connected with one end of the cell label, and the microbead body is connected with the other end of the cell label and can be conditionally broken away from the cell label;
step S402: mixing a plurality of fragmentation products of a plurality of cells with a plurality of labeled microbeads, connecting the adaptor 1' with the transposon sequence, and applying conditions to break the microbead body and the cell label to obtain a labeled single cell complete sequence, wherein the plurality of fragmentation products of the same cell are correspondingly mixed with the same labeled microbeads, and the plurality of fragmentation products of different cells are mixed with different labeled microbeads.
2. A method for constructing a high-throughput single-cell complete-sequence transcriptome library is characterized by comprising the following steps of:
obtaining the labeled single cell complete sequence by using the single cell complete sequence labeling method of claim 1;
and performing index PCR on the marked single cell complete sequence, enriching the marked single cell complete sequence, and introducing a sequencing joint sequence and a library label to obtain a high-throughput single cell complete sequence transcriptome library.
3. A sequencing method of a high-throughput single-cell complete sequence is characterized by comprising the following steps:
constructing a high-throughput single-cell full-sequence transcriptome library by the method of claim 2;
sequencing the high-throughput single-cell full-sequence transcriptome library by using a sequencing platform.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211315126.9A CN115386624B (en) | 2022-10-26 | 2022-10-26 | Single cell complete sequence marking method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211315126.9A CN115386624B (en) | 2022-10-26 | 2022-10-26 | Single cell complete sequence marking method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115386624A CN115386624A (en) | 2022-11-25 |
| CN115386624B true CN115386624B (en) | 2023-03-21 |
Family
ID=84128087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211315126.9A Active CN115386624B (en) | 2022-10-26 | 2022-10-26 | Single cell complete sequence marking method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115386624B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113026110A (en) * | 2019-12-25 | 2021-06-25 | 苏州绘真生物科技有限公司 | High-throughput single-cell transcriptome sequencing method and kit |
| CN113444770B (en) * | 2020-03-27 | 2023-05-30 | 中国人民解放军陆军军医大学 | Construction method and application of single-cell transcriptome sequencing library |
| EP4279609A1 (en) * | 2020-12-31 | 2023-11-22 | Beijing Institute of Genomics, Chinese Academy of Sciences (China National Center for Bioinformation) | Method and kit for labeling nucleic acid molecules |
| CN115198000B (en) * | 2022-07-21 | 2023-07-21 | 北京寻因生物科技有限公司 | Method for constructing single-cell complete sequence transcriptome library |
| CN115198001B (en) * | 2022-07-21 | 2023-07-04 | 北京寻因生物科技有限公司 | Construction method and application of single-cell complete sequence transcriptome library |
-
2022
- 2022-10-26 CN CN202211315126.9A patent/CN115386624B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN115386624A (en) | 2022-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11427856B2 (en) | Methods and kits for labeling cellular molecules | |
| CN107002292B (en) | A kind of construction method and reagent in the twin adapter single stranded circle library of nucleic acid | |
| CN113106150B (en) | Ultrahigh-throughput single cell sequencing method | |
| CN110129415B (en) | NGS library-building molecular joint and preparation method and application thereof | |
| CN108138364B (en) | Construction method and reagent of nucleic acid single-stranded circular library | |
| WO2013056640A1 (en) | A method for preparing a nucleic acid library, its uses and kits | |
| CN108315387B (en) | Micro cell ChIP method | |
| CN105524920B (en) | TN5 for Ion Proton microarray datasets builds the primer sets, kit and banking process in library | |
| CN114107459B (en) | High-throughput single cell sequencing method based on oligonucleotide chain hybridization marker | |
| CN111379031A (en) | Nucleic acid library construction method, obtained nucleic acid library and application thereof | |
| CN106591285B (en) | A method of constructing the library Hi-C of high availability data rate | |
| WO2022161294A1 (en) | Construction method and use of medium-throughput single-cell copy number library | |
| CN115198001B (en) | Construction method and application of single-cell complete sequence transcriptome library | |
| CN115386622B (en) | Library construction method of transcriptome library and application thereof | |
| CN112410331A (en) | Linker with molecular label and sample label and single-chain library building method thereof | |
| CN114729349A (en) | Method for detecting and sequencing barcode nucleic acid | |
| CN111471746A (en) | NGS library preparation joint for detecting low mutation abundance sample and preparation method thereof | |
| CN105296602B (en) | Method and kit for quickly constructing plasma DNA sequencing library | |
| CN115386624B (en) | Single cell complete sequence marking method and application thereof | |
| CN117089597A (en) | Single cell library construction sequencing method and application thereof | |
| CN115386966B (en) | DNA appearance modification library building method, sequencing method and library building kit thereof | |
| US20240182962A1 (en) | Ultra-high-throughput single cell sequencing method | |
| CN115261389A (en) | Functional sequence, label group containing functional sequence and application | |
| CN116694730A (en) | Construction method of single cell open chromatin and transcriptome co-sequencing library | |
| CN116497105B (en) | Single-cell transcriptome sequencing kit based on terminal transferase and sequencing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |