CN1153825A - Sequential detection method for DNA basic group sequence and sample regulation method using for said method - Google Patents

Sequential detection method for DNA basic group sequence and sample regulation method using for said method Download PDF

Info

Publication number
CN1153825A
CN1153825A CN 96112561 CN96112561A CN1153825A CN 1153825 A CN1153825 A CN 1153825A CN 96112561 CN96112561 CN 96112561 CN 96112561 A CN96112561 A CN 96112561A CN 1153825 A CN1153825 A CN 1153825A
Authority
CN
China
Prior art keywords
mentioned
sequence
base sequence
dna
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 96112561
Other languages
Chinese (zh)
Inventor
神原秀记
冈野和宣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hitachi Ltd
Original Assignee
Hitachi Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hitachi Ltd filed Critical Hitachi Ltd
Priority to CN 96112561 priority Critical patent/CN1153825A/en
Publication of CN1153825A publication Critical patent/CN1153825A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for DNA analysis based on a complementary extension reaction using a DNA polymerase, and a method for preparation of a DNA sample which can be efficiently used for the DNA sequencing method, as well as a reagent kit for use in therein.

Description

The sequence measurement of DNA base sequence and be used for the sample modulator approach of this method
The modulator approach of the sample that the present invention relates to utilize the DNA complementary strand synthetic DNA analysis method of being undertaken, is used for high efficiency DNA base sequence sequence measurement and the test kit that is used for this method by enzyme.
Along with progress, the requirement of the sequencing technologies of high efficiency DNA base sequence has been improved people's group group analytic technique.Use the labelled with radioisotope dna fragmentation, measure DNA length, utilize the method for manually determining base sequence replaced at present again by the gel electrophoresis method.With DNA fluorescent substance mark, carry out illumination while carry out gel electrophoresis then, thereby automatically the sequenator of optical detection dna fragmentation (DNA Sequencers) is popularized.This device is hybridized the oligonucleotide and the target DNA that are called as primer (primer), make the dna fragmentation that the complementary strand that is used to use enzyme synthesizes to determine all lengths of base sequence, utilize gel electrophoresis to measure the length of dna fragmentation, and then the method for definite base sequence is called Sang Ge (Sanger) (dna sequencing) method or two deoxidation (dideoxy) sequencing., can once determine the length of base sequence herein, depend on the length separating power of utilizing gel, be the 400-700 base.To spend a large amount of time and manpower than this longer order-checking from K base of number to the DNA base sequence of tens of K base.
Before, air gun (Shotgun) method commonly used when determining the base sequence of long DNA (the tens of K bases of number K-).In shotgun, utilize ultrasonic wave etc. that the DNA sample is cut off randomly, the dna fragmentation clone is implanted in the colibacillus etc. cultivates, turn out bacterium colony after, cultivate the colibacillus in each bacterium colony, increase the replica of DNA.Extracting sample DAN then resolves.In the method, the sample DNA that contains fragmentation among the DNA that in each bacterium colony that takes out, contains, but dna fragmentation is which part of sample DNA actually, this is determining that before the base sequence be there is no telling, resolves so must get the dna fragmentation that will determine the DAN chain length that is equivalent to 10-20 times.Therefore will expend a large amount of time and manpower, this becomes very big obstacle.
Determine the base sequence of DNA, from making the DNA library, collect in this library whole DNA behind the clone from the 10K base to 100K base length that the DNA that will contain gene forms.In fact when determining base sequence, each clone is further cut off, utilize the dna sequencing instrument to make the subclone of the length that can be used for analyzing, carry out the order-checking of base sequence then.To determine the dna fragmentation reorganization of sequence at last, obtain original base sequence of DNA completely.Aforesaid method is because of simple to operate, so be used widely.
But plan from present people's group group order-checking,, consider it to be the best approach (mathematical and physical science No.359, May, (1993) PP74-81) from production efficiency and automatization aspect as large-scale base sequence sequence measurement.Will make subclone in advance when particularly utilizing the dna sequencing instrument to measure, this bothers very much.Before, subclone was to utilize ultrasonic wave to cut off at random huge DNA and carry out synthetic (" Molecular Cloning " secondedition.Cold Spring Harbor Laboratory Press (1989) PP13.21-13.23).Subclone is inserted colibacillus cultivate and obtain bacterium colony, again the bacterium colony that obtains is separated, obtain the target DNA of fragmentation respectively.Each bacterium colony is carried out the order-checking of DNA base sequence with containing the plasmid that separates the dna fragmentation that obtains then.Usually, the DNA base length that 1 base sequence operation can determine is 300 base to 500 bases, so must resolve a large amount of subclones.
In addition,, have a lot,, must analyze 10 times to 20 times base length of the actual base sequence part that will determine so have to repeatedly same DNA base sequence partly be checked order because contain the bacterium colony of same DNA fragment part even obtained bacterium colony.In the reality, when determining the DNA base sequence of 10K base length, the plasmid (subclone) more than 400 must be resolved, but, subclone can not be selected for base sequence information is repeated.In addition, the preparation subclone will utilize place kind, the carrier system of colibacillus, so complicated operation is difficult to realize automatization.
Needn't determine repeatedly in the base sequence sequence measurement of same base sequence that primer (Primer walking) method (Science 258 (1992) PP1787-1791, Proc.Natl.Acad.Sci.U.S.A.866917-6921 (1989)) of advancing is arranged.In primer is advanced method, huge dna direct is used as sample DNA.At first determine the part base sequence of sample DNA.Then, based on the DNA base sequence of having determined, synthetic primer of hybridizing specifically on the part of having determined base sequence is determined the DNA base sequence of remaining part.That is, will determine the method that the base sequence of the dna fragmentation of base sequence is determined in order since an end.In primer is advanced method, the base sequence that repeats to determine partly can be reduced to minimum, but all must synthetic primer, very trouble when determining base sequence at every turn.In addition, the base sequence measurement operation is because become (Sequential) of order, so be not only limited to suitable large scale sequencing.
Tested the whole bag of tricks for solving the advance numerous and diverse property of life of method of cloning and primer.Likely especially is to utilize restriction enzyme to form dna fragmentation sample DNA, directly measures the method (DNA Research1 (1994) PP231-237) of base sequence then from the state of mixture, below this method of explanation.Be each dna fragmentation that identification utilizes the DNA restriction enzyme to cut off, the oligonucleotide that will have known base sequence utilizes ligation to import the end of the dna fragmentation that is formed by the DNA restriction enzyme.Use the primer sets (Primer set) to debate that the severed segment that is not formed by restriction enzyme reaches, is connected with this severed segment then, carry out serial response from the unknown base sequence of 1 base to 4 base.Primer sets partly is under the situation of 2 bases when unknown base sequence for example, is combined to form by the base sequence of 16 kinds of whole bases.Article 2, the chain DNA fragment is under 3 kinds of situations about (having 6 kinds as the DNA end), can directly use above-mentioned primer sets to determine the base sequence of each dna fragmentation from mixture.Determine after the base sequence of each dna fragmentation, the base sequence of each dna fragmentation is rebuild, obtain all base sequences.For obtaining all base sequences, the primer of the base sequence that near 3 ' terminal base sequence of synthetic and each dna fragmentation is identical, DNA before cutting off is carried out the base sequence sequencing reaction as template, determine the base sequence between dna fragmentation and dna fragmentation, can determine the combination between dna fragmentation thus.In addition, determining the base sequence of the dna fragmentation that cut off by other restriction enzyme, is clue with the rearrangement of base sequence, and then the interconnected relationship of definite dna fragmentation.
As mentioned above, the order-checking of the base sequence of Chang DNA is to be undertaken by needs cost great amount of manpower and the process of time in the past.Use the method for subclone, because can carry out the base sequence order-checking of a plurality of dna fragmentations (subclone) simultaneously, thus just be widely used, but must repeat to read same base sequence part, if the scale of base sequence order-checking becomes big, then exist to spend huge manpower and the problem of time.In addition,, determined that then the reconstruction of each dna fragmentation of base sequence becomes very difficult, the problem of the DNA base sequence of the length that existence is can not recomposition original if reduce repetition for raising the efficiency.
In primer is advanced method,, determined clearly advantage of base sequence annexation partly so have because usually be to begin to synthesize next primer and use from the part of having determined base sequence.But the order-checking of base sequence is must be since an end of 1 DNA chain basically, carry out hundreds of bases successively at every turn, therefore its processing power is limited, and the synthetic primer can not be to having determined the good function of part performance of base sequence, all the order-checking of base sequence becomes very difficult, and this is the problem that exists at present.In the method for the base sequence of the dna fragmentation of determining to obtain, because will know connection between dna fragmentation, so there is the problem that need expend huge manpower by restriction enzyme.
For addressing the above problem, the 1st purpose of the present invention is to provide a kind of sequence measurement of base sequence, this method, when determining the base sequence of sample DNA, in the time of with the base sequence determined as the dna fragmentation of target, can determine at least a portion with the base sequence of the sample DNA of target dna adjacency.
For finishing the 1st purpose, the present invention has following formation.
The of the present invention the 1st base sequence sequence measurement that constitutes (A) is characterised in that and comprises following each operation:
(A1) operation of sample DNA being utilized the restriction enzyme cut-out obtain dna fragmentation reaches
(A2) 3 ' the terminal operation that imports the oligonucleotide (for example oligonucleotide of being made up of single base kind) with specific base sequence that goes up at dna fragmentation reaches
(A3) will import segmental 1 chain of DNA of oligonucleotide as template, the 3rd base sequence that use partly reaches and utilize base sequence complementary the 2nd base sequence of restriction enzyme identification partly to reach, form from the base combination of the scope of 1 base to 4 base by at least a portion to the 1st base sequence of mending with the base sequence of oligonucleotide is partly formed, and be labeled the labeled primer of (for example fluorescent labelling), carry out the synthetic extension of complementary strand, obtain having mark with 1 chain complementary base sequence of dna fragmentation extend primer operation and
(A4) make (a) will import 1 chain of dna fragmentation of oligonucleotide as template, the applying marking primer carry out serial response operation and, (B) will have 1 chain of the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA as template, the extension primer of applying marking carries out the operation of serial response, respectively or the operation of carrying out simultaneously and,
(A5) resultant with serial response carries out electrophoresis, determine dna fragmentation base sequence and, with the base sequence of at least a portion of the sample DNA of the base sequence adjacency of dna fragmentation, determine the operation of base sequence of the sample DNA of the part longer than dna fragmentation, in operation (A3), (A4), use the heat resistant poly synthase in addition, the change condition repeats operation (A3), (A4) respectively to obtain the extension primer and the serial response resultant of the mark of sufficient amount for several times.
The of the present invention the 2nd base sequence sequence measurement that constitutes (B) is characterised in that to have following each operation:
(B1) operation of sample DNA being utilized the cut-out of the 1st restriction enzyme obtain dna fragmentation reaches
(B2) use primer that 1 chain of dna fragmentation is carried out after the extension as template, with the operation of the nucleotide subsitution of 3 ' terminal and fluorescent labelling and,
(B3) the complementary strand utilization that (B2) generated 2nd restriction enzymes different with the 1st restriction enzyme cut off, obtain 3 ' terminal go up by the operation of the fluorescent labelling primer of fluorescent labelling reach,
(B4) use the fluorescent labelling primer, 1 chain that will have the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA is as template, carry out serial response operation and,
(B5) resultant with serial response carries out electrophoresis, determines the base sequence with at least a portion of the adjacent sample DNA of the base sequence of dna fragmentation, determines the operation of base sequence of the sample DNA of the part longer than the length of dna fragmentation.
The of the present invention the 3rd base sequence that constitutes (C) is determined that method is characterised in that and is comprised following each operation:
(C1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(C2) use primer, it is synthetic that 1 chain of dna fragmentation is carried out complementary strand as template, obtain having with the operation of 1 chain complementary base sequence of dna fragmentation and,
(C3) use primer, 1 chain that will have the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA is as template, carry out on the end of extended chain, importing fluorescent labelling serial response operation and
(C4) utilize the operation of the resultant of restriction enzyme shutoff sequence reaction to reach,
(C5) will utilize the resultant of the serial response of restriction enzyme cut-out to carry out electrophoresis, determine the base sequence with at least a portion of the adjacent sample DNA of the base sequence of dna fragmentation, determine the operation of base sequence of the sample DNA of the part longer again than the length of dna fragmentation.
The of the present invention the 4th constitutes the base sequence sequence measurement of (D), is characterised in that altogether to comprise following operation:
(D1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(D2) use the fluorescent labelling primer, it is synthetic that 1 chain of dna fragmentation is carried out complementary strand as template, obtain having with the operation of the primer of 1 chain complementary base sequence of dna fragmentation and,
(D3) will have 1 chain of the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA as template; Use primer carry out serial response operation and,
(D4) resultant with serial response carries out electrophoresis, the base sequence of at least a portion of the sample DNA that base sequence definite and dna fragmentation is adjacent, the operation of the base sequence of the sample DNA of the part that the length of definite dna fragmentation is longer again.
The of the present invention the 5th base sequence sequence measurement that constitutes (E) is characterised in that and comprises following each operation:
(E1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(E2) use on dna fragmentation, select complementary strand in conjunction with by the 1st primer of fluorescent labelling and, have with 1 chain complementary base sequence of dna fragmentation by the 2nd primer of fluorescent labelling, 1 chain and the dna fragmentation that will have the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent and sample DNA mix as template, carry out serial response operation and,
(E3) resultant with serial response carries out electrophoresis, determine dna fragmentation base sequence and, with the base sequence of at least a portion of the adjacent sample DNA of the base sequence of dna fragmentation, determine the operation of base sequence of the sample DNA of the part longer again than the length of dna fragmentation.
The of the present invention the 6th base sequence that constitutes (F) is determined that method is characterised in that and is comprised following each operation:
(F1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(F2) with 1 chain of dna fragmentation as template, make primer generation extension, obtain 1 chain DNA operation and,
(F3) use 1 chain DNA, 1 chain that will have the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA is as template, carry out serial response operation and,
(F4) resultant with serial response carries out electrophoresis, determines the base sequence with at least a portion of the adjacent sample DNA of the base sequence of dna fragmentation, determines the operation of base sequence of the sample DNA of the part longer than the length of dna fragmentation again.
The of the present invention the 6th base sequence that constitutes (G) is determined that method is characterised in that and is comprised following operation:
(G1) will have a part of complementary base sequence with the base sequence of 1 chain of the dna fragmentation that obtains from sample DNA and be used in the primer that 3 ' end has and carry out the synthetic extension of complementary strand, obtain having with the operation of the extension primer of a part of complementary base sequence of 1 chain of dna fragmentation and,
(G2) make (a) with 1 chain of dna fragmentation as template, use primer carry out serial response operation and, (b) will have 1 chain of the part of 1 chain of sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA as template, use and extend the operation that primer carries out serial response, the operation of carrying out reaches
(G3) resultant with serial response carries out electrophoresis, determine dna fragmentation base sequence and with the base sequence of at least a portion of the adjacent sample DNA of the base sequence of dna fragmentation, determine the operation of base sequence of the sample DNA of the part longer again than the length of dna fragmentation.
In addition, in above base sequence sequence measurement, can utilize restriction enzyme that sample DNA is cut off and obtain dna fragmentation, but be not limited to this method, also can utilize ultrasonic wave etc. that sample DNA is cut off at random and obtain dna fragmentation.Also can utilize additive method to modulate dna fragmentation in addition from sample DNA.
Base sequence sequence measurement of the present invention (utilizes extension to connect down one by one the base sequence of dna fragmentation.Below method of the present invention is called the fragment method (fragment walking method) of advancing), be described in detail following, this method is made up of following each operation:
(1) sample DNA is utilized restriction enzyme form segmental operation,
(2) utilize terminal part that restriction enzyme investigation is connected with the severed segment that is identified from the base kind of 1 base to 4 base and the length of dna fragmentation, be identified for the primer of serial response operation,
(3) will carry out electrophoresis by the dna fragmentation that restriction enzyme obtains, according to length carry out the fractionated operation,
(4) dna fragmentation 3 ' terminal go up the operation that imports known oligonucleotide,
(5) use and on 3 ' end, to have for distinguishing the fluorescent labelling primer by the base sequence that forms from 1 base to 4 base of dna fragmentation, the dna fragmentation that will be distinguished as template carry out complementary strand synthetic operation,
(6) dna fragmentation that the applying marking primer is distinguished carries out the complementary strand that operation reaches, use is generated by operation (5) of serial response as template, to have and carried out the operation of serial response as template by the part of the sample DNA of identical base sequence of the dna fragmentation distinguished and the base sequence that is adjacent or sample DNA, respectively or the operation of carrying out simultaneously,
(7) resolve the resultant of the serial response that obtains by operation (6), thereby from the base sequence that obtains obtain the dna fragmentation distinguished base sequence and, determine the arrangement of each dna fragmentation the sample DNA with the adjacent base sequence of the dna fragmentation of being distinguished, determine the operation of the base sequence of the sample DNA longer again than the length of the dna fragmentation of being distinguished.
In fragment is advanced method, can be with the order-checking expeditiously at short notice of long DNA base sequence.Usually, utilize restricted by cutting enzyme cut-out DNA, generate a lot of dna fragmentations, but can be from cut off the directly definite base sequence of dna fragmentation that reaction obtains by restriction enzyme, the tumor-necrosis factor glycoproteins of the base sequence that is determined by exploration, can be through clone or subclone, redundancy that just can be very little (low redundancy) is determined whole base sequence of very long DNA.
In fragment is advanced method, use the primer library of synthetic in advance 16 kinds of minorities, utilize the restriction enzyme of sample DNA to cut off the optionally serial response that dna fragmentation is carried out in reaction.A plurality of dna fragmentations are determined base sequence side by side, are extended for the resultant that imports serial response by the primer of fluorescent labelling, and meanwhile generation and each dna fragmentation complementary are by the extension primer of fluorescent labelling.This is by the primer of extending of the length of fluorescent labelling, as using with the sample DNA that cuts off reaction without the conditionality restriction endonuclease primer as template.Cut off in the selectivity serial response liquid of each dna fragmentation that reacts at the restriction enzyme that utilizes sample DNA, interpolation is cut off the sample DNA of reaction as template without the conditionality restriction endonuclease, base sequence with each dna fragmentation, with the base sequence of the adjacent sample DNA of this dna fragmentation, by being determined with the resultant by the serial response of the extension primer of the length of fluorescent labelling of sample DNA as template.
Because can be with the base sequence of each dna fragmentation, the base sequence that determine to surpass the adjacent sample DNA of this and this dna fragmentation of place of incision of restriction enzyme, so based on these base sequences that are determined, by seeking the multiple base sequence, to the dna fragmentation transition adjacent, just can determine whole base sequence of sample DNA since 1 dna fragmentation with this dna fragmentation.In this method, the length of the DNA that can read is not the length of dna fragmentation, and the sample DNA that will cut off reaction without the conditionality restriction endonuclease utilizes serial response to determine as template.Therefore, all base sequences can be determined with the state of very little redundancy.
In addition, the additional instruction fragment method of advancing, in fragment was advanced method, the sample DNA that will determine base sequence utilized restriction enzyme such as 4 bases identification enzyme to cut off fully, makes no multiple slice groups.In the dna fragmentation that generates, if remove this part the base sequence that cuts off through restriction enzyme identification, then base sequence the unknown.These dna fragmentations especially do not have the initiation point (Priming Site) that complementary strand synthetic starting point is hybridized and become to the primer that has known base sequence.Therefore conduct causes point in conjunction with the oligonucleotide with known base sequence on 3 ' end side of the dna fragmentation that generates.When making the hybridization of primer and dna fragmentation utilize the synthetic preparation of complementary strand DNA extended chain, 2 bases (being called distinguishing sequence) of 3 ' end of primer are complementary fully with dna fragmentation, the moment of closely hybridizing reacts, but if not so constantly, then reaction is very slow or do not carry out fully, and this is known.Therefore go up at fluorescent labelling primer 3 ' terminal (complementary strand extension side) and connect 2 bases (16 kinds of base sequences are arranged) arbitrarily, from dna fragmentation, select to have specific fragment with fluorescent labelling primer fully-complementary sequence, it is synthetic to carry out complementary strand, can determine base sequence (DNA Research1/231-237 (1994)).
The kind of the dna fragmentation that contains in the dna fragmentation group is few, when being 1 with a kind of complete complementary dna fragmentation of primer, can determine each segmental base sequence respectively with above-mentioned primer.When a kind of primer and the hybridization of the dna fragmentation more than 2, carry out in advance carrying out aforesaid operations after the length separation etc.In primer is advanced method, the base that is in the dna fragmentation of admixture can be consulted row like this, needn't use that 16 kinds of primers are cloned etc., just can repeatedly simply not determine side by side.Determine the connection that dna fragmentation is mutual, and carry out as follows during the whole base sequence of definite sample DNA.Above-mentioned 16 kinds of fluorescent labelling primers only have the sheet segment DNA that causes point with end and hybridize, and do not hybridize with the original sample DNA that does not cut off.If extend but will carry out complementary strand with the above-mentioned primer of dna fragmentation hybridization, then part of Yan Shening and original sample DNA complementation are hybridized with original sample DNA.Therefore, when stating primer in the use and carrying out the complementary strand synthesis reaction of base sequence order-checking usefulness of each dna fragmentation, under the cyclic sequence condition of lifting temperature of reaction, carry out, in case in reaction solution, add the sample DNA that does not cut off, except the base sequence of dna fragmentation, can also determine the base sequence of the original sample DNA that is connected with cut-out portion.Use 16 kinds of different primers in the method, each dna fragmentation and the base sequence that connects thereon can be determined that side by side efficient is very high.This method because good as if from a dna fragmentation to next dna fragmentation by connecting the base preface to advancing step by step, so be called the fragment method of advancing.
The fragment method of advancing is the very high method of a kind of efficient, must prepare 16 kinds of primers that 3 ' 2 terminal bases all make up as primer.Monochromatic mode is arranged now (with the terminal bases kind of a kind of phosphor body identification dna fragmentation in the fluorescent formula dna sequencing instrument, make the diverse dna fragmentation swimming of terminal bases with different swimming routes) and 4 look modes (the terminal bases kind corresponding to dna fragmentation is discerned with 4 kinds of phosphor bodies, make the dna fragmentation swimming with same swimming route), but, preferably adopt 4 look modes in order to reach high efficiency.If but the above-mentioned fragment method of advancing is applicable to 4 look modes, and then minimumly must prepare 16 * 4=64 fluorescent labelling primer, this advances aspect method practical in fragment is a problem.
The 2nd purpose of the present invention is, address the above problem, provide a kind of in order just to implement advance used sample modulator approach in the DNA analysis method, DNA base sequence sequence measurement of method and be used for the test kit of this method of fragment at an easy rate at hand with commercially available universal primer or the minority that has primer.
For finishing the 2nd purpose, the present invention has following formation.
Among the present invention, use has the primer of distinguishing of anchor, this distinguishes that primer is that the band anchor that has anchor on the primer that has on the 3 ' end by the distinguishing sequence of 2 based compositions is distinguished primer (following for the easy anchor primer that is called), increases copy number as the dna fragmentation of template with PCR (Polymerase chain reaction).The complementary strand of anchor part is imported at the end of dna fragmentation, carries out the base sequence sequencing reaction but fluorescent labelling primer and anchor are partly hybridized.Anchor primer (shared 16 kinds) on the fluorescent labelling primer that uses, uses 4 kinds of used in common order-checking phosphor bodies universal primer of mark respectively not by necessity of fluorescent labelling in the base sequence order-checking.
16 kinds of anchor primers with the specific DNA fragments hybridization in the hybrid dna fragment, carry out complementary strand and extend, and are used to increase the copy number of specific dna fragmentation.Its result from the mixture of dna fragmentation, has only increased the dna fragmentation that anchor primer is hybridized fully, can select specific dna fragmentation in fact.On the dna fragmentation that is selected, import the part of fluorescent labelling primer hybridization, can carry out serial response.That is, use the common fluorescent labelling primer of the base sequence with the primer that can become common polymeric enzyme reaction, the kind that need not increase the fluorescent labelling primer promptly can be carried out the fragment method of advancing at an easy rate.
Example as such fluorescent labelling primer has, and that uses on the M13 serial carrier has a base sequence (sequence sequence number 1)
The primer of 5 '-TGTAAAACGAC GGCCAGT-3 ', what be used for the T7 serial carrier has a base sequence (sequence sequence number 2).
The primers of 5 '-GTAATACGACTCACTATAGGGC-3 ' etc. except the primer that is commonly referred to as general primer, can also utilize the fluorescent labelling primer with arbitrary sequence.Certainly can also utilize known phosphor body as fluorescent labelling.
Constitutive characteristic of the present invention following detailed description, the sample modulator approach that relates in the formation of the present invention (a) is characterised in that and comprises following operation:
(1) sample DNA is utilized restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have oligonucleotide, and with the sequence of utilizing restriction enzyme identification in fact the complementary sequence and, have by the selection sequence of 1-4 based composition, at the anchor primer that 5 ' end side has the anchor sequence more than at least 8 Nucleotide (octamer) at 3 ' end side, carry out complementary strand synthesize the operation that obtains the DNA chain reach,
(4) use and to have identical in fact with the anchor sequence at least sequence, not directly and the sample DNA primer of hybridizing, the DNA chain that is obtained by operation (3) carries out complementary strand synthetic operation as template.
The sample modulator approach that relates in the formation of the present invention (b) is characterised in that and comprises following operation:
(1) sample DNA cut off is generated a plurality of length dna fragmentation operation and
(2) dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have with oligonucleotide essence be the complementary base sequence and, 3 ' end side have for distinguish the anchor primer that has the anchor sequence more than at least 8 Nucleotide by the sequence of the dna fragmentation of 1-4 based composition, at 5 ' end side with, have and the practically identical base sequence of anchor sequence, when using separately and the primer that can not stably hybridize of dna fragmentation, dna fragmentation is distinguished each terminal base sequence, carried out the operation that PCR amplifies.
The base sequence of the definite DNA chain that relates in the formation of the present invention (c) and be characterised in that with the base sequence sequence measurement of the base sequence of the sample DNA of the adjacent part of base sequence of DNA chain and comprise following operation:
(1) sample DNA is utilized the restricted enzyme of cutting cut off, generate a plurality of length dna fragmentation operation and,
(2) dna fragmentation at least 3 ' end side import base sequence be known oligonucleotide operation and,
(3) use have oligonucleotide, and with the identification part sequence of utilizing restriction enzyme identification in fact the complementary sequence and, 3 ' end side have a part of base that has anchor sequence at least 8 Nucleotide more than, an identification part sequence by the distinguishing sequence of 1-4 based composition, at 5 ' end side be substituted, can not utilize the base sequence part that restriction enzyme cuts off anchor primer and, the primer of the base sequence of being limited property restriction endonuclease cut-out, utilize PCR with the operation of specific dna fragmentation amplification reach,
(4) cut off an end of the specific dna fragmentation be exaggerated, obtain the DNA chain operation and,
(5) use and to have at least the sequence practically identical, directly do not send out the fluorescent labelling primer with sample DNA hybridization with the anchor sequence, the DNA chain that will obtain by operation (4) as template carry out the synthetic operation that obtains dna fragmentation of complementary strand and,
(6) use fluorescent labelling primer and complementary strand synthetic DNA fragment, the DNA chain that will be obtained by operation (4), sample DNA carry out the operation of serial response as template,
Its feature is that also the fluorescent labelling primer has identical in fact with the anchor sequence at least sequence.
The base sequence of determining the 1st, the 2nd DNA chain that relates in the formation of the present invention (d) and with the 1st, the determination of alkali base sequence of the base sequence of the sample DNA of the adjacent part of the base sequence of 2DNA chain, it is characterized in that this method comprises following each operation:
(1) sample DNA is utilized the 1st restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) dna fragmentation at least 3 ' end side import operation that base sequence is known, as to have the identification part sequence that is obtained by the 2nd restriction enzyme oligonucleotide and,
(3) use has oligonucleotide, and with the identification part sequence of utilizing the 1st restriction enzyme identification come down to the complementary sequence and, have by the 1st of 1-4 based composition at 3 ' end side and to select sequence, has the 1st anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of identification part sequence is replaced, have the 1st of the base sequence part that can not be cut off by the 1st restriction enzyme retouch decide primer and, has oligonucleotide, and with the identification part sequence of utilizing the 1st restriction enzyme identification in fact the complementary sequence and, has the 2nd selection sequence that forms by 1-4 base at 3 ' end, has the 2nd anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of oligonucleotide is by metathetical, have and to be utilized PCR that the operation that specific dna fragmentation amplifies is reached by the 2nd anchor primer of the base sequence part of the 2nd restriction enzyme cut-out;
(4) the 1st of the specific dna fragmentation that will be exaggerated the terminal cut off, obtain the 1DNA chain, utilize the 1st restriction enzyme to cut off the 2nd end of the specific dna fragmentation that is exaggerated with the 2nd restriction enzyme, the operation that obtains the 1DNA chain reaches,
(5) use have identical in fact with the 1st anchor sequence at least sequence, not with the 1st fluorescent labelling primer of sample DNA direct cross and, have identical in fact with the 2nd anchor sequence at least sequence, not with sample DNA on the 2nd fluorescent labelling primer of direct cross, will by operation (4) obtain the 1st, that the 2DNA chain carries out complementary strand as template is synthetic, obtain the segmental operation of the 1st, the 2nd complementary strand synthetic DNA and,
(6) use the 1st, the 2nd fluorescent labelling primer and the 1st, the 2nd complementary strand synthetic DNA fragment, will by operation 4 obtain the 1st, 2DNA chain, sample DNA carry out the operation of serial response as template;
Its feature also is: the 1st fluorescent labelling primer has and the 1 identical sequence of anchor sequence essence at least, and the 2nd fluorescent labelling primer has and the 2 identical sequence of anchor sequence essence at least.
Formation e of the present invention relates to a kind of test kit, it is characterized in that by have with ligation with few a tree, used in making timber for boats thuja acid complementary base sequence and, the identification part sequence of restriction enzyme identification and, the sequence identical, have by the selection sequence of 1-4 based composition, can select a plurality of anchor primers of base sequence of the end of dna fragmentation to form at 3 ' end side with general primer, anchor primer is characterised in that, select the selection sequence of sequence of 2 bases of dna fragmentation end, contain the base sequence of the whole combinations that form by 2 bases.
Formation of the present invention (f) relates to a kind of test kit, it is characterized in that, at least by the ligation oligonucleotide, in the synthetic test kit of complementary strand with the primer composition, complementary strand synthetic with primer comprise by with oligonucleotide complementary sequence in fact, the identification part sequence of restriction enzyme identification reaches, 3 ' end side of this identification part sequence have the 1st primer sets (primer set) formed by 16 kinds of primers of the selection sequence of 2 based compositions and, 5 ' end side at each primer of the 1st primer sets imports the anchor sequence, the 2nd primer sets that the base of the part of the identification part sequence of each primer is formed by 16 kinds of primers of metathetical.
Formation of the present invention (g) relates to a kind of test kit, it is characterized in that, in the test kit of forming with oligonucleotide, complementary strand synthetic primer by ligation at least, complementary strand is synthetic comprise with primer have oligonucleotide, and with the identification part sequence of utilizing the identification of the 1st restriction enzyme in fact the complementary sequence and, have by the 1st selection sequence of 1-4 based composition, have the 1st anchor sequence more than at least 8 Nucleotide at 3 ' end side at 5 ' end side; A part of base of identification part sequence is substituted, have the base sequence part that can not be cut off by the 1st restriction enzyme the 1st anchor primer group and, by oligonucleotide, and with the identification part sequence of utilizing the 1st restriction enzyme identification in fact the complementary sequence and, have by the 2nd of 1-4 based composition at 3 ' end side and to select sequence, has the 2nd anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of oligonucleotide is substituted, having can not be by the 2nd anchor primer group of the base sequence part of the 2nd restriction enzyme cut-out, its feature also is: the 1st, the 2nd base of selecting sequence comprises the base sequence by whole combinations of 2 based compositions by 2 based compositions.
Formation of the present invention (h) relates to a kind of analytical procedure, it is characterized in that analyzing the synthetic sample of sample modulator approach by constituting (a) and (b).
With reference to the present invention of Fig. 1 brief description, for finishing the 1st purpose, dna fragmentation 3 as template, is used fluorescent labelling primer 31 synthetic complementary strands, obtain extended DNA chain 32.The extended DNA chain as primer, as template, is carried out serial response with sample DNA 1, obtain DNA extended chain 33.Electrophoretic separation extended DNA chain 33, can determine simultaneously dna fragmentation base sequence and, with the base sequence of at least a portion of the sample DNA 1 of dna fragmentation adjacency.
According to the present invention, utilizing that restriction enzyme cuts off that sample DNA obtains, adding the very long dna fragmentation of the base sequence that contains the segmental 3 ' end side of target dna that uses as the sample DNA before determining to cut off or base sequence in the mixture of dna fragmentation, under this state, carry out the base sequence sequencing reaction, can determine the base sequence of the dna fragmentation part of adjacency on the segmental 3 ' end side of target dna fragment and target dna simultaneously.The method according to this invention, in the base sequence of each dna fragmentation of determining to utilize restriction enzyme to obtain, dna fragmentation partly the base sequence adjacent can be determined simultaneously, the connection of the base sequence between each dna fragmentation can be determined with each dna fragmentation.
Therefore, needn't use a plurality of restriction enzymes to determine the overlap of the base sequence of each dna fragmentation, can determine base sequence expeditiously.In addition, needn't use subclone, all only in vitro react, just can determine the base sequence of very long sample DNA.In addition, advance as primer, needn't be at every turn synthetic primers when determining base sequence all, can determine the base sequence of each dna fragmentation, can determine the connection of the base sequence between each dna fragmentation.That is, the base sequence of a plurality of dna fragmentations that needn't repeated resolution be obtained by sample DNA can be determined the base sequence of sample DNA.
With reference to the present invention of Figure 12 brief description, for finishing the 2nd purpose, utilize N1aIII to cut off sample DNA 1, in the liquid 320 that contains dna fragmentation group 303, add DNA oligonucleotide 304,3 ' the terminal DNA oligonucleotide of going up in conjunction with known base sequence 304 at the restriction enzyme place of incision, the liquid that will contain oligonucleotide conjugates injects 16 test tubes respectively, add different primers respectively (at 3 ' end, the distinguishing sequence that has the discriminant function that has dna fragmentation on the anchor sequence of 5 ' end side), it is synthetic to carry out complementary strand, and resultant is carried out gel electrophoresis.Use the gel electrophoresis spectrum of product, necessary PCR is with distinguishing primer when determining dna fragmentation PCR amplified.The container that liquid in the test tube 323 places the number of combinations (K) of PCR respectively will be taken to respectively, in each container, add PCR with distinguishing primer, use anchor primer, and the performing PCR that is combined into of the primer of primer sets amplify, the methods such as dna fragmentation utilization dialysis that obtain is refining, as utilizing the fragment method of advancing to carry out the template of base sequence order-checking usefulness.
Use primer sets to determine the method for base sequence, because the primer quantity of being prepared by the system that uses the polychrome instrumentation is a lot, bother very much, but anchor primer of the present invention has the dna fragmentation discriminant function, therefore uses a spot of primer that has existed can determine the base sequence of very long sample DNA simply.In addition, utilize the primer that has the different severed segment that to utilize the restriction enzyme cut-out at the two ends of DNA chain to carry out PCR, can determine base sequence simultaneously since 2 ends of 2 chains expeditiously.
The accompanying drawing simple declaration
Fig. 1 is the schema of the processing sequence of the expression embodiment of the invention 1.
Fig. 2 is in the embodiment of the invention 1, uses the fluorescent labelling primer, the dna fragmentation that the HhaI that utilizes pUC19 is cut off as the electrophorogram of the extension resultant of template,
Fig. 3 is in embodiments of the invention 1, utilize pUC19 the PCR resultant restriction enzyme HhaI the cut-out resultant the isolating fraction of agar-agar gel electrophoresis electrophorogram,
Fig. 4 is in embodiments of the invention 1, uses the fluorescent labelling primer, with the dna fragmentation of fraction 4 as the electrophorogram of the extension resultant of template,
Fig. 5 A, 5B, 5C, 5D, 5E are in the embodiments of the invention 1, the electrophorogram of the base sequence sequencing reaction resultant that obtains by fraction 1,
Fig. 6 A, 6B, 6C, 6D, 6E are in the embodiments of the invention 1, the electrophorogram of the base sequence sequencing reaction resultant that obtains by fraction 4,
Fig. 7 be pUC19 in the embodiments of the invention 1 base sequence order-checking explanatory view,
Fig. 8 is in the embodiments of the invention 2, uses the fluorescent labelling primer, the HhaI that utilizes λ-DNA is cut off the dna fragmentation that obtains as the electrophorogram of the extension resultant of template,
Fig. 9 for the expression embodiments of the invention 4 processing sequence schema,
Figure 10 for the expression embodiments of the invention 5 processing sequence schema,
Figure 11 for separate in the embodiments of the invention 5 with system's configuration example diagrammatic sketch of the sequence of operations of base sequence order-checking,
Figure 12 for explanation use sample modulator approach of the present invention DNA process of analysis figure,
Figure 13 represents the DNA oligonucleotide is connected the bonded dna fragmentation;
Figure 14 A for combine the DNA oligonucleotide after the end of DNA chain (1 chain) the anchor primer group of hybridizing concept map, Figure 14 B for combine the DNA oligonucleotide after the end of DNA chain (1 the chain) primer sets of hybridizing concept map,
Figure 15 represent for illustration figure, Figure 16 of the gel electrophoresis spectrum of using 16 kinds of complementary strand synthetic products of selecting the dna fragmentation that primers obtain the dna fragmentation that is detected structure example,
The presentation graphs of one example of the product that Figure 17 obtains for the complementary strand synthetic (PCR amplification) that utilize to use anchor primer,
Figure 18 be graph of a relation with anchor primer, labeled primer and dna fragmentation of selecting sequence,
Figure 19 has the anchor primer of selecting sequence for using, and distinguishes dna fragmentation, carries out PCR determines the method that primer is right before in advance with a spot of dna fragmentation explanatory view.
Following with reference to accompanying drawing detailed description embodiment.
Embodiment 1
Fig. 1 is the schema of the processing sequence of the expression embodiment of the invention 1.Embodiment 1 carries out above-mentioned operation (5) and operation (6) continuously, determine simultaneously selecteed dna fragmentation base sequence and, with the continue base sequence of sample DNA together of the base sequence of this selecteed dna fragmentation.Also can carry out operation (5) and operation (6) simultaneously.Adopt pUC19 as sample.
(amplification of sample DNA)
Sample DNA adopts PCR that sample DNA 1 is amplified after a little while in the following order.At first, for cyclic pUC19 is made the straight chain shape, the pUC19 of 10pmol was cut off with 1 hour in 37 ℃ with 100 unitary Pst1.Carry out ethanol sedimentation by usual way, obtain straight catenate pUC19.Then, use ATP and 12 unitary terminal deoxynucleotidyl transferases of 1mM, after importing the PolyA sequence on the 3 ' end at the pUC19 two that cuts off, hybridize as the primer that PCR uses.
As primer, use has base sequence and is:
TTTTTTTTTTT TTTGCAGGC (sequence number 3), and,
Two kinds of primers of TTTTTTTTT TTTTTGCAGGT (sequence number 4).Use 96pmol two kinds of each primers and, the Pst1 of the pUC19 of the importing PolyA of 5fmol cut off thing and, the dATP of each 30nmol, dCTP, dGTP, dTTP and, 15 unitary TaqDNA polysaccharases carry out PCR.Each load responsive fluid is defined as 4800 μ l.Each reaction solution carries out thermal cycle reaction after being divided into 96 branches such as grade.Thermal cycle reaction, during through 94 ℃ 30 seconds, in the time of 47 ℃ 30 seconds, 5 minutes circulation in the time of 72 ℃, carry out 2 times after, during again with 94 ℃ 30 seconds, in the time of 55 ℃ 30 seconds, 5 minutes circulation was carried out 35 times in the time of 72 ℃.
In order to remove unreacted primer and dATP, dCTP, dGTP, dTTP, agarose gel electrophoresis with 0.7% divides to separate to be got, the high purity PCR product of being made up of one of the long band of 2.7K base during as electrophoresis obtains the chain pUC19 of about 15pmol.Below, pUC19 is called the PCR product with this chain, as sample DNA 1.
(fragmentation of sample DNA)
Adopt restriction enzyme to make the dna fragmentation that the pUC19PCR product is cut off.In the present embodiment, use Hhal as restriction enzyme, but the restriction enzyme of cut-out sample DNA 1 (pUC19PCR product) is not limited in enzyme Hhal.Among Fig. 1,12,13,14 expressions are by the fragment part of the restriction enzyme generation of sample DNA.Tris-HCl (10mM, pH7.5), MgCl 2(10mM), in the solution of NaCl (50mM), dithiothreitol (DTT) (1mM), make the pUC19PCR product reaction of 84 unitary Hhal and 5.5pmol.This reacts on 37 ℃ and carried out 1 hour.After the reaction, use the part of reaction solution,, on 3 ' end of dna fragmentation, introduce known base sequence according to the method that on 3 ' end of dna fragmentation, imports oligonucleotide described later.
Then, carry out extension with 16 kinds of primers (sequence number 5).The extension product is analyzed by electrophoresis with each of 16 kinds of primers.Fig. 2 illustrates analytical results.At Fig. 2, among Fig. 4,39 expression base length, the swimming peak value of 38 expression primers, 37 expressions are because the electrophoretic patten of the dna fragmentation that primer extension produces, and 40 represent 2 base sequences that primers have.Based on the result of Fig. 2, by electrophoretic separation, divide the extension products of getting each primer, become 1 class as far as possible.
Get about branch, Hhal is cut off reaction solution separate by 2% agarose gel electrophoresis immediately, obtain four fractions of the 1st to the 4th.As shown in Figure 3, the from the 1st to the 4th four fractions obtain having four kinds of electrophoretic pattens 91,92,93,94 that separate bands of the 1st to the 4th respectively.Each band of DNA size indicia 90 is arranged as from bottom to up: 100 bases are long, 200 bases are long, 300 bases are long ..., and 100 bases long.
(on 3 ' end of dna fragmentation, importing oligonucleotide)
The method that imports the oligonucleotide with known base sequence on 3 ' end of dna fragmentation has 2 kinds.The 1st kind of method is the method that imports the oligonucleotide with known base sequence by ligation on dna fragmentation, only imports oligonucleotide on 3 ' end of dna fragmentation.In 2 chain oligonucleotide that ligation is used, 3 ' end of 2 chain oligonucleotide that the ligation of the side of will joining with 5 ' end of dna fragmentation is used is made the form of di-deoxynucleoside acid.Perhaps, remove 5 ' phosphoric acid of dna fragmentation in advance.This be because, if import unnecessary oligonucleotide, then enter unexistent base sequence in the original DNA chain in the DNA complementary strand that can in operation (5), generate at 5 ' end side of dna fragmentation, the edge that operation (6) does not start is consolidated.The 2nd kind of method is to use terminal deoxynucleotidyl transferase (hereinafter referred to as terminal enzyme (DNA)), on 3 ' end of dna fragmentation, import in turn dATP (2 '-Desoxyadenosine 5 '-triphosphate) or dTTP (2 '-deoxythymidine 5 '-triphosphate) method.The 2nd kind of method is simpler than the 1st kind of method, and efficient is also high, therefore adopts the 2nd kind of method in the present embodiment.
Position in order to ensure fluorescent dye primer can be hybridized imports the PolyA sequence on 3 ' end of each dna fragmentation.When importing the PolyA sequence, adopt terminal deoxynucleotidyl transferase.Reaction conditions is as follows.In each fraction of about 4pmol, add dATP (1mM), CoCl 2(5mM), MgCl 2(5mM), mercaptoethanol (0.5mM), sodium dimethylarsonate (50mM, PH7.2), make 12.5 unitary terminal deoxynucleotidyl transferases in 37 ℃ of reactions 1 hour.
(the selectivity complementary strand is synthetic)
As shown in Figure 1, the dna fragmentation 2,3 that makes has the PolyA part 21 that imports at 3 ' end side, restriction enzyme identification division 23, and selecteed base sequence part 22.Selecteed base sequence part 22 is 2 base portions selecting by fluorescent dye primer 31.
By the dna fragmentation that restriction enzyme obtains, is the mixture of numerous species dna fragmentation by sample.In order only optionally to determine base sequence, use fluorescent dye primer 31 as target DNA fragment 3.Any base sequence part 201 of fluorescent dye primer 31 is to be combined by any 2 kinds of bases, all is 16 kinds.The PolyT part 203 of fluorescent dye primer 31 and the PolyA part 21 of dna fragmentation 3, and the restriction enzyme identification division 23 of the restriction enzyme identification division 202 of fluorescent dye primer 31 and dna fragmentation 3 can be hybridized separately fully.
As complete crossbred 51, any base sequence part 201 of fluorescent dye primer 31 can only be hybridized with the dna fragmentation 3 that has with any base sequence part 201 complementary base sequences 22.Yet, in the imperfect hybridization body 52, base sequence part 201 and dna fragmentation 2 arbitrarily, its terminal portions is not hybridized, and 16 kinds of fluorescent dye primers and dna fragmentation are reacted, and just can pick out target DNA fragment.
In fact by the following method, only select the fluorescent dye primer that can when base sequence is determined, utilize in advance, and then carry out base sequence and determine reaction.At first, in each fraction of the DNA of the dna fragmentation that contains the 200fmol that has an appointment mixture, add the mixing solutions (16 μ l), the MgCl that contain dATP (0.1mM), dCTP (16mM), dGTP (0.1mM), dTTP (0.1mM) 2Tris-HCl (75mM) (250mM, PH9.5) damping fluid (8 μ l),, total amount is 48 μ l, is divided in 16 containers by each container 3 μ l.Add the Taq DNA polymerase (0.5 μ l) of each fluorescent dye primer (0.001mM, 0.5 μ l) and 2 unit/μ l in each container.The Taq DNA polymerase that uses is than common widely used Taq polysaccharase, the Δ Taq that is more improving aspect elongation property and the substrate specificity TMOr ThermoSequenase TM(any all is the goods of Amersham International company) is more effective.Its reason is that as common Taq polysaccharase, the situation that extension stops in the specific base sequence part often produces.The thermal cycling that kept 60 seconds when keeping 30 seconds → 72 ℃ when keeping 30 seconds → 66 ℃ during with 94 ℃ is carried out 5 times repeatedly, with electrophoresis analytical reaction product.
Divide the analytical results before getting shown in Fig. 2, divide analysis (electrophoresis) result of the fraction 4 (providing the fraction of Fig. 3 electrophoresis Figure 94) after getting shown in Fig. 4.Each electrophorogram of 2 base sequences 40 of any base sequence part 201 of the primer with use is shown.
In electrophorogram with dna fragmentation shown in Fig. 4, that select by primer with 2 base sequence XY (XY represents the combination of any 2 bases), except that the electrophoresis peak value 38 of primer, all do not occurring under the situation of peak value, there is not the dna fragmentation with the primer reaction in expression.Among Fig. 4, in the electrophorogram of the dna fragmentation of being selected by the primer with 2 base sequence AA, only detect 1 swimming peak value, the expression primer is only hybridized with a kind dna fragmentation, and the base sequence of following explanation determines to become possibility.
Among Fig. 2 and Fig. 4, the electrophorogram (for example, having the segmental electrophorogram of being selected by the primer of 2 base sequence GG shown in Fig. 4 of DAN) that 2 above swimming peak values occur illustrates, and the fluorescent dye primer of use and a plurality of dna fragmentation are hybridized.Electrophorogram with dna fragmentation of being selected by the primer of 2 base sequence GG shown in Fig. 4 illustrates, have the fluorescent labelling primer of GG as any base sequence part 201, play a part fluorescent dye primer with respect to 2 kinds of dna fragmentations, only a kind of NDA fragment with specific base sequence is carried out base sequence when determining, can not use to have GG as the fluorescent dye primer of base sequence part 201 arbitrarily.
Yet, in Fig. 4, the swimming peak value in the left side in the dna fragmentation electrophorogram of selecting by primer in 2 approaching swimming peak values with 2 base sequence GG and, the swimming peak value of the electrophorogram of the dna fragmentation of selecting by primer with 2 base sequence CA, on the base of equal length, has peak value, the swimming peak value on the right side in the dna fragmentation electrophorogram of selecting by primer in 2 approaching swimming peak values with 2 base sequence GG and, the swimming peak value of the dna fragmentation electrophorogram of selecting by primer with 2 base sequence AA, on the base of equal length, has the swimming peak value, the dna fragmentation that gives equal length base (swimming time) has the inside and outside (+chain of 2 chains,-chain) relation, therefore, use with the restriction enzyme identification division of dna fragmentation adjacent, have 2 base sequence CA and GG, or the primer of 2 base sequence AA and GG, by PCR, can isolate 2 kinds of dna fragmentations selecting by primer with 2 base sequence GG.
More than in the explanation, be so that describe as an example with the segmental situation of primer DNA isolation with any base sequence of forming by 2 base XY (XY represents the combination of any 2 bases), have by 3 base XYZ (XYZ represents the combination of any 3 bases) but also can be to use, or the primer DNA isolation fragment of any base sequence of 4 base WXYZ (WXYZ represents the combination of any 4 bases) composition.As mentioned above, can pick out fluorescent dye primer used when determining base sequence at an easy rate in advance.
(complementary strand is synthetic, and base sequence is determined)
Then, using the fluorescent dye primer of selecting to carry out base sequence determines.The example that the fraction of electrophoresis Figure 91 shown in the presentation graphs 3 (fraction 1) and 94 (fractions 4) is used as dna fragmentation is shown herein.Analysis (electrophoresis) result of the fraction after getting by branch, can distinguish fraction 1, and in the fraction 4, fluorescent dye primer and a kind of dna fragmentation that any base sequence part 201 is AA are hybridized, therefore base sequence part 201 fluorescent dye primer 31 that uses AA arbitrarily below carries out the base sequence of the dna fragmentation of fluorescent primer 31 hybridization and determines.
In order to read the base sequence with the adjacent part 14 of dna fragmentation 3 simultaneously, behind the PCR product (sample DNA 1) that interpolation can not be cut off with Hhal, carry out base sequence and determine reaction (serial response).Fluorescent dye primer 31 is hybridized fully with the dna fragmentation 3 that has imported PolyA, but is not hybridized with sample DNA 1.Dna fragmentation 3 as template and complementary strand synthetic extended DNA chain 32 is hybridized with sample DNA 1, is formed DNA extended chain 33 by serial response.In the DNA base sequence was determined, if base length is elongated, then the dna fragmentation number reduced, so signal strength weakening.
The strength of signal of the DNA extended chain 33 that obtains in order to make free extended DNA chain 32 to extend reaches enough intensity, only use dNTP (mixture of dATP, dCTP, dGTP and dTTP) in advance, extend the 5 ' end of fluorescent primer 31 to dna fragmentation 3, make in a large number after the extended DNA chain 32, use extended DNA chain 32 that sample DNA 1 is carried out serial response as template, can obtain DNA extended chain 33 effectively.Just, after a large amount of making play the extended DNA chain 32 of primer effect to the sample DNA that does not cut off, add di-deoxynucleoside acid carrying out base sequence and determine reaction.The details of reaction below is shown.In the fraction 1 of each dna fragmentation that comprises about 100fmol, or in the fraction 4, adding fluorescent dye primer 31 (1pmol/ μ l) respectively is that 2 μ l, dNTP are 4 μ l, contains 75mM MgCL 2Tris-HCl (250mM, pH9.5) damping fluid be 2 μ l, total amount is 14 μ l, be 3.5 μ l by each container then, be injected into respectively in 4 containers, in 4 containers of dispensing, add Taq archaeal dna polymerase (Δ Taq polysaccharase (ア マ ッ ャ system company) 0.5 μ l) by each container 2 unit/μ l.60 seconds thermal cycling of maintenance is 5 times repeatedly when keeping 30 seconds → 72 ℃ when keeping 30 seconds → 64 ℃ during with 94 ℃, makes the extended DNA chain 32 that fluorescent primer 31 extends to 5 of dna fragmentation 3 ' end in a large number.
Then, in the reaction solution that contains a large amount of this extended DNA fragments 32, add PCR product (sample DNA 1), the di-deoxynucleoside acid (ddNTP) of 12.5fmol respectively, and the mixed solution of deoxynucleotide (4.5 μ l).Di-deoxynucleoside acid and deoxynucleotide composed as follows:
As A reaction usefulness, dNTP is 0.020mM, and ddATP is 1.0mM;
As C reaction usefulness, dNTP is 0.020mM, and ddCTP is 0.50mM;
As G reaction usefulness, dNTP is 0.020mM, and ddGTP is 0.10mM;
As T reaction usefulness, dNTP is 0.020mM, and ddTTP is 1.0mM; The thermal cycling that keeps 60 seconds when keeping 30 seconds → 72 ℃ when mixed solution is carried out keeping 30 seconds → 64 ℃ 94 ℃ the time 30 times repeatedly.Carry out ethanol sedimentation to reclaim reaction product, determine with carrying out base sequence after the fluorescence formula dna sequencing instrument electrophoretic separation reaction product.
Obtain clearly electrophorogram, Fig. 5 A～Fig. 5 E illustrates the electrophoresis result from the hybrid dna sample of fraction 1, fraction 4 respectively among Fig. 6 A～Fig. 6 E.Fig. 5 A, Fig. 6 A illustrate fluorescent primer 31 respectively and extend back 3 ' terminal bases with the A slice groups of A as end,
It is terminal C slice groups that Fig. 5 B, Fig. 6 B illustrate respectively with C,
It is terminal G slice groups that Fig. 5 C, Fig. 6 C illustrate respectively with G,
Fig. 5 D, Fig. 6 D illustrate T respectively and are terminal T slice groups,
Fig. 5 E, Fig. 6 E are the figure that repeats A, C, each dna fragmentation group electrophorogram of G, T respectively.Electrophoresis Figure 41,42,43 is basis separately: by the dna fragmentation (the DNA extended chain 34 shown in Fig. 1) that dna fragmentation 3 is generated as the sequencing reaction of template, fluorescent primer 31 extends to that 5 of dna fragmentation 3 ' terminal afterreaction stops and the dna fragmentation (the extended DNA chain 32 shown in the figure) that generating, and extended DNA chain 32 (Fig. 1) is combined in DNA and goes up the DNA extended chain 33 that further extend the back.
According to former base sequence sequence measurement, only may obtain electrophoresis Figure 41,42, but press present embodiment, then can in the base sequence of determining dna fragmentation 3, determine base sequence with dna fragmentation 3 consecutive sample DNAs.In the present embodiment, suppose that long sample DNA is cut off fully by 4 bases identification Restriction Enzyme, even but can not be safely by under the situation of 4 bases identification Restriction Enzyme cut-out, if in the sum of long sample DNA molecule, for example 20%～30% can be cut off fully by 4 bases identification Restriction Enzyme, just can determine base sequence without any problem ground, and then, surpassed by the desirable part of cutting off of restriction enzyme, also can determine at least a portion base sequence by the adjacent dna fragmentation of restriction enzyme cut-out.
In the present embodiment, from the dna fragmentation that sample DNA 1 is cut off by restriction enzyme, any base sequence part 201 Hes of 3 ' end side of fluorescent dye primer 31, be in the dna fragmentation of complementary relationship with restriction enzyme identification division 23 adjacent and selecteed base sequence parts 22, can select by fluorescent dye primer 31, and can optionally carry out sequencing reaction.The annealing temperature (anealing temperature) of the primer when complementary strand forms is set in more than 60 ℃, preferably in 62 ℃～68 ℃ scope, can further improve selectivity.
Complementary strand is synthetic, is that 3 of the dna fragmentation 3 of hybridizing from fluorescent dye primer 31 ' terminal carries out to 5 ' end direction.During common DNA base sequence sequencing reaction,, stop extension at the position that imports di-deoxynucleoside acid owing to adding di-deoxynucleoside acid as any specific base kind among A, C, G or the T.Extended DNA chain 32 is to arrive 5 of dna fragmentation 3 ' terminal DNA chain.Do not add under the situation of di-deoxynucleoside acid, extended DNA chain 32 arrives 5 ' end of dna fragmentation 3.As template,, also reach DNA chain portion 14 with sample DNA 1, therefore also can determine the base sequence of DNA chain portion 14 above the restriction enzyme recognition site with the sequencing reaction of dna fragmentation extended DNA chain 32 as primer.In case, make synthetic and extended DNA chain 32 that generate by complementary strand, play a part the primer of sample DNA 1, then must break away from and become 1 chain from template DNA fragment 3, and this disengaging be to be undertaken by the thermal cycling order-checking by thermally denature.With respect to template DNA (dna fragmentation 3, and sample DNA 1) primer (fluorescent primer 31, and extended DNA chain 32) hybridization (for example, in the time of 64 ℃ 30 seconds), complementary strand extension reaction (for example, in the time of 72 ℃ 60 seconds), the cycle sequencing that each operation that makes the primer of extension break away from template DNA by thermally denature is formed for example carries out 30 times repeatedly.By this cycle sequencing, can obtain simultaneously to extend to dna fragmentation 34 He in dna fragmentation 3 way as template with dna fragmentation 3, with sample DNA 1 as template and the DNA extended chain 33 of extended DNA chain 32 extensions.Consequently, can determine dna fragmentation 3 base sequence and with at least a portion of the base sequence of the sample DNA at the adjacent position of 3 of dna fragmentation 3 ' end.As for other dna fragmentation, can determine too each dna fragmentation base sequence and with at least a portion of the base sequence of the sample DNA of 3 of dna fragmentation ' terminal adjacent regions.
Utilize each dna fragmentation that restriction enzyme obtains base sequence and, base sequence position with the sample DNA of 3 of each dna fragmentation ' terminal adjacency, overlapping with near other 5 ' base sequence terminal of dna fragmentation, therefore can be at an easy rate the base sequence of each dna fragmentation be coupled together.And, owing to the electrophoresis peak value that clearly observes the primer extension body 32 that produces by complementary strand synthesis reaction, therefore can differentiate the cutting part of restriction enzyme in sample DNA at an easy rate until dna fragmentation 3 ends.In fact, it is several to utilize the present embodiment method to determine that base sequence decides the dna fragmentation that is cut off by the Hhal of pUC19 to have, and investigates the contact of the base sequence of each dna fragmentation, and the base sequence of the whole length of pUC19 just can be determined without cloning.
Fig. 7 illustrated among the embodiment 1, the determining of the base sequence of pUC19 (base total length 2.7Kbp).Among Fig. 7, the position that ↓ expression is cut off by restriction enzyme Hhal, near the numerical value of ← → expression (for example, 270,393 etc.) expression is by the length (base number) between the position of restriction enzyme cut-out, mold shaft is represented base length,-→ and ←-represent that respectively the base sequence in the present embodiment determines the position, with → and ← parallel represented-, expression and the adjacent base sequence position (the base sequence part of the base sequence contact details of each dna fragmentation is provided) of dna fragmentation that cuts off by the Hhal that determines object as base sequence.And then among Fig. 7, base sequence is determined position 770, is the position by the electrophorogram shown in Fig. 6 decision, be by the base sequence part of dna fragmentation 770-1 and, form with the base sequence part 770-2 of the part of the adjacent dna fragmentation of dna fragmentation 770-1.As shown in Figure 7, provide by effective utilization each dna fragmentation base sequence contact details base sequence part-information, just can determine that the base total length is the full base sequence of the pUC19 of 2.7Kbp.
Embodiment 2
In the present embodiment, obtain through cloning under the situation of long sample DNA, restriction enzyme used when cloning by using cuts off the length dna fragment that sample DNA obtains, as sample DNA 1.With regard to examples of applications among the λ DNA method of the present invention is described.In order to determine base sequence, use 16 kinds of (for any base sequence position of selecting dna fragmentation is under the situation of 2 bases) primers in advance, it is synthetic to carry out complementary strand, and correct judgement dna fragmentation how long with what kind exists, and it is successful key that the branch that carries out which kind of dna fragmentation is taken as.
Shown in Fig. 8, with λ DNA (47.7K base long), the dna fragmentation that cuts off with HhaI is as template, carries out extension and the electrophorogram of the reactant that obtains with fluorescent dye primer.As shown in the figure, press original state of reactant, the dna fragmentation number is too much, and the branch of dna fragmentation is got difficulty.Huge sample DNA as λ DNA, in advance, for example have no progeny through 6 bases identification restriction enzyme digestion, after going out the dna fragmentation that cuts off by restriction enzyme by electrophoretic separation, divide and get, each dna fragmentation that branch was got further cuts off with 4 bases identification Restriction Enzyme, and is identical with pUC19 situation among the embodiment 1, can determine base sequence.For example, use PstI, use HhaI as 4 bases identification Restriction Enzyme as 6 bases identification Restriction Enzyme.
Embodiment 3
Usually, in many researchs department, in store with the form in DNA library through the length dna that cloning obtains.And the clone who carries out the definite DNA field of base sequence finishes.According to the present invention, even under the situation that the clone has finished, just can determine base sequence efficiently without subclone.For example, as template, pUC19 is defined as sample DNA 1 with the straight chain dna that restriction enzyme Pst1 cuts off.Present embodiment, from using the straight chain shape pUC19 that cuts off by Pst1, different with embodiment 1 as sample DNA 1 this point.Below, adopt the symbol identical to describe with used symbol among Fig. 1.With 100 unitary Pst1,, cut off the pUC19 of 10pmol in 37 ℃ of costs 1 hour.According to usual method, carry out ethanol sedimentation.Therefore Pst1 can obtain linearly pUC19 at 1 local pUC19 that cuts off.
Below, determine base sequence by method similarly to Example 1.With linearly pUC19, cut off back preparation dna fragmentation with restriction enzyme Hhal, by agarose gel electrophoresis, be divided into 3 kinds of fractions, from 16 kinds of fluorescent dye primers, pick out the fluorescent primer 31 that uses in the sequencing reaction.Use fluorescent primer 31, obtain extended DNA chain 32 by extension.Then, pUC19 as template, is extended the back with extended DNA chain 32 and obtains the DNA extended chains, determine base sequence by method similarly to Example 1.Its result, can determine specific dna fragmentation 3 base sequence and, and the base sequence of the sample DNA 1 (pUC19) that link up adjacent with 3 of dna fragmentation 3 ' end.
Embodiment 4
If the length of dna fragmentation more than the base, just is difficult to obtain the dna fragmentation of sufficient amount from 400 bases to 500, in gel electrophoresis, except the strength of signal from dna fragmentation dies down, the problem that also has the separation energy of DNA chain length to reduce.Below the method that addresses this problem with Fig. 9 explanation.
Cut off by the 1st restriction enzyme on 3 ' end of the dna fragmentation 501 that obtains behind the sample DNA 500, by method importing PolyA similarly to Example 1.With dna fragmentation 501 as template, the fluorescent dye primer 502 (being called the 1st primer) that employing is hybridized on restriction enzyme identification division and the unknown base sequence part that linking to each other with the restriction enzyme identification division, carry out serial response, by fluorescence formula dna sequencing instrument, the dna fragmentation 550 of synthetic all lengths is carried out electrophoretic separation, thereby determine the base sequence of dna fragmentation 501.Prepare biotinylation primer 504 then with biotin labeling the 1st primer.
Carry out complementary strand with the fragment 501 that has imported PolyA as template and synthesize, obtain complementary strand synthetic DNA fragment 530.After in maintaining the bead of avidin (beads) 510, capturing reaction, from reaction solution, take out complementary strand synthetic DNA fragment 530.Then, by having the enzyme dna polysaccharase of fluorescent mark dNTP511 and 3 ' exonuclease activity, decompose 3 of complementary strand synthetic DNA fragment 530 ' terminal (reaction of 3 ' → 5 ' exonuclease), and add new fluorescent mark dNTP511, obtain on 3 ' end, to have fluorescently-labeled fluorescent label DNA 512 (3 ' terminal recognition reaction).
Herein, formerly to determine the base sequence of the dna fragmentation 501 of base sequence, near the 2nd restriction enzyme of 2 chain DNAs 3 of dna fragmentation 501 ' end is cut off in decision.Cut off fluorescent label DNA chain 512 by the 2nd restriction enzyme, obtain to become the 2nd primer 513 of short fluorescent dye primer.With sample DNA 500 is template, by serial response 503, extend the 2nd primer 513 after, press the same method of embodiment 1, determine base sequence.Much less, also can be with sample DNA 500 as template by serial response, after extending in 3 ' end and having fluorescently-labeled fluorescent label DNA chain 512, cut the ennation of the 2nd primer 513 again by the 2nd restriction enzyme.The 2nd primer 513 is a part of complementary with sample DNA 500.The ennation of the 2nd primer 513 that generates by serial response, have only part to shorten by the identification of the 2nd restriction enzyme, the product of serial response can detect with high sensitivity with fluorescence formula dna sequencing instrument up to longer dna fragmentation length, can more correctly determine base sequence.
Embodiment 5
Use the 2nd restriction enzyme, with different in order to generate the 1st used restriction enzyme of dna fragmentation in embodiment 4, with this 2nd restriction enzyme, cut off fluorescent label DNA chain 512, but in the present embodiment, with the DNA chain that uses the fluorescent mark terminator to extend, after being used to make the restriction enzyme cut-out of dna fragmentation, determine and the adjacent base sequence of dna fragmentation.Figure 10 illustrates the handling procedure of present embodiment.
For example, cut off sample DNA 700, obtain dna fragmentation 701,702,703,704 with restriction enzyme Hhal.Then, use on 3 ' end, to have the 1st primer 710 of distinguishing base sequence, make the complementary strand of target DNA fragment 702.5 ' side of the 1st primer 710 is used vitamin H 711 marks in advance.Use the fixing bead 712 of avidin that is fixed with avidin on the surface, draw the 1st primer 750 that complementary strand extends, after removing dna fragmentation 702,, be used as the primer (being called the 2nd primer 750) of serial response with 1 chain that the 1st primer 710 extends as template.
Also can use the magnetic bead instead and draw the 2nd primer without the fixing bead 712 of avidin.The 2nd primer and sample DNA 700 are mixed, add serial response liquid and carry out serial response, obtain on 3 ' end, to have fluorescently-labeled dna fragmentation 720.Then, cut off, remove the 2nd primer 750 with restriction enzyme Hhal, obtain dna fragmentation 721 after, by fluorescence formula dna sequencing instrument dna fragmentation 721 is carried out electrophoresis, thereby determines base sequence.According to present embodiment, can determine the base sequence (that is, can determine dna fragmentation 703 base sequences) of the sample DNA 700 of adjacency on the 3 ' end of dna fragmentation 702 of the 1st primer 710 hybridization.
Embodiment 6
Shown in embodiment 2, by determining of the base sequence of the sample DNA of the length of tens of K based compositions, at first be to cut off sample DNA with 6 bases identification Restriction Enzyme, pass through electrophoretic separation then, after branch is got, each dna fragmentation that branch was got cuts off with 4 bases identification Restriction Enzyme again, adopts the method that illustrates in the various embodiments described above, just can determine whole base sequences.Above-mentioned separation and base sequence are determined, can under the control of computer, carry out automatically, carry out the total system that above-mentioned separation and base sequence are determined, by tripping device, carry out the device (automatic gear) of serial response, the high efficiency dna sequencing instrument of picture kapillary group electrophoresis apparatus and so on constitutes, and does not need especially skillfully just can operate.
System's configuration example of separating the sequence of operations of determining with base sequence shown in Figure 11.System shown in Figure 11, by enzyme reaction device 900, fragment analysis device 901, divide and take electrophoresis apparatus 902, dna sequencing instrument 903, between these devices, have in order to transport a plurality of volumetric pipettes 904 of reaction product, for the XYZ stage arrangement 905 that volumetric pipette 904 is moved, and the computer 906 of each device operation of control under predefined program constitutes.
Enzyme reaction device 900, by the primer sets maintaining part 910 that keeps 16 kinds of primer sets with at least 16 fractions, the reaction reagent maintaining part 911 that keeps reaction reagents such as enzyme, damping fluid, carry out the enzyme cut-out reacting part 912 that sample DNA cuts off reaction with restriction enzyme, reclaim the DNA recoverer 913 that enzyme cuts off reaction product in the reacting part, extension portion 914 with at least 16 fractions of carrying out extension, carry out the serial response portion 918 of serial response, volumetric pipette washing portion 915 keeps the sample maintaining part 917 of sample DNA to constitute.Constitute each one of enzyme reaction device 900, under computer 906 controls, control by the temperature-control device (not shown) independently, between each one, comprise sample liquid, reaction reagent, transporting of the various feed liquids of reaction product undertaken by volumetric pipette 904, and the mobile control of volumetric pipette 904 positions is to be undertaken by XYZ stage arrangement 905, feed liquid is drawn onto volumetric pipette, or the control of discharge volumetric pipette, with moving control, undertaken by control signal from computer 906.
By volumetric pipette sample DNA is got enzyme by sample maintaining part 917 and cut off in the reacting part 912, cut off in the reacting part 912 being added to enzyme behind the separatory such as restriction enzyme, keep reacting in 1 hour in 37 ℃ by reaction reagent maintaining part 911.Reaction moves to DNA recoverer 913 by volumetric pipette with reaction solution after finishing, and reclaims the DNA that is cut off by restriction enzyme.DNA recoverer 913 is made up of silica bead film and pump; The recovery of DNA at first replenishes DNA on the silica bead film, wash the back water and carry out elution.The part of the cut DNA that reclaims is divided into 16 parts, carries out extension by 16 kinds of primer sets in extension portion 914.Reaction product is added in the fragment analysis device 901 by volumetric pipette, the primer that reacted and its sheet segment length are through measuring, its measurement result is analyzed by computer 906, and each primer decides the branch of dna fragmentation mixture to get scope according to can be used for a kind of fragment extension like that.With the dna fragmentation mixture that remains in the DNA recoverer 913, after adding branch to and taking in the electrophoresis apparatus 902, dna fragmentation mixture branch is formed 2-5 fraction.
Branches at different levels are transported to serial response portion 918 carry out serial response.Needed reagent infeeds serial response portion by reaction reagent maintaining part 911 by volumetric pipette in the serial response.By the serial response product that serial response portion 918 obtains, carry out electrophoresis after being transported to dna sequencing instrument 903, obtain base sequence and determine needed electrophoretic analysis result.According to the electrophoretic analysis result of relevant each fraction, determine the base sequence of sample DNA.The base sequence of sample DNA determines, by computer 906, or the computer that has dna sequencing instrument 903 separately carries out.Computer 906 has indication device 916, represents the information material that carries out situation, base sequence of various controls.
Embodiment 7
Figure 12 illustrates the DNA analysis flow process that adopts sample preparation methods of the present invention.The solution that will contain sample DNA 301 to be analyzed (length with several Kb～10Kb) is divided into 2 parts, divides separately and gets among the 1st pipe 302-1 and the 2nd the pipe 302-2.The sample DNA that comprises among the 1st the pipe 302-1 is cut off with restriction enzyme N1aIII, obtain the dna fragmentation group.NIaIII discerns base sequence-CATG-, is created on 3 ' end to have-dna fragmentation of the base sequence of CATG (3 ').The restriction enzyme that uses, other any restriction enzyme is all right except that Sau3Al, HhaI, MaeI, is good but discern Restriction Enzyme with 4 bases that the place of incision high frequency occurs.In the solution 320 that contains dna fragmentation group 303, add oligonucleotide 304, at least on 3 ' end of restriction enzyme cut-out portion in conjunction with oligonucleotide 304 with known base sequence.In the method for oligonucleotide binding, have the PolyA chain that adopts by terminal deoxynucleotidyl transferase to add and the method that is connected, but this example of sentencing the employing connection describe.Contain to divide in advance behind solution 321,2 branches such as grade of ligation product and get in pipe 322 and 323.
Figure 13 illustrates and connects the dna fragmentation that combines oligonucleotide 304.In Figure 13, N and n are the Nucleotide (being any of A, T, G, C) that constitutes the dna fragmentation wait to determine base sequence, by the recognition sequence 305 of N1aIII identification are-CATG-3 '.Combine 3 ' end side of the DNA chain behind the DNA oligonucleotide 304, synthetic according to not carrying out complementary strand like that with making complementary strand can not extend beyond it after the di-deoxynucleoside acid replacement.Certainly, in the oligonucleotide stage, modification such as the residue of usefulness amino or vitamin H etc. 3 '-OH, the form that hinders 3 ' extension in advance is preferred.Combine 3 ' end side of DNA oligonucleotide 304 DNA chain afterwards, not making it carry out complementary strand synthesizes, this be because, synthesize by using anchor primer to carry out complementary strand, 3 of anchor primer ' end (having for carrying out the part of the base sequence that dna fragmentation distinguishes) and dna fragmentation not under the complementary situation, can not produce and anchor portion complementary chain fully.In the chain that 3 of anchor primer ' end and dna fragmentation mate fully, the part of anchor primer is hybridized with the end of opposing side (3 ' end of synthetic chain), and then extend, synthesize and will remain on dna fragmentation on 3 ' end with anchor portion complementary base sequence.
Figure 14 A illustrates and combines the concept map of the anchor primer group (the anchor primer group 1.) that the end of the DNA chain (1 chain) behind the DNA oligonucleotide 304 hybridizes; Figure 14 B illustrates and combines the primer sets concept map 2. that the end of the DNA chain (1 chain) behind the DNA oligonucleotide 304 is hybridized.Preparation on dna fragmentation, have with the DNA oligonucleotide 304 complementary parts 315 that import and, at the anchor series 311 of its 5 ' end side, and have 16 kinds of (is 4～256 kinds corresponding to 1～4 base) anchor primer groups 306 of distinguishing sequence 312 of 2 bases (be) composition of representing with XX of 3 ' end side with 1～4 base.Distinguishing sequence 312 is the base sequences that are used for selecting from the mixture of dna fragmentation specific DNA fragments.The anchor portion 311 of this anchor primer group 306 or the base sequence that contains anchor portion 311 parts are made universal sequence in fact in advance.Prepare this moment as Figure 14 A 313 shown in will be base (in the cutting sequence of restriction enzyme one of the 6th base apart from 3 ' end of anchor primer group 306, herein for C) be transformed into other base for example 16 kinds of the anchor primers of T (the anchor primer group 1.) and, the primer sets 307 of indeclinable former state C (primer sets is 2.).In this embodiment, as shown in Figure 14B, primer sets there is no need in 2. primer sets 2. on additional anchor, but, can enclose fluorescent mark 314 with Texas Red or FITC in advance in order to help later checking.
2. the primer sets that use is crossed with a kind of fluor fluorescent mark carries out the extension of primer with the dna fragmentation mixture.Just, as shown in figure 12, from the pipe 322 that contains ligation product solution is housed, with feed liquid dispensing to 16 322-1 by all means, 322-2 ..., among the 322-16, adding different primers separately, to carry out complementary strand synthetic.Just, in each pipe, add mutually different selection sequence 312 respectively.Complementary strand synthetic product is through gel electrophoresis.Figure 15 is the example of the gel electrophoresis spectrum of complementary strand synthetic product.In the electrophorogram, have the primer of selecting sequence 312 and, respectively by in the DNA chain (2 chain)+chain and-chain complementary strand synthetic product, occur in couples with equidistant L from the swimming starting point.Just to produce complementary strand during fully with the dna fragmentation coupling synthetic when 2 bases of 3 of primer ' end, generates and the fluorescent label DNA fragment of its dna fragmentation equal length.Therefore, can be learnt by the collection of illustrative plates of the Figure 15 that obtains that how the fragment of length is arranged in the dna fragmentation group, what its terminal base sequence is.Figure 16 is the figure of the dna fragmentation structure example that is detected of expression, for example, by primer, and have in the electrophorogram that the primer of selection sequence (primer selectivity sequence) TC obtains, the dna fragmentation that the DNA chain is about 400 bases occurs with selection sequence (primer selectivity sequence) AG.
Can learn thus, in 2 the chain DNA fragments of original sample DNA with the restriction enzyme cut-out, length is about 400bp, and the base sequence of 3 ' end side of chain comprises the GTACTC as 3 ' respectively separately ... 5 ', and 3 ' GTA CAG ... 5 ' dna fragmentation.Herein, " " is the base sequence that imports the oligonucleotide in the dna fragmentation by ligation, " ... " it is inherent base sequence on dna fragmentation.The continue base sequence of 5 ' end side on the base sequence 3 ' GTAC5 ' of restriction enzyme identification part becomes and AG separately, and TC complementary base sequence.Can learn that the dna fragmentation shown in Figure 16 is among the dna fragmentation mixture.When only taking out this dna fragmentation, use the terminal bases sequence to have the anchor primer of AG and TC respectively, carry out PCR (polymerase Chain Reaction), so long as the copy number of its dna fragmentation than other big several magnitude just.
Use is by the primer of 4 kinds of fluor difference marks, the base sequence of definite DNA that so makes, and the base sequence of the original sample DNA that links to each other with them.In order to check order, to use at 5 ' end side and introduce the anchor primer 306 of anchor 1. as the PCR primer with existing 4 kinds of fluorescent dye primers.Promptly, this anchor primer, shown in Figure 14 A, the anchor series 311 shared with existing primer, in fact with DNA oligonucleotide 304 complementations that import at 3 ' end side of dna fragmentation by ligation, be have the general primer sequence 315 shared with anchor primer group 306, with 1 of the base sequence of restriction enzyme identification partly or entirely shared base sequence and 3 ' end side on the primer of distinguishing sequence 312 of 2 based compositions.The primer sequence 315 shared with anchor series 311 also can be that a part is shared, but the length of common sparing be below 8 Nucleotide.When the known primer of mark used separately respectively with 4 kinds of fluor, it was necessary can not stably hybridizing and carry out complementary strand synthetic with the base sequence of the DNA oligonucleotide 304 that imports dna fragmentation.General primer sequence 315 has essence and DNA oligonucleotide 304 complementary base sequences.And the base sequence of anchor portion 311 is more than 10 Nucleotide, preferably is necessary for obtaining stable hybridization more than 15 Nucleotide.
In addition, primer sequence is carried out some researchs.Just, these anchor primers 1., have with the DNA oligonucleotide 304 complementary base sequences that import dna fragmentation and, the selection sequence (XX) 312 of 2 bases is arranged on 3 ' end, but the kind of 1 base of 5 ' end side of the base sequence-CATG-of restriction enzyme identification is changed.In the example of Figure 14 A, make the C among base sequence-CATG-be varied to T (replacement T, also or to be A, G), this anchor primer, distance 3 ' end is that mismatch takes place the base T313 of the 6th base, but stably hybridize, form complementary strand with the DNA oligonucleotide 304 that imports in the dna fragmentation end.Its result, the DNA chain of formation becomes the type for not using restriction enzyme used in the present embodiment to cut off.And, even with the A among base sequence-CATG, be varied among T, G, the C any, this anchor primer, distance 3 ' end is the base generation mismatch of the 5th base, but stably hybridizes with the DNA oligonucleotide 304 that imports in the dna fragmentation end, forms complementary strand.Its result is same, and the DNA chain of formation becomes the type for not using restriction enzyme used in the present embodiment to cut off.In addition, also prepare 16 kinds of primers (primer sets 2.).These primers as shown in Figure 14B, do not have anchor series, but have the primer of selection sequence (XX) 312, distance 3 ' end is the base sequence of 6 bases of the 2nd base to the, with base sequence-CATG-complementation, can add and also can not add 5 ' terminal fluorescent mark 314.
Utilize the result of Figure 15, be defined as making and carry out PCR than 130 longer dna fragmentations of base and amplify necessary PCR selectivity primer.As shown in figure 12, divide the solution of getting in the pipe 323, the number (K) that is dispensed into the PCR combination is individual (in electrophorogram, complementary strand synthetic product, be to begin below the right quantity of equidistant appearance from migration point, the PCR that equals to be determined is with the species number of selectivity primer) container 323-1,323-2 ... among the 323-K, in container, add PCR inequality selectivity primer separately, use the PCR of selectivity primer to amplify.In this PCR amplifies, use the anchor primer group 1., and primer sets combination primer 2..In addition, 130 bases (common 150 bases) also can the operation that continues by each dna fragmentation as described below be determined whole base sequence even following dna fragmentation is not analyzed, and therefore do not carry out PCR and amplify.
Make with extra care through dialysis etc. amplify the dna fragmentation that obtains by PCR, and determine to use template as base sequence.Figure 17 illustrates product one example by using anchor primer complementary strand 1. synthetic (PCR amplification) to be obtained.In Figure 17,304 ' a part be the extension of oligonucleotide 304.The dna fragmentation of Huo Deing herein is the anchor primer that has anchor primer group 306 (the anchor primer group 1.) respectively on endways, and the dna fragmentation of the primer of primer sets 307 (primer sets 2.).The primer bonded part 305 of primer sets 307-CATG-, if use previous used restriction enzyme, then can cut off at place of incision 400, but the anchor primer of anchor primer group 306 in conjunction with side part 351-CATA-, because with-CATG is different, and therefore the restriction enzyme that can not before have been used cuts off.
Its result, if PCR is amplified product as 1 chain after being cut off by previous restriction enzyme, use has that to carry out complementation synthetic with the fluorescent dye primer 330 (* represents fluorescent mark) of anchor series 311 identical base sequences, will on 3 ' end side, have and original sample DNA 301 complementary base sequences, hybridize the back generation with original sample DNA chain and can further extend the dna fragmentation of complementary strand (fluorescent dye primer 402 that complementary strand extends).Add then to divide earlier and get the 2nd fragmentation among the pipe 302-2 original sample DNA 301 Hes before, base sequence is determined the reagent (ddNTP: the reagent that contains di-deoxynucleoside acid triphosphate), carry out serial response of usefulness.The base sequence of the dna fragmentation that PCR amplifies can be learnt by the serial response that uses fluorescent dye primer 330, the base sequence (banded base sequence) that this dna fragmentation should link can be learnt by the serial response that uses pre-prepd fluorescent dye primer 402 through above-mentioned complementary strand extend through.Just, similarly to Example 5, by embodiment 1 can determine dna fragmentation base sequence and, the base sequence adjacent with this base sequence.
Dna fragmentation shown in Figure 17 is a dna fragmentation of going up the primer of the anchor primer that has anchor primer group 306 separately and primer sets 307 (primer sets 2.) endways.By the reaction of using different PCR selectivity primers (, among Figure 14 B, having the primer of the primer sets 307,306 of different recognition sequences), can read the base sequence of sample DNA 301 at Figure 14 A.In the above-mentioned serial response, use primer by 4 kinds of fluor difference marks with different emission wavelengths; Carry out so-called A termination reaction, C termination reaction, G termination reaction and T termination reaction, therefore can use 4 common look primers, operate very easy as fluorescent dye primer 330.That is, its advantage is to there is no need to be produced on 16 kinds of fluorescent dye primers (so owing to being that 4 looks add up to 64 kinds of primers) that 3 ' end has recognition sequence.
Embodiment 8
Present embodiment is an example of being determined the base sequence of 2 chain DNAs by 3 ' end, 5 ' terminal both sides simultaneously.Figure 18 illustrates the anchor primer with recognition sequence, the relation of labeled primer and dna fragmentation.The forward primer of being crossed by fluorescent mark (forward primer) (general+chain carries out complementary strand and extends synthetic employed primer) 171, and primer (general-chain carries out complementary strand and extends synthetic employed primer) 371, and the mark fluorescent body adopts Texas Red (314 respectively, emission wavelength 615nm), and Cy-5 (141, emission wavelength 654nm).Then, these primers are called primer-a (171, positive primer), primer-b (371).Figure 18 illustrate primer-a (171) ,-b (371), anchor primer (361,362) and endways on added the dna fragmentation of DNA oligonucleotide 304 relation.The anchor series of primer-a (171) and anchor primer-a (361) has general in fact base sequence, and the anchor series of primer-b (371) and anchor primer-b (362) has general in fact base sequence.Primer-a ,-b, even partly also can not stablize, become when not having anchor primer to exist complementary strand synthetic base sequence does not take place with dna fragmentation hybridization.Just, only the part of the DNA chain 316 that obtains with anchor primer extension back is carried out stable hybridization, makes the sequence product.
In the base sequence of the DNA oligonucleotide that combines with dna fragmentation, add the restriction enzyme identification part (GGATG) 318 of Class2A restriction enzyme FokI in advance.This restriction enzyme FokI is by the restriction enzyme of restriction enzyme identification part 318 with 9 base positions, 317 cut-outs of 3 ' end side, as described later, can be used to remove the oligonucleotide that is combined on the dna fragmentation.Anchor primer-a (361), the part of the base sequence-CATG-of restriction enzyme identification part (being the restriction enzyme identification part that base was substituted) 351 (herein being the restriction enzyme identification parts of N1aIII) is changed, according to 313 such C → T, be varied to-TATG-, become the product that to use restriction enzyme N1aIII to cut off, but since have the recognition sequence that the restriction enzyme of Class2A cuts off (GGATG) 318, therefore can be cut off by FokI.On the other hand, anchor primer-b (362) has preserved restriction endonuclease recognition sequence portion-CATG-305, and (part 319 GGATG-) is varied to-GTATG-, and it is changed into can not cut off with FokI but make the recognition sequence of Class2A restriction enzyme.Just, use anchor primer-a and-b, the product that PCR amplified cuts off a side with restriction enzyme N1aIII, cuts off opposite opposite side with the restriction enzyme of Class2A, is working hard aspect the terminal DNA oligonucleotide that imports of dna fragmentation removing respectively.Self-evident, anchor primer-a, and-b, on 3 ' end, have by the distinguishing sequence 312 of 2 based compositions (being AG, TC in the example of Figure 18), be the anchor primer group of forming by 16 kinds of primers respectively.
Below, explanation in order.Identical with embodiment 7, (feed liquid of number Kb～10Kb) is divided into 2 parts to contain sample DNA to be analyzed.Isolated a feed liquid is cut off sample DNA with restriction enzyme N1aIII (also can be other 4 bases identification enzyme).Cut-out portion by restriction enzyme cuts off combines with the DNA oligonucleotide with known base sequence by ligation.The DNA oligonucleotide of usefulness is base sequence (sequence number 6) herein, 5 '-auxiliary oligonucleotide 101 Hes of GTAAAACGACGGCCAGTGGATGCATG-3 ', base sequence (sequence number 7), have 3 '-the connection oligonucleotide that imports vitamin H (Bio) and on 5 ' end, have 3 ' Bio-CATTTTGCTGCCGGTCACCTAC P-5 ' structure of phosphate (P) on 3 ' end of CATTTTGCTGCCGGTCACCTAC-5 '.Auxiliary oligonucleotide 101, remove the base sequence that generates by N1aIII as the CATG-3 ' of overhang, be in complementary relationship with the base sequence that is connected oligonucleotide 102, vitamin H (Bio) is the material that imports in order to blockade extension, also can use vitamin H (Bio) material in addition to modify the OH base of 3 ' end.In the DNA chain that has imported the DNA oligonucleotide, near a side is terminal, there is cut-out portion by N1aIII identification, near another is terminal, there is cut-out portion by FokI identification.3 ' end of the connection oligonucleotide 102 that is imported into makes it not surpass its chain extension with the vitamin H sealing.Under the situation of the poor yields of ligation, use not have 5 '-connection of P, only auxiliary oligonucleotide is carried out ligation after, by the synthetic complementary strand of polysaccharase.In such cases, 3 ' end is blockaded after with terminal deoxynucleotidyl transferase di-deoxynucleoside acid being imported 3 ' end.If adopt this method, can prevent becomes dipolymer by ligation between the primer, therefore can expeditiously auxiliary oligonucleotide 101 be imported in the DNA chain with the base sequence that is connected Nucleotide 102.Dna fragmentation self connect the oligonucleotide can prevent to use excessive (100 times).(the anchor primer group a) for anchor primer-a, and anchor primer-b (anchor primer group b), hybridize by the DNA oligonucleotide that is imported into and the identification part of N1aIII, but anchor primer-a, the base sequence of the identification part of NIaIII is become-TATGNN3 ' by-CATGNN 3 '.Anchor primer-b on the other hand, the base sequence of the identification part of FokI is become-GTATGCATGNN by-GGATGCATGNN.Any during these change all is can not replace the synthetic point that hinders that produces of complementary strand.
Figure 19 explanation is discerned before thereby dna fragmentation carries out PCR at the anchor primer that use has a selectivity sequence, determines the method that primer is right with a spot of dna fragmentation.Right in order to be identified for that the dna fragmentation mixture is carried out the primer that PCR amplifies, make electrophoretogram similarly to Example 7.Just, another part feed liquid (comprising the dna fragmentation group of cutting off by restriction enzyme) of 2 equal portions will formerly be divided into, as shown in figure 19, further be divided in 16 parts of containers of packing into separately, 16 kinds of primers 110 that belong to anchor primer group b respectively by a kind of interpolation of every container, further add the forward primer 111 that fluorescent mark (*) is crossed again, complementary strand extends under the condition of cycle sequencing, forms the complementary strand 106 that is extended by forward primer 111.Use anchor primer-b herein, but also can use anchor primer-a equally, or do not had the primer sets of a replacement fully.In the reaction, at first be anchor primer-b (110) and dna fragmentation 100 hybridization, 3 ' terminal coupling fully, promptly produce complementary strand and extend 103.The chain of the side that herein do not match does not extend.Complementary strand is performed until and imports oligonucleotide (auxiliary oligonucleotide 101) part, and the result can obtain the base sequence 104 with auxiliary oligonucleotide 101 hybridization on 3 ' end of extended chain.By thermal cycle reaction, this complementary strand extends 103, is formed on the anchor series that has primer 110 on 3 ' end and the dna fragmentation of complementary base sequence 105 further.Just, form hybridization base sequence 105 parts of forward primer 111.Hybridization forward primer 111 forms the complementary strand 106 that extends on these base sequence 105 parts.Then, react equally with common PCR, the terminal bases sequence of anchor primer-a is hybridized fully, obtains identical with dna fragmentation basically (length that is limited to the anchored ends primer length) the fluorescent label DNA fragment of length.
In addition, the length of dna fragmentation mixture is used at each 2 base kind time-like of asking the dna fragmentation end at every turn, also is effective but the dna fragmentation mixture is carried out the method that PCR amplifies at per 2 base sequences of its end.If distinguishing sequence is increased to 3 or 4 bases from 2 bases, even 1 base mispairing also has the function as primer.In order to prevent this point, for example when having the selectivity sequence of 3 bases, go up in the 4th base (near selectivity sequence the base here) of 3 of distance anchor primer ' end and to add inosine, weaken terminal bonding force.In such cases, if further selecting on the sequence mismatch is arranged, then the synthetic very difficulty of complementary strand helps improving evident characteristics.
After the fluorescent label DNA chain of acquisition separates by gel electrophoresis at every turn with 16 kinds of anchor primer-b, can learn the terminal bases sequence and the length of the DNA chain that is included in the mixing.With the terminal bases sequence and the length of acquisition like this, determine the PCR primer, but 2 primers respectively from anchor primer-a, and-select a kind the b.Use these 2 primers (for example, anchor primer-a (361) and-b (362)) carry out PCR and amplify, as shown in figure 18, obtain thus to have near an end to cut off by N1aIII, near another is terminal by the dna fragmentation of the cut-out portion of FokI cut-out.The various dna fragmentations that obtain after ethanol is refining, are divided into 2 parts after being dissolved in damping fluid separately, obtain (a) of relevant each dna fragmentation and (b) solution.In (a) solution, add N1aIII, in (b) solution, add FokI, dna fragmentation is cut off.In case 1 chainization of dna fragmentation that will cut off by NIaIII, it is synthetic to carry out complementation with fluorescent dye primer 171 (forward primer) under circulating reaction, will on 3 ' end side, have and original sample DNA301 complementary base sequence, hybridize the back with original sample DNA chain and generate the dna fragmentation (fluorescent dye primer 404 that complementary strand extends) that complementary strand can further extend.Equally, in case 1 chainization of dna fragmentation that will cut off by FokI, it is synthetic to carry out complementation with fluorescent dye primer 371 under circulating reaction, will on 3 ' end side, have and original sample DNA301 complementary base sequence, hybridize the back with original sample DNA chain and generate the dna segment (fluorescent dye primer 406 that complementary strand extends) that complementary strand can further extend.So, thereby prepare the dna fragmentation 404,406 that complementary strand can further extend in advance with original sample DNA chain 301 hybridization.
Then, both are mixed (also can be to the last also to separate), add sample DNA 301, and then add base sequence and determine the reagent of usefulness (ddNTP: contain the reagent of di-deoxynucleoside acid triphosphate, carry out the cyclic sequence reaction with the preceding total length of restriction enzyme cut-out.By this reaction, the base sequence that can obtain DNA chain front and back is determined necessary information material.Just, can learn the base sequence of the dna fragmentation that PCR amplified from the serial response that uses fluorescent dye primer 171,371; Can learn the base sequence (base sequence of connection) that this dna fragmentation should link from the serial response that uses the fluorescent dye primer 404,406 that above-mentioned complementary strand extends.Just, identical with embodiment 1～embodiment 5, can determine dna fragmentation base sequence and, the base sequence adjacent with this base sequence.
With embodiment 1～embodiment 5, embodiment 7 is identical, can determine dna fragmentation base sequence and, the base sequence adjacent with this base sequence.
Herein, primer and DNA2 bar chain (+,-chain) are corresponding is 2 looks (2 kinds of fluorescently-labeled primers), the identification of A, C, G, T, be to carry out with different electrophoresis routes, i.e. every kind of terminal bases swimming in different electrophoresis roads (Bio/Technology.9,648-651 (1991)).
On the other hand, when using 4 look fluor primers (respectively by the primer of 4 kinds of phosphor body marks), needn't make (a) solution and (b) solution mixing, just can carry out similarly to Example 7.So, use the primer that has different cut-out portion at DNA chain two ends to carry out PCR, owing to can determine base sequence simultaneously from the both sides of 2 chains, so efficient is good.And, can know the base sequence that two ends continue simultaneously, therefore have that can to make the dna fragmentation number of determining base sequence be minimum advantage.
More than the length of sample DNA among each embodiment as long as be number Kb～10Kb, can certainly be by the dna fragmentation sample of fragmentation among the DNA that from check object, extracts.
(sequence table)
Sequence number: 1
The length of sequence: 18
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
Sequence
TGTAAAACGACGGCAGT
Sequence number: 2
The length of sequence: 22
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
Sequence
GTAATGCGACTCACTATAGGGC
Sequence number: 3
The length of sequence: 20
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
Sequence
TTTTTTTTTTTTTTGCAGGC
Sequence number: 4
The length of sequence: 20
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
Sequence
TTTTTTTTTTTTTTGCAGGT
Sequence number: 5
The length of sequence: 20
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
The feature of sequence
Other information material: X, Y; A, C, G or T sequence arbitrarily
TTTTTTTTTTTTTTTCGCXY
Sequence number: 6
The length of sequence: 26
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
Sequence
GTAAAACGACGGCCAGTGGATGCATG
Sequence number: 7
The length of sequence: 22
Sequence type: nucleic acid
Chain number: 1 chain
Layout: straight chain shape
Sequence kind: other nucleic acid, synthetic DNA
Sequence
CATCCACTGGCCGTCGTTTTAC

Claims (38)

1. base sequence sequence measurement is characterized in that comprising following operation:
(1) operation of sample DNA being utilized the restriction enzyme cut-out obtain dna fragmentation reaches
(2) 3 ' the terminal operation that imports the oligonucleotide with specific base sequence that goes up at dna fragmentation reaches
(3) will import segmental 1 chain of above-mentioned DNA of above-mentioned oligonucleotide as template, the 3rd base sequence that use partly reaches and utilize base sequence complementary the 2nd base sequence of above-mentioned restriction enzyme identification partly to reach, form from the base combination of the scope of 1 base to 4 base by at least a portion to the 1st base sequence of mending with the base sequence of oligonucleotide is partly formed, and the labeled primer that is labeled, carry out the synthetic extension of complementary strand, obtain having mark with 1 chain complementary base sequence of dna fragmentation extend primer operation and
(4) make (a) with 1 chain of the above-mentioned above-mentioned dna fragmentation that has imported oligonucleotide as template, use above-mentioned labeled primer carry out serial response operation and, (b) will have 1 chain of the part of 1 chain of sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or sample DNA as template, use above-mentioned mark to extend the operation that primer carries out serial response, respectively or the operation of carrying out simultaneously and,
(5) resultant with above-mentioned serial response carries out electrophoresis, determine above-mentioned dna fragmentation base sequence and, with the base sequence operation of at least a portion of the sample DNA of the base sequence adjacency of dna fragmentation.
In the claim 1 record the base sequence sequence measurement, mark wherein is meant fluorescent labelling.
3. the base sequence sequence measurement of record in the claim 1, the operation (3) that the transformation temperature condition will be wherein repeats for several times.
4. the base sequence sequence measurement of record in the claim 1, the transformation temperature condition, will be wherein operation (4) be that synthetic extension of above-mentioned complementary strand and above-mentioned mark extend the operation that primer dissociates out and repeat for several times from above-mentioned dna fragmentation.
5. the base sequence sequence measurement of record in the claim 1 uses the heat resistant poly synthase in operation therein (3), (4).
In the claim 1 record the base sequence sequence measurement, oligonucleotide wherein is made up of single base kind.
7. base sequence sequence measurement is characterized in that comprising following operation:
(1) operation of sample DNA being utilized the cut-out of the 1st restriction enzyme obtain dna fragmentation reaches
(2) use primer that 1 chain of above-mentioned dna fragmentation is carried out after the extension as template, with the operation of the nucleotide subsitution of 3 ' terminal and fluorescent labelling and,
(3) the complementary strand utilization that (2) are generated 2nd restriction enzymes different with above-mentioned the 1st restriction enzyme cut off, obtain 3 ' terminal go up by the operation of the fluorescent labelling primer of fluorescent labelling reach,
(4) use above-mentioned fluorescent labelling primer, 1 chain that will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or above-mentioned sample DNA is as template, carry out serial response operation and,
(5) resultant with above-mentioned serial response carries out electrophoresis, the base sequence of at least a portion of the above-mentioned sample DNA that base sequence definite and above-mentioned dna fragmentation is adjacent.
8. base sequence sequence measurement is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) use primer, it is synthetic that 1 chain of above-mentioned dna fragmentation is carried out complementary strand as template, obtain having with the operation of 1 chain complementary base sequence of dna fragmentation and,
(3) use above-mentioned primer, 1 chain that will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or above-mentioned sample DNA is as template, carry out on the end of extended chain, importing fluorescent labelling serial response operation and
(4) utilize above-mentioned restriction enzyme cut off above-mentioned serial response resultant operation and,
(5) the above-mentioned resultant of the serial response of restriction enzyme cut-out that utilizes is carried out electrophoresis, the operation of the base sequence of at least a portion of the sample DNA that base sequence definite and dna fragmentation is adjacent.
9. base sequence sequence measurement is characterized in that comprising following operation:
(1) operation of sample DNA being utilized the restriction enzyme cut-out obtain dna fragmentation reaches
(2) 3 ' the terminal operation that imports the oligonucleotide with specific base sequence that goes up at above-mentioned dna fragmentation reaches
(3) with 1 chain of the above-mentioned dna fragmentation that has imported oligonucleotide as template, use by at least a portion to the 1st base sequence of mending with the base sequence of above-mentioned oligonucleotide reach partly and utilize that base sequence complementary the 2nd base sequence of above-mentioned restriction enzyme identification partly reaches, base combination in the scope of 1 base to 4 base and the 3rd base sequence that forms partly forms, and the labeled primer that is labeled, carry out the synthetic extension of complementary strand, obtain having mark with 1 chain complementary base sequence of above-mentioned dna fragmentation extend primer operation and
(4) make (a) with 1 chain of the above-mentioned dna fragmentation that has imported oligonucleotide as template, use above-mentioned labeled primer carry out serial response operation and, (b) will have 1 chain of the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of dna fragmentation and the base sequence that is adjacent or sample DNA as template, use the extension primer of above-mentioned fluorescent labelling to carry out the operation of serial response, the operation of carrying out and,
(5) resultant with serial response carries out electrophoresis, determines the operation with the base sequence of at least a portion of the above-mentioned sample DNA of the base sequence adjacency of above-mentioned dna fragmentation.
10. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) use the fluorescent labelling primer, it is synthetic that 1 chain of above-mentioned dna fragmentation is carried out complementary strand as template, obtain having with the operation of the primer of 1 chain complementary base sequence of above-mentioned dna fragmentation and,
(3) 1 chain that will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or sample DNA is as template, use above-mentioned primer carry out serial response operation and,
(4) resultant with above-mentioned serial response carries out electrophoresis, the operation of the base sequence of at least a portion of the above-mentioned sample DNA that base sequence definite and above-mentioned dna fragmentation is adjacent.
11. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) use select complementary strand to combine with above-mentioned dna fragmentation and by the 1st primer of fluorescent labelling reach, have with 1 chain complementary base sequence of above-mentioned dna fragmentation by the 2nd primer of fluorescent labelling, to have the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent above-mentioned sample DNA 1 chain a part or 1 chain and the above-mentioned dna fragmentation of sample DNA mixed as template, carry out serial response operation and,
(3) resultant with above-mentioned serial response carries out electrophoresis, determine above-mentioned dna fragmentation base sequence and, with the operation of the base sequence of at least a portion of the adjacent above-mentioned sample DNA of the base sequence of above-mentioned dna fragmentation.
12. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) 3 ' terminal importing at above-mentioned dna fragmentation has the operation of the oligonucleotide of known base sequence
(3) by utilizing above-mentioned restriction enzyme to discern the base kind that above-mentioned dna fragmentation is also discerned 1-4 base of the terminal part that is connected with severed segment, carry out extension, thereby when measuring the length of above-mentioned dna fragmentation, be identified for serial response primer operation and,
(4) the above-mentioned dna fragmentation that will utilize above-mentioned restriction enzyme to obtain utilize electrophoretic method according to length separate operation that branch gets and,
(5) use at 3 ' end and have, distinguish above-mentioned dna fragmentation for distinguishing the fluorescent labelling primer by the base sequence of 1-4 based composition of above-mentioned dna fragmentation, the above-mentioned dna fragmentation that will be distinguished as the operation of the synthetic complementary strand of template reach,
(6) carry out (a) and use above-mentioned labeled primer, the above-mentioned dna fragmentation that to be distinguished is as the serial response of template, reach and (b) use the above-mentioned complementary strand that generates by above-mentioned operation (5), the part of 1 chain of the above-mentioned sample DNA of the base sequence that will have the base sequence of the above-mentioned dna fragmentation of being distinguished and be adjacent, or 1 chain of above-mentioned sample DNA as the operation of the serial response of template and
(7) resultant with above-mentioned serial response carries out electrophoresis, the operation of the base sequence of at least a portion of the above-mentioned sample DNA of the base sequence adjacency of the above-mentioned dna fragmentation that the base sequence of definite above-mentioned dna fragmentation of being distinguished reaches and distinguished.
13. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) with 1 chain of above-mentioned dna fragmentation as template, make primer generation extension, obtain 1 chain DNA operation and,
(3) use 1 above-mentioned chain DNA, 1 chain that will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or above-mentioned sample DNA is as template, carry out serial response operation and,
(4) resultant with above-mentioned serial response carries out electrophoresis, determines the operation at the base sequence of at least a portion of the adjacent above-mentioned sample DNA of the base sequence of above-mentioned dna fragmentation.
14. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or 1 chain of above-mentioned sample DNA respectively, and above-mentioned dna fragmentation is as template, use with the part of 1 chain of 1 chain of above-mentioned sample DNA or above-mentioned sample DNA carry out optionally complementary strand bonded primer and, carry out optionally complementary strand bonded primer with above-mentioned dna fragmentation, carry out serial response operation and,
(3) resultant with above-mentioned serial response carries out electrophoresis, determines the operation than the base sequence of the above-mentioned sample DNA of the longer part of length of the base sequence of above-mentioned dna fragmentation.
15. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized the 1st restriction enzyme cut off to obtain dna fragmentation operation and,
(2) use primer, 1 chain of above-mentioned dna fragmentation is carried out extension as template after, with 3 ' terminal with the fluorescent labelling nucleotide subsitution operation and,
(3) above-mentioned complementary strand is used 2nd restriction enzyme different cut off with above-mentioned the 1st restriction enzyme, obtain 3 ' terminal by the operation of the fluorescent labelling primer of fluorescent labelling and,
(4) use above-mentioned fluorescent labelling primer, 1 chain that will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or above-mentioned sample DNA is as template, carry out serial response operation and,
(5) resultant with above-mentioned serial response carries out electrophoresis, determines the operation than the base sequence of the above-mentioned sample DNA of the longer part of length of the base sequence of above-mentioned dna fragmentation.
16. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off to obtain dna fragmentation operation and,
(2) will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or above-mentioned sample DNA 1 chain and, 1 chain of above-mentioned dna fragmentation is respectively as template, use with the part of 1 chain of 1 chain of above-mentioned sample DNA or above-mentioned sample DNA carry out optionally complementary strand bonded primer and, carry out optionally complementary strand bonded primer with above-mentioned dna fragmentation, carry out simultaneously serial response operation and,
(3) resultant with above-mentioned serial response carries out electrophoresis, determine simultaneously above-mentioned dna fragmentation base sequence and, with the operation of the base sequence of at least a portion of the adjacent above-mentioned sample DNA of the base sequence of above-mentioned dna fragmentation.
17. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) use the primer that has on the 3 ' end with a part of complementary base sequence of the base sequence of 1 chain of the dna fragmentation that obtains by sample DNA to carry out the synthetic extension of complementary strand, obtain having with the operation of the extension primer of a part of complementary base sequence of 1 chain of above-mentioned dna fragmentation and,
(2) carry out (a) with 1 chain of above-mentioned dna fragmentation as template, use above-mentioned primer carry out serial response operation and, (b) will have the part of 1 chain of above-mentioned sample DNA of the base sequence of 1 chain of above-mentioned dna fragmentation and the base sequence that is adjacent or above-mentioned sample DNA 1 chain as template, use above-mentioned extension primer carry out serial response operation and,
(3) resultant with serial response carries out electrophoresis, determine above-mentioned dna fragmentation base sequence and with the operation of the base sequence of at least a portion of the adjacent sample DNA of the base sequence of above-mentioned dna fragmentation.
18.DNA the sample modulator approach is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have oligonucleotide, and with the sequence of utilizing restriction enzyme identification in fact the complementary sequence and, have by the selection sequence of 1-4 based composition, at the anchor primer that 5 ' end side has the anchor sequence more than at least 8 Nucleotide (octamer) at 3 ' end side, carry out complementary strand synthesize the operation that obtains the DNA chain reach,
(4) use the primer have identical in fact with the anchor sequence at least sequence, not hybridize with above-mentioned sample DNA, will carry out complementary strand synthetic operation as template by the above-mentioned DNA chain that operation (3) obtain.
19. the sample modulator approach is characterized in that comprising following operation:
(1) sample DNA cut off is generated a plurality of length dna fragmentation operation and
(2) above-mentioned dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have with above-mentioned oligonucleotide in fact the complementary base sequence and, 3 ' end side have for distinguish the anchor primer that has the anchor sequence more than at least 8 Nucleotide by the sequence of the above-mentioned dna fragmentation of 1-4 based composition, at 5 ' end side with, have and the identical in fact base sequence of above-mentioned anchor sequence, when using separately and the primer that can not stably hybridize of dna fragmentation, above-mentioned dna fragmentation is distinguished each terminal base sequence, carried out the operation that PCR amplifies.
20.DNA sample modulator approach, it is characterized in that, comprise use 3 ' end have for distinguish be connected with the identification part sequence of restriction enzyme identification by the primer of the selection sequence of the dna fragmentation of 1-4 based composition and, the base of the part of above-mentioned identification part sequence replaced the primer that can not utilize above-mentioned restriction enzyme to cut off, carry out at least 1 complementary strand synthetic operation and, near the DNA chain that has the identification part sequence that different restriction enzymes discerns the two ends is carried out the synthetic operation.
21. the sample modulator approach of claim 20 record is characterized in that comprising that the single end with above-mentioned DNA chain utilizes restriction enzyme to cut off, and is prepared as the operation of the template DNA of the base sequence of determining sample DNA.
22. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have above-mentioned oligonucleotide, and with the identification part sequence of utilizing above-mentioned restriction enzyme identification in fact the complementary sequence and, 3 ' end side have a part of base that has the anchor sequence at least 8 Nucleotide more than, an above-mentioned identification part sequence by the distinguishing sequence of 1-4 based composition, at 5 ' end side be substituted, can not utilize the base sequence part that above-mentioned restriction enzyme cuts off anchor primer and, have through primer with the base sequence of above-mentioned restriction enzyme cut-out, utilize PCR with the operation of specific dna fragmentation amplification reach,
(4) cut off an end of the above-mentioned specific dna fragmentation be exaggerated, obtain the DNA chain operation and,
(5) use the fluorescent labelling primer have the sequence identical in fact at least, directly not hybridize with above-mentioned sample DNA with above-mentioned anchor sequence, the DNA chain that will obtain by operation (4) as template carry out complementary strand synthetic obtain the segmental operation of complementary strand synthetic DNA and,
(6) use above-mentioned fluorescent labelling primer and above-mentioned complementary strand synthetic DNA fragment, the above-mentioned DNA chain that will be obtained by operation (4), above-mentioned sample DNA carry out the operation of serial response as template,
Determine above-mentioned DNA chain base sequence and with the base sequence of the above-mentioned sample DNA of the adjacent part of the base sequence of above-mentioned DNA chain.
23. the sequence measurement of base sequence is characterized in that comprising following each operation:
(1) sample DNA is utilized the restricted enzyme of cutting cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have above-mentioned oligonucleotide, and with the identification part sequence of utilizing above-mentioned restriction enzyme identification in fact the complementary sequence and, 3 ' end side have a part of base that has the selection sequence at least 8 Nucleotide more than, an above-mentioned identification part sequence by the selection sequence of 1-4 based composition, at 5 ' end side be substituted, can not utilize the base sequence part that above-mentioned restriction enzyme cuts off anchor primer and, have through primer with the base sequence of above-mentioned restriction enzyme cut-out, utilize PCR with the operation of specific dna fragmentation amplification reach,
(4) cut off an end of the above-mentioned specific dna fragmentation be exaggerated, obtain the DNA chain operation and,
(5) use the fluorescent labelling primer have the sequence identical in fact with above-mentioned anchor sequence at least, directly not hybridize with above-mentioned sample DNA, the above-mentioned DNA chain that will be obtained by operation (4), above-mentioned sample DNA carry out the operation of serial response as template,
Determine above-mentioned DNA chain base sequence and with the base sequence of the above-mentioned sample DNA of the adjacent part of the base sequence of above-mentioned DNA chain.
24. the base sequence sequence measurement of record in claim 22 or 23, wherein the fluorescent labelling primer has and the identical in fact sequence of above-mentioned anchor sequence at least.
25. the base sequence sequence measurement is characterized in that comprising following operation:
(1) sample DNA is utilized the restricted enzyme of cutting cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side import operation that base sequence is known oligonucleotide and,
(3) use have above-mentioned oligonucleotide, and with the identification part sequence of utilizing above-mentioned restriction enzyme identification in fact the complementary sequence and, 3 ' end side have the big base of a part that has the anchor sequence at least 8 Nucleotide more than, an above-mentioned identification part sequence by the selection sequence of 1-4 based composition, at 5 ' end side be substituted, can not utilize the base sequence part that above-mentioned restriction enzyme cuts off anchor primer and, have the primer of process with the base sequence of above-mentioned restriction enzyme cut-out, utilize the operation of PCR with specific dna fragmentation amplification;
Determine the base sequence of the above-mentioned specific dna fragmentation that is exaggerated.
26. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized the 1st restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side imports that base sequence is known, the operation of oligonucleotide with the identification part sequence that obtains by the 2nd restriction enzyme and,
(3) use has above-mentioned oligonucleotide, and with the identification part sequence of utilizing the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, have by the 1st of 1-4 based composition at 3 ' end side and to select sequence, has the 1st anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned identification part sequence is replaced, and have and to be reached by base sequence the 1st anchor primer partly that above-mentioned the 1st restriction enzyme cuts off, has above-mentioned oligonucleotide, and with the recognition sequence that utilizes the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, have by the 2nd of 1-4 based composition at 3 ' end side and to select sequence, has the 2nd anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned oligonucleotide is replaced, have and to be utilized PCR that the operation that specific dna fragmentation amplifies is reached by the 2nd anchor primer of the base sequence part of above-mentioned the 2nd restriction enzyme cut-out;
(4) the 1st of the above-mentioned specific dna fragmentation that will amplify respectively the is terminal with above-mentioned the 2nd restriction enzyme cut-out, obtain the 1DNA chain, utilize above-mentioned the 1st restriction enzyme to cut off the 2nd end of the above-mentioned specific dna fragmentation that is exaggerated, obtain the 1DNA chain operation and,
(5) use have at least the sequence identical in fact with above-mentioned the 1st anchor sequence, with above-mentioned sample DNA not direct cross the 1st fluorescent labelling primer and, at least have the sequence identical in fact with above-mentioned the 2nd anchor sequence, with above-mentioned sample DNA the 2nd fluorescent labelling primer of direct cross not, it is synthetic that above-mentioned the 1st, the 2DNA chain that will be obtained by operation (4) carries out complementary strand as template, obtain the segmental operation of the 1st, the 2nd complementary strand synthetic DNA and,
(6) use above-mentioned the 1st, the 2nd fluorescent labelling primer and the 1st, the 2nd complementary strand synthetic DNA fragment, will by operation 4 obtain the 1st, 2DNA chain, above-mentioned sample DNA carry out the operation of serial response as template;
Determine above-mentioned the 1st, 2DNA chain base sequence and with the base sequence of the above-mentioned sample DNA of the adjacent part of base sequence of above-mentioned the 1st, 2DNA chain.
27. the sequence measurement of base sequence is characterized in that comprising following operation:
(1) sample DNA is utilized the 1st restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side imports that base sequence is known, the operation of oligonucleotide with the identification part sequence that obtains by the 2nd restriction enzyme and,
(3) use has above-mentioned oligonucleotide, and with the identification part sequence of utilizing the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, have by the 1st of 1-4 based composition at 3 ' end side and to select sequence, has the 1st anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned identification part sequence is replaced, and have and to be reached by base sequence the 1st anchor primer partly that above-mentioned the 1st restriction enzyme cuts off, has above-mentioned oligonucleotide, and with the recognition sequence that utilizes the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, have the 2nd of 1-4 based composition at 3 ' end side and select sequence, has the 2nd anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned oligonucleotide is replaced, have and to be utilized PCR that the operation that specific dna fragmentation amplifies is reached by the 2nd anchor primer of the base sequence part of above-mentioned the 2nd restriction enzyme cut-out;
(4) the 1st of the above-mentioned specific dna fragmentation that will amplify respectively the is terminal with above-mentioned the 2nd restriction enzyme cut-out, obtain the 1DNA chain, utilize above-mentioned the 1st restriction enzyme to cut off the 2nd end of the above-mentioned specific dna fragmentation that is exaggerated, obtain the 1DNA chain operation and,
(5) use above-mentioned the 1st, the 2nd fluorescent labelling primer, above-mentioned the 1st, the 2DNA chain that will obtain by operation (4), above-mentioned sample DNA carries out serial response as template operation;
Determine above-mentioned the 1st, 2DNA chain base sequence and, with the base sequence of the above-mentioned sample DNA of the adjacent part of base sequence of above-mentioned the 1st, 2DNA chain.
28. the base sequence sequence measurement of record in claim 26 or 27, wherein the 1st fluorescent labelling primer has and the identical sequence of above-mentioned the 1st anchor sequence essence at least, and wherein the 2nd fluorescent labelling primer has and above-mentioned the 2nd anchor sequence essence sequence mutually at least.
29. the base sequence sequence measurement is characterized in that comprising following operation:
(1) sample DNA is utilized the 1st restriction enzyme cut off, generate a plurality of length dna fragmentation operation and,
(2) above-mentioned dna fragmentation at least 3 ' end side imports that base sequence is known, the operation of oligonucleotide with the identification part sequence that obtains by the 2nd restriction enzyme and,
(3) use has above-mentioned oligonucleotide, and with the identification part sequence of utilizing the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, have by the 1st of 1-4 based composition at 3 ' end side and to select sequence, has the 1st anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned identification part sequence is replaced, and have and to be reached by base sequence the 1st anchor primer partly that above-mentioned the 1st restriction enzyme cuts off, has above-mentioned oligonucleotide, and with the identification part sequence of utilizing the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, have by the 2nd of 1-4 based composition at 3 ' end side and to select sequence, has the 2nd anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned oligonucleotide is replaced, having can not be by the 2nd anchor primer of the base sequence part of above-mentioned the 2nd restriction enzyme cut-out, the operation of utilizing PCR that specific dna fragmentation is amplified;
Determine the base sequence of the above-mentioned specific dna fragmentation that is exaggerated.
30. a test kit, be by have with ligation with oligonucleotide complementary base sequence and, the identification part sequence of restriction enzyme identification and, a plurality of anchor primers of base sequence of the end selection sequence, that can select dna fragmentation base sequence, have 1-4 based composition at 3 ' end side that can become the primer of polymeric enzyme reaction form.
31. the test kit of record in the claim 30, wherein, described anchor primer selects the selection sequence of sequence of 2 bases of above-mentioned dna fragmentation end to contain whole combination base sequences by 2 based compositions.
32. test kit, it is characterized in that at least by the ligation oligonucleotide, in the synthetic test kit of complementary strand with the primer composition, above-mentioned complementary strand is synthetic to be comprised and above-mentioned oligonucleotide complementary sequence in fact with primer, the identification part sequence of restriction enzyme identification reaches, this identification part sequence 3 ' end side have the 1st primer sets (Primer set) formed by 16 kinds of primers of the selection sequence of 2 based compositions and, 5 ' end side at each primer of the 1st primer sets imports the anchor sequence, the 2nd primer sets that 16 kinds of primers that the base of the part of the above-mentioned identification division sequence of above-mentioned each primer was replaced are formed.
33. test kit, it is characterized in that at least by ligation with oligonucleotide, complementary strand in the synthetic test kit of forming with primer, above-mentioned complementary strand synthetic with primer comprise above-mentioned oligonucleotide, and with the identification division sequence of utilizing the identification of the 1st restriction enzyme in fact the complementary sequence reach, have by the 1st selection sequence of 1-4 based composition, have the 1st anchor sequence more than at least 8 Nucleotide at 5 ' end side at 3 ' end side; A part of base of above-mentioned identification part sequence is replaced, have and to be reached by base sequence the 1st anchor primer group partly that above-mentioned the 1st restriction enzyme cuts off, has above-mentioned oligonucleotide, and with the identification part sequence of utilizing the identification of above-mentioned the 1st restriction enzyme in fact the complementary sequence and, has the 2nd selection sequence that forms by 1-4 base at 3 ' end side, has the 2nd anchor sequence more than at least 8 Nucleotide at 5 ' end side, a part of base of above-mentioned oligonucleotide is replaced, having can not be by the 2nd anchor primer group of the base sequence part of above-mentioned the 2nd restriction enzyme cut-out.
34. the test kit of record in the claim 33 wherein the 1st, the 2nd selects the base of sequence to be formed by 2 bases, comprises the base sequence by whole combinations of 2 based compositions.
35. analyze analytical procedure by the synthetic sample of sample modulator approach of record in the claim 18.
36. analyze analytical procedure by the synthetic sample of sample modulator approach of record in the claim 19.
37. analyze analytical procedure by the synthetic sample of sample modulator approach of record in the claim 20.
38. analyze analytical procedure by the synthetic sample of sample modulator approach of record in the claim 21.
39. analyze analytical procedure, comprise the operation of an end of above-mentioned DNA chain being cut off, is prepared as the template DNA of the length of determining dna fragmentation with restriction enzyme by the synthetic sample of sample modulator approach of record in the claim 21.
CN 96112561 1995-09-18 1996-09-18 Sequential detection method for DNA basic group sequence and sample regulation method using for said method Pending CN1153825A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 96112561 CN1153825A (en) 1995-09-18 1996-09-18 Sequential detection method for DNA basic group sequence and sample regulation method using for said method

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP238141/95 1995-09-18
JP013634/96 1996-01-30
CN 96112561 CN1153825A (en) 1995-09-18 1996-09-18 Sequential detection method for DNA basic group sequence and sample regulation method using for said method

Publications (1)

Publication Number Publication Date
CN1153825A true CN1153825A (en) 1997-07-09

Family

ID=5121504

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 96112561 Pending CN1153825A (en) 1995-09-18 1996-09-18 Sequential detection method for DNA basic group sequence and sample regulation method using for said method

Country Status (1)

Country Link
CN (1) CN1153825A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100351391C (en) * 1998-12-23 2007-11-28 普雷本·莱克索 Sequencing method using magnifying tags
CN103290106B (en) * 2007-12-05 2015-07-29 考利达基因组股份有限公司 In sequencing reaction, base effectively determines

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100351391C (en) * 1998-12-23 2007-11-28 普雷本·莱克索 Sequencing method using magnifying tags
CN103290106B (en) * 2007-12-05 2015-07-29 考利达基因组股份有限公司 In sequencing reaction, base effectively determines

Similar Documents

Publication Publication Date Title
CN1128884C (en) Methods and compositions for efficient nucleic acid sequencing
US7262030B2 (en) Multiple sequencible and ligatible structures for genomic analysis
CN1896284A (en) Method for identifying allelic gene type
CN1076397C (en) Mycobacterium primers and probes
CN1040220A (en) A kind of method of amplification of nucleotide sequences
CN1473201A (en) Method for amplification and optional characterisation of nucleic acids
EP1790723A2 (en) Direct cloning of PCR amplified nucleic acids
CN1177640A (en) Improved heat-stable DNA polymerase
CN1059562A (en) Reduce the method for carryover contamination in the amplification procedure
CN1500887A (en) Method for detecting primer elongation reaction, method and apparatus for distinguishing kinds of basic groups
CN1697882A (en) Multiplex PCR
KR20130018575A (en) Method for synthesizing nucleic acid molecules
CN1218832A (en) Thermal stable DNA polyase for detecting change of frequency
CN1293204C (en) Method for determining alleles
CN1863927A (en) Nucleic acid detection assay
CN107354211B (en) Forest musk deer four-base microsatellite genetic marker locus and screening method thereof
CN1628124A (en) Heteroconfigurational polynucleotide and methods of use
CN1818070A (en) Methods of manipulating and sequencing nucleic acid molecules using transposition and recombination
CN1944682A (en) Determination of alkali base sequence and reagent
CN1325446A (en) Method for synthesizing DNA
CN1346411A (en) Method of amplification of nucleic acids
CN1209464C (en) Synthesis of poly deoxynucleosides, synthesis of chromosome DNA, and method for preparing chromosome
US20220220542A1 (en) Capture and analysis of target genomic regions
CN1153825A (en) Sequential detection method for DNA basic group sequence and sample regulation method using for said method
JP2022535029A (en) Flexible, high-throughput sequencing of target gene regions

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication