CN115369179A - Kit and method for rapidly detecting KPC-2 - Google Patents
Kit and method for rapidly detecting KPC-2 Download PDFInfo
- Publication number
- CN115369179A CN115369179A CN202211224489.1A CN202211224489A CN115369179A CN 115369179 A CN115369179 A CN 115369179A CN 202211224489 A CN202211224489 A CN 202211224489A CN 115369179 A CN115369179 A CN 115369179A
- Authority
- CN
- China
- Prior art keywords
- solution
- concentration
- volume
- kpc
- temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/22—Klebsiella
Abstract
The kit for rapidly detecting KPC-2 comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the total volume of the amplification primer pair is 20-50 mu L and is used for detecting KPC-2; the buffer solution comprises Taq DNA polymerase, dNTP solution and MgCl 2 Solution, naHCO 3 Solution, mg (OH) 2 Solution, tris HCl solution with pH 8.3, fe (OH) 2 Solution, fe (OH) 3 Solution, tween20 with final concentration of 0.05-0.1%; adding DNA of a sample to be detected, supplementing deionized purified water to 20-50 mu L, and fully mixing. The invention circularly extends the extension cyclotomic section under the condition of the same initial concentration, the concentration of the DNA polymerase is higher than that of the traditional DNA polymerase, and further the extension efficiency of the extension cyclosection is higher, thereby realizing that the extension characteristic is more obvious while reducing the cycle number,and finally, the detection efficiency is accelerated.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to a kit for rapidly detecting KPC-2, which can effectively shorten the single cycle time and reduce the loss of DNA polymerase during detection while ensuring the detection quality so as to improve the overall detection efficiency.
Background
Klebsiella pneumoniae (Klebsiella pneumoniae) is a common nosocomial pathogen and is one of the pathogenic bacteria which are intensively monitored in clinical hospital infection. Along with the wide-range use of carbapenem antibiotics, multidrug-resistant klebsiella pneumoniae continuously appears.
It has been reported that some bacteria of the genus Enterobacter also carry Klebsiella pneumoniae type carbapenemases, such as Escherichia coli, salmonella, enterobacter cloacae, klebsiella oxytoca, serratia arenicola, etc., which have been found to fail in the treatment of bacterial infectious diseases with clinical antibiotics or cause a delay in the course of treatment. The mechanism of drug resistance generation of klebsiella pneumoniae is mainly that thalli generate plasmid-mediated extended-spectrum beta-lactamase (ESBLs) and cephalosporins (AmpC) enzymes, thereby causing loss of outer membrane porin of the thalli, active discharge of antibacterial drugs, formation of biofilm, genetic variation and the like.
The real-time fluorescent quantitative PCR detection mainly comprises three steps: denaturation link, primer annealing link and extension link. In the cycle of the denaturation step, the temperature is generally 95 ℃, so that various target DNA sequences are completely denatured, a double-stranded DNA template is broken by hydrogen bonds under the action of heat to form single-stranded DNA, and the target sequences are not completely denatured due to too short denaturation time or too low temperature, so that amplification failure is easily caused. The annealing temperature in the primer annealing step needs to be determined from many aspects, generally, the Tm value of the primer is taken as a reference, the annealing temperature is properly adjusted downwards according to the amplified length, and the temperature is usually between 45 ℃ and 55 ℃, and the primer is combined with the DNA template to form a local double strand. The temperature of the extension step is about 72 ℃ (optimum activity), dNTP is used as raw material, and the primer is extended from the 3' end in the direction from 5' → 3' end, so that a DNA strand complementary to the template is synthesized. The existing real-time fluorescence quantitative PCR technology can effectively screen against Klebsiella pneumoniae KPC-2, but the current single cycle time is longer, the loss amount of DNA polymerase in detection is higher, and the detection efficiency is lower.
Therefore, a kit for rapidly detecting KPC-2, which ensures detection quality, effectively shortens single cycle time, reduces loss of DNA polymerase during detection, and improves overall detection efficiency, is needed.
Disclosure of Invention
The invention aims to solve the technical problem of providing a kit for rapidly detecting KPC-2, which ensures the detection quality, effectively shortens the single cycle time, reduces the loss of DNA polymerase during detection and further improves the overall detection efficiency.
The invention relates to a kit for rapidly detecting KPC-2, which comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the amplification primer pair is used for detecting KPC-2, and the total volume of the amplification primer pair is 20-50 mu L;
the amplification primer pair comprises KPC-F and KPC-R;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: the volume of KPC-F solution with concentration of 8umol/L is 1-2 muL, the volume of KPC-R solution with concentration of 8umol/L is 1-2 muL, and the volume of molecular beacon probe solution with concentration of 10umol/L is 0.6-1.5 muL;
the buffer solution comprises 1-3 mu L of Taq DNA polymerase solution with the concentration of 1.6U/mu L, 3-8 mu L of dNTP solution with the concentration of 2.5mmol/L and 0.5mmol/L MgCl 2 NaHCO with solution volume of 2-4 mu L and concentration of 1mmol/L 3 The volume of the solution is 2-4 mu L, and the concentration is 1mmol/L Mg (OH) 2 The volume of the Tris HCl solution with the pH value of 8.3 and the concentration of 20mmol/L is 1-4 mu L, the volume of the Tris HCl solution is 0.7-1.5 mu L, and the concentration of the Fe (OH) is 1mmol/L 2 The volume of the solution is 0.8-2 mu L, and the concentration is 1mmol/L Fe (OH) 3 Tween20 with a solution volume of 1.5-2.5 μ L and a final concentration of 0.05-0.1%;
adding DNA of a sample to be detected, supplementing deionized purified water to 20-50 mu L, and fully mixing.
The invention relates to a kit for rapidly detecting KPC-2, which comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the amplification primer pair is used for detecting KPC-2, and the total volume of the amplification primer pair is 30 mu L;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: the volume of KPC-F solution with concentration of 8umol/L is 1.2 muL, the volume of KPC-R solution with concentration of 8umol/L is 1.2 muL, and the volume of molecular beacon probe solution with concentration of 10umol/L is 0.8 muL;
the buffer solution comprises 2 mu L of Taq DNA polymerase solution with the concentration of 1.6U/mu L, 5 mu L of dNTP solution with the concentration of 2.5mmol/L and 0.5mmol/L MgCl 2 NaHCO with solution volume of 3 mu L and concentration of 1mmol/L 3 The volume of the solution was 3. Mu.L, mg (OH) concentration was 1mmol/L 2 Tris HCl solution with pH 8.3 and concentration of 2 μ L and 20mmol/L, fe (OH) with concentration of 1mmol/L and volume of 1 μ L 2 The volume of the solution was 1. Mu.L, and the concentration was 1mmol/L Fe (OH) 3 Tween20 at a solution volume of 2. Mu.L and a final concentration of 0.07%;
adding DNA of a sample to be detected, supplementing deionized purified water to 30 mu L, and fully mixing.
The invention relates to a kit for rapidly detecting KPC-2, which comprises the following steps:
step 1: extracting DNA of a sample to be detected of thalli in the sample to be detected, and storing at-20 ℃ for later use;
step 2: adding the amplification primer and the molecular beacon probe in the claim 1 into extracted DNA serving as a template, adding a buffer solution, sealing, putting into a PCR fluorescence detection device which is started in advance and preheated to 39 ℃ for real-time fluorescence quantitative PCR experiment, and carrying out curve analysis on an amplification product.
The invention relates to a kit for rapidly detecting KPC-2, wherein the reaction program of a PCR device is set as follows:
s3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature gradually reaches 60 ℃ from 39 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually adopted from 60 ℃ to 88 ℃ at 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
s3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, then increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
s3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining for 40 seconds, collecting fluorescence signals once every 0.1s and recording the fluorescence signals into a corresponding amplification curve graph;
s3.4: completing the S3.3 circulation for 40 times, and cooling the reaction mixture to 4 ℃ to terminate the reaction;
compared with the traditional PCR technology, the kit for rapidly detecting KPC-2 provided by the invention has the difference that the subsequent continuous addition of DNA polymerase is not required, and the pressure condition in the test tube is adjusted in real time along with the temperature and the action occasion required by the DNA polymerase, so that the denaturation link originally performed at the high temperature of 95 ℃ is performed at 88 ℃ with higher pressure, the unwinding of DNA is more complete, the loss rate of the DNA polymerase in the high-temperature denaturation link is reduced while the temperature is reduced, the concentration of the DNA polymerase is higher than that of the traditional DNA polymerase when the loop is circularly extended under the condition of the same initial concentration, the extension efficiency of the extension loop is higher, the cycle number is reduced, the extension characteristic is more obvious, and the detection efficiency is finally accelerated.
The kit for rapidly detecting KPC-2 of the present invention is further described below with reference to the accompanying drawings.
Drawings
FIG. 1 is a summary of KPC-2 amplification curves for the same test sample.
Detailed Description
As shown in figure 1, referring to figure 1, the kit for rapidly detecting KPC-2 comprises an amplification primer pair for detecting KPC-2, a molecular beacon probe and a buffer solution, wherein the total volume of the amplification primer pair is 20-50 mu L;
the amplification primer pair comprises KPC-F and KPC-R;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: the volume of KPC-F solution with concentration of 8umol/L is 1-2 muL, the volume of KPC-R solution with concentration of 8umol/L is 1-2 muL, and the volume of molecular beacon probe solution with concentration of 10umol/L is 0.6-1.5 muL;
the buffer solution comprises 1-3 mu L of Taq DNA polymerase solution with the concentration of 1.6U/mu L, 3-8 mu L of dNTP solution with the concentration of 2.5mmol/L and 0.5mmol/L MgCl 2 NaHCO with solution volume of 2-4 mu L and concentration of 1mmol/L 3 The volume of the solution is 2-4 mu L, and the concentration is 1mmol/L Mg (OH) 2 The volume of the Tris HCl solution with the pH value of 8.3 and the concentration of 20mmol/L is 1-4 mu L, the volume of the Tris HCl solution is 0.7-1.5 mu L, and the concentration of the Fe (OH) is 1mmol/L 2 The volume of the solution is 0.8-2 mu L, and the concentration is 1mmol/L Fe (OH) 3 Tween20 with a solution volume of 1.5-2.5 μ L and a final concentration of 0.05-0.1%;
adding DNA of a sample to be detected, supplementing deionized purified water to 20-50 mu L and fully mixing.
Wherein the KPC-F, KPC-R sequence of the primer group of KPC-2 gene is as follows:
KPC-F：tcgtctggcccactgggcgcgc；
KPC-R：atccctcgagcgcgagtcta。
wherein, the sequence of the molecular beacon probe is as follows: VIC-cacccgggcgcctaacaaggatga-BHQ1.
Further optimization of the invention comprises an amplification primer pair for detecting KPC-2 with a total volume of 30 muL, a molecular beacon probe and a buffer solution;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: the volume of KPC-F solution with the concentration of 8umol/L is 1.2 muL, the volume of KPC-R solution with the concentration of 8umol/L is 1.2 muL, and the volume of molecular beacon probe solution with the concentration of 10umol/L is 0.8 muL;
the buffer solution comprises a concentrateTaq DNA polymerase solution at a concentration of 1.6U/. Mu.L in a volume of 2. Mu.L, dNTP solution at a concentration of 2.5mmol/L in a volume of 5. Mu.L, and MgCl at a concentration of 0.5mmol/L 2 NaHCO with solution volume of 3 mu L and concentration of 1mmol/L 3 The volume of the solution was 3. Mu.L, mg (OH) concentration 1mmol/L 2 Tris HCl solution with pH 8.3 and concentration of 2 μ L and 20mmol/L, fe (OH) with concentration of 1mmol/L and volume of 1 μ L 2 The volume of the solution was 1. Mu.L, and the concentration was 1mmol/L Fe (OH) 3 Tween20 at a solution volume of 2. Mu.L and a final concentration of 0.07%;
adding DNA of a sample to be detected, supplementing deionized purified water to 30 mu L, and fully mixing.
The kit for rapidly detecting KPC-2 is different from the prior art in that NaHCO is added into buffer solution 3 、Mg(OH) 2 、Fe(OH) 2 、Fe(OH) 3 The method is characterized in that the solution environment of the DNA polymerase is flexibly adjusted, the pressure in a test tube and the concentration of magnesium ions are dynamically changed along with the temperature change in a PCR experiment, so that the activity of the DNA polymerase is adjusted in real time when the DNA polymerase is required to work or not work, the temperature required by DNA unwinding is reduced by improving the pressure, and further the loss of the DNA polymerase in a denaturation link is reduced, more DNA polymerase can be used and the activity given by the environment is stronger after the DNA polymerase enters an extension link in the later period, the time required by the extension link is shortened on the basis of ensuring the quality, the cycle time required by each PCR experiment is reduced, a fluorescence characteristic curve is displayed more quickly, and the aim of quick detection is fulfilled.
The invention relates to a kit for rapidly detecting KPC-2, which comprises the following use steps:
step 1: extracting DNA of a sample to be detected of thalli in the sample to be detected, and storing at-20 ℃ for later use;
step 2: adding the amplification primer and the molecular beacon probe in the claim 1 into extracted DNA serving as a template, adding a buffer solution, sealing, putting into a PCR fluorescence detection device which is started in advance and preheated to 39 ℃ for real-time fluorescence quantitative PCR experiment, and carrying out curve analysis on an amplification product.
The invention tries to establish the linear relation between the Ct value of a DNA template and the initial copy number of the DNA template in the exponential growth period of PCR amplification through a real-time quantitative fluorescent PCR experiment, and further, the invention can rapidly identify the strain from the mutual matching of the probe and the primer in claim 1, thereby becoming the basis of quantification.
Wherein the DNA of the sample to be tested is extracted by using a commercial kit of TIANGEN BIOTECH (BEIJING).
Wherein, can not only practice thrift the experimental time through going on getting hotter to the instrument in advance, can also effectively prolong the life of instrument.
Wherein, the PCR fluorescence detection equipment is selected from: the FT-CW32 should be a quantitative PCR instrument in real time.
As a further explanation of the present invention, the set PCR equipment reaction program for a kit for rapid detection of KPC-2 is as follows:
s3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature is gradually increased from 39 ℃ to 60 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually increased from 60 ℃ to 88 ℃ by 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
the invention makes template DNA molecule completely denature and activates thermostable DNA polymerase by heating to 88 deg.C, so that heating is carried out at the speed of 1.6 deg.C/s after 2 deg.C/s before the temperature is increased to 60 deg.C, in order to mix NaHCO in reagent 3 Sustained slow release of CO 2 The pressure in the closed test tube is gradually enhanced to avoid the too fast rise of the pressure in the test tube, and the original unwinding temperature of the DNA is reduced from 95 ℃ to about 88 ℃ just by the increase of the pressure in the test tube, so that the temperature reduction not only can reduce the temperature rise time, but also is beneficial to reducing the possibility of inactivation or denaturation of the DNA polymerase and is beneficial to shortening the time required by the subsequent extension stage.
The invention prepares nano-grade Fe 3 O 4 The method of (1), namely, the divalent iron ion Fe 2+ And ferric ion Fe 3+ Reacting at 70 deg.C or above and in alkaline environment rich in hydroxyl to obtain magnetic Fe 3 O 4 Nanoparticles, a process which makes the originalHeavy metal ion Fe of 2+ 、Fe 3+ The activity of DNA polymerase is inhibited in the early stage of the experiment, and Fe3O4 with magnetism is generated in the middle and later stages, so that the nano-scale Fe 3 O 4 The particles provide a magnetic field for the DNA polymerase to further activate the enzyme, and promote the replication and synthesis of DNA under the action of the magnetic field, so that the time required by the DNA polymerase to form a DNA chain in an amplification extension phase is shortened, the synthesis time of a single DNA chain is shortened, the experimental time is further shortened, and the efficiency is improved.
In the PCR experiment process, the temperature and the acid-base environment are suitable for preparing the ferroferric oxide crystal particles, so that nano-grade ferroferric oxide does not need to be purchased additionally, and the test cost is reduced.
Wherein the nanoscale Fe generated in the invention 3 O 4 The particles are different from the finished magnetic beads used in the purification process, the Fe of the present invention 3 O 4 The crystal does not have a hydroxyl modification layer of the finished product magnetic bead, so that the crystal cannot be attached or adsorbed to a DNA chain like a nano finished product magnetic bead, and the subsequent PCR experiment process cannot be adversely affected.
S3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s, maintaining for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
the present invention accomplishes annealing by lowering the temperature to 45 ℃ for 30 seconds, promotes binding of primers to DNA template at low temperature, and promotes CO at 45 ℃ 2 With Mg (OH) in solution 2 Bind and form Mg (HCO) 3 ) 2 Further increase Mg in the solution 2+ The concentration of the ions enhances the activity of the DNA polymerase, and when the temperature is raised to 72 ℃ for extension amplification, the efficiency of synthesizing DNA by the DNA polymerase is higher, so that the time required by the whole experiment is shortened, and the fluorescence signal in the test tube is acquired and recorded into a corresponding amplification curve chart, thereby laying a foundation for the subsequent continuous analysis.
S3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining for 40 seconds, collecting fluorescence signals once every 0.1s and recording the fluorescence signals into a corresponding amplification curve graph;
after the invention collects the fluorescence signal once, the solution is heated to the temperature for DNA denaturation and fragmentation, and the steps are repeated, and Mg (HCO) in the solution 3 ) 2 Decompose to MgCO at high temperature 3 Then from MgCO 3 Interacts with water in the solution and decomposes into Mg (OH) 2 Precipitation and CO 2 Enhancing the pressure in the closed test tube at high temperature and continuing the steps; along with the exponential amplification of the target DNA, fluorescent signals continuously emitted in the process of synthesizing the target DNA by DNA polymerase are continuously collected and recorded, so that the condition that an operator can form an amplification curve with obvious parameters through the fluorescent signals to finish the judgment of the target DNA through the operation even if the number of DNA templates is very small is ensured.
S3.4: completing the S3.3 circulation after 40 times, and cooling the reaction mixture to 4 ℃ to terminate the reaction;
compared with the traditional PCR technology, the invention not only keeps the condition that the subsequent continuous addition of DNA polymerase is not needed, but also adjusts the pressure condition in the test tube in real time along with the temperature and the action occasion required by the DNA polymerase, so that the denaturation link originally carried out at the high temperature of 95 ℃ can be carried out at the higher pressure of 88 ℃, the unwinding of the DNA is ensured to be more complete, the loss rate of the DNA polymerase in the high-temperature denaturation link is reduced while the temperature is reduced, the concentration of the DNA polymerase is higher than that of the traditional DNA polymerase when the extension loop is circularly extended under the condition of the same initial concentration, the extension efficiency of the extension loop is higher, the cycle number is reduced, the extension characteristic is more obvious, and the detection efficiency is finally accelerated.
Experimental data
Dividing the DNA of the sample to be detected of the thallus in the same sample to be detected in the step one into 5 parts according to the volume average, and respectively detecting by adopting a control group 1, a control group 2, a control group 3, an embodiment 1 and an embodiment 2, wherein the experimental data is as follows:
control group 1:
the control group adopts a carbapenem drug-resistant gene KPC detection kit (fluorescence PCR method), national food and drug administration Instrument (Standard) 2014 No. 3400850, and the fluorescence PCR detection program comprises 95 ℃ denaturation for 45 seconds, 45 ℃ annealing for 30 seconds, 72 ℃ extension for 60 seconds, circulation for 40 times, and heating and cooling are carried out at 1.8 ℃/s.
The obtained PCR fluorescence curve is shown in FIG. 1;
control group 2:
the control group comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the amplification primer pair is used for detecting KPC-2, and the total volume of the amplification primer pair is 30 mu L;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: KPC-F (8 umol/L) 1.2 μ L, KPC-R (8 umol/L) 1.2 μ L, molecular beacon probe (10 umol/L) 0.8 μ L;
the buffer solution comprises Taq DNA polymerase (1.6U/. Mu.L) 2 mu L, dNTP (2.5 mmol/L) 5 mu L, mgCl 2 (0.5 mmol/L) 3. Mu. L, PH value Tris HCl (20 mmol/L) 1. Mu. L, fe (OH) 8.3 2 (1mmol/L)1μL、Fe(OH) 3 (1 mmol/L) 2. Mu. L, tween20 final concentration 0.07%/L;
adding DNA of a sample to be detected, supplementing deionized purified water to 30 mu L, and fully mixing.
The fluorescent PCR detection program comprises
S3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature is gradually increased from 39 ℃ to 60 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually increased from 60 ℃ to 88 ℃ by 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
s3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, then increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
s3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining for 40 seconds, collecting fluorescence signals once every 0.1s and recording the fluorescence signals into a corresponding amplification curve graph;
s3.4: completing the S3.3 circulation for 40 times, and cooling the reaction mixture to 4 ℃ to terminate the reaction;
wherein the KPC-F, KPC-R sequence of the primer group of KPC-2 gene is as follows:
KPC-F：tcgtctggcccactgggcgcgc；
KPC-R：atccctcgagcgcgagtcta。
wherein, the sequence of the molecular beacon probe is as follows: VIC-cacccgggcgcctaacaaggatga-BHQ1.
Control group 3:
the control group comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the amplification primer pair is used for detecting KPC-2, and the total volume of the amplification primer pair is 30 mu L;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: KPC-F (8 umoL/L) 1.2 μ L, KPC-R (8 umoL/L) 1.2 μ L, molecular beacon probe (10 umoL/L) 0.8 μ L;
the buffer solution comprises Taq DNA polymerase (1.6U/. Mu.L) 2 mu L, dNTP (2.5 mmoL/L) 5 mu L, mgCL 2 (0.5mmoL/L)3μL、NaHCO 3 (1mmoL/L)3μL、Mg(OH) 2 (1 mmoL/L) 2 μ L, PH value 8.3 Tris HcL (20 mmoL/L) 1 μ L, tween final concentration 0.07% L;
adding DNA of a sample to be detected, supplementing deionized purified water to 30 mu L, and fully mixing.
The fluorescent PCR detection program comprises
S3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature is gradually increased from 39 ℃ to 60 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually increased from 60 ℃ to 88 ℃ by 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
s3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, then increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
s3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining for 40 seconds, collecting fluorescence signals once every 0.1s and recording the fluorescence signals into a corresponding amplification curve graph;
s3.4: completing the S3.3 circulation after 40 times, and cooling the reaction mixture to 4 ℃ to terminate the reaction;
wherein the KPC-F, KPC-R sequence of the primer group of KPC-2 gene is as follows:
KPC-F：tcgtctggcccactgggcgcgc；
KPC-R：atccctcgagcgcgagtcta。
wherein, the sequence of the molecular beacon probe is as follows: VIC-cacccgggcgcctaacaaggatga-BHQ1.
Example 1:
the present example includes an amplification primer pair for detecting KPC-2, a molecular beacon probe and a buffer in a total volume of 50 μ L;
the amplification primer pair comprises KPC-F and KPC-R;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: KPC-F (8 umol/L) 2 μ L, KPC-R (8 umol/L) 2 μ L, molecular beacon probe (10 umol/L) 1.5 μ L;
the buffer solution comprises Taq DNA polymerase (1.6U/. Mu.L) 3. Mu. L, dNTP (2.5 mmol/L) 8. Mu. L, mgCl 2 (0.5mmol/L)4μL、NaHCO 3 (1mmol/L)4μL、Mg(OH) 2 (1 mmol/L) 4. Mu. L, PH Tris Hcl (20 mmol/L) 1.5. Mu. L, fe (OH) with a value of 8.3 2 (1mmol/L)2μL、Fe(OH) 3 (1 mmol/L) 2.5. Mu. L, tween20 final concentration 0.1% L;
adding DNA of a sample to be detected, supplementing deionized purified water to 50 mu L and fully mixing.
The fluorescent PCR detection program comprises
S3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature gradually reaches 60 ℃ from 39 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually adopted from 60 ℃ to 88 ℃ at 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
s3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, then increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
s3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining the temperature for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining the temperature for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining the temperature for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining the temperature for 40 seconds, collecting a fluorescence signal every 0.1s and recording the fluorescence signal into a corresponding amplification curve graph;
s3.4: completing the S3.3 circulation for 40 times, and cooling the reaction mixture to 4 ℃ to terminate the reaction;
wherein, KPC-F, KPC-R sequence of the primer group of KPC-2 gene is as follows:
KPC-F：tcgtctggcccactgggcgcgc；
KPC-R：atccctcgagcgcgagtcta。
wherein, the sequence of the molecular beacon probe is as follows: VIC-cacccgggcgcctaacaaggatga-BHQ1.
Example 2:
the present example includes an amplification primer pair for detecting KPC-2, a molecular beacon probe and a buffer in a total volume of 30 μ L;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: KPC-F (8 umol/L) 1.2 μ L, KPC-R (8 umol/L) 1.2 μ L, molecular beacon probe (10 umol/L) 0.8 μ L;
the buffer solution comprises Taq DNA polymerase (1.6U/. Mu.L) 2 mu L, dNTP (2.5 mmol/L) 5 mu L, mgCl 2 (0.5mmol/L)3μL、NaHCO 3 (1mmol/L)3μL、Mg(OH) 2 (1 mmol/L) 2. Mu. L, PH Tris Hcl (20 mmol/L) 1. Mu. L, fe (OH) with a value of 8.3 2 (1mmol/L)1μL、Fe(OH) 3 (1 mmol/L) 2. Mu. L, tween20 final concentration 0.07%/L;
adding DNA of a sample to be detected, supplementing deionized purified water to 30 mu L, and fully mixing.
The fluorescent PCR detection program comprises
S3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature gradually reaches 60 ℃ from 39 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually adopted from 60 ℃ to 88 ℃ at 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
s3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, then increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
s3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining for 40 seconds, collecting fluorescence signals once every 0.1s and recording the fluorescence signals into a corresponding amplification curve graph;
s3.4: completing the S3.3 circulation after 40 times, and cooling the reaction mixture to 4 ℃ to terminate the reaction;
wherein, KPC-F, KPC-R sequence of the primer group of KPC-2 gene is as follows:
KPC-F：tcgtctggcccactgggcgcgc；
KPC-R：atccctcgagcgcgagtcta。
wherein the sequence of the molecular beacon probe is as follows: VIC-cacccgggcgcctaacaaggatga-BHQ1.
Data analysis
The fluorescence amplification curves of the control group 1, the control group 2, the control group 3, the example 1 and the example 2 are uniformly plotted in one graph as shown in fig. 1, and the following analysis is made based on the above experimental data;
the conventional kit represented by the control group 1 uses a 95 ℃ denaturation temperature, which causes the loss of DNA polymerase in this step to be so large that the increase of fluorescence intensity after entering the 22 nd cycle is slowed down, because the amount of DNA polymerase limits the binding efficiency of DNA chains, and therefore, the time of the extension amplification step of the control group 1 is intentionally prolonged, but the increase of fluorescence intensity is still not as good as that of other groups;
the control group 2 is represented without two substances of sodium bicarbonate and magnesium hydroxide, and the procedure is the same as that of the examples 1 and 2 and adopts 88 ℃ as the denaturation temperature, but because the sodium bicarbonate and the magnesium hydroxide are not used for adjusting the pressure in real time according to the temperature, the loss of DNA polymerase in the denaturation link is less, but the target DNA chain has incomplete breakage, the DNA chain available in the extension link is less, and the fluorescence intensity index of the control group 2 is increased later and slower than that of the example group;
the control group 3 does not have two iron ion reagents, namely ferric hydroxide and ferrous sodium hydroxide solution, and the same procedure as the examples 1 and 2 can ensure the survival rate of DNA polymerase in a denaturation link and adjust the concentration of magnesium ions in real time under the conditions of reducing the temperature and increasing the pressure in real time, so that the control group 3 has more obvious characteristic expression of fluorescence intensity in the early stage and the later stage compared with the control group 1;
example 1 after adding ferric hydroxide, ferrous sodium hydroxide, sodium bicarbonate, magnesium hydroxide solution and the procedure strictly following the procedure described in the claims, not only the fluorescence intensity characteristics appear earlier than the three control groups, but also the cycle times used to reach the maximum fluorescence intensity value are significantly less than the three control groups, because example 1 has the measures of increasing the magnesium ion concentration and generating ferroferric oxide to provide magnetic field in the extension link, the two measures make the activity of DNA polymerase sufficiently activated compared with the control groups 1, 2, 3, and further make the speed and efficiency of DNA polymerase in synthesizing DNA strand higher, and example 1 has relatively lower denaturation temperature and simultaneously increases pressure compared with control group 1, i.e. ensures that DNA strand is more thoroughly dissolved, and also effectively protects and reduces the loss amount of DNA polymerase in the denaturation link, which makes example 1 have more amount and higher activity of DNA polymerase than control group 1 in the extension link, which also promotes the slope change of the fluorescence intensity curve to appear earlier and maintains a higher change amount of the characteristics in the extension link;
example 2 the mixing ratio of the amplification primer pair, the molecular beacon probe and the buffer solution was further adjusted relative to example 1, so that the fluorescence intensity curve representing example 2 appeared earlier and consistently in high growth potential than that of example 1.
It is particularly noted that the time required for a single cycle of the control group 1 is longer than that of the control groups 2 and 3 and the embodiments 1 and 2, the cycle time of the control group 1 is longer than that of the control group 2 and 3, the final temperature of the denaturation link and the temperature rise and decrease speed, the whole program flow of the control group 1 needs 2.3 hours, and the time required for the whole programs of the embodiments 1 and 2 is only 1.4 hours.
The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solution of the present invention by those skilled in the art should fall within the protection scope defined by the claims of the present invention without departing from the spirit of the present invention.
Claims (4)
1. A kit for rapidly detecting KPC-2, which is characterized in that: comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the amplification primer pair is used for detecting KPC-2, and the total volume of the amplification primer pair is 20-50 mu L;
the amplification primer pair comprises KPC-F and KPC-R;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: the volume of KPC-F solution with concentration of 8umol/L is 1-2 muL, the volume of KPC-R solution with concentration of 8umol/L is 1-2 muL, and the volume of molecular beacon probe solution with concentration of 10umol/L is 0.6-1.5 muL;
the buffer solution comprises Taq DNA polymerase solution with the concentration of 1.6U/. Mu.LA dNTP solution with the volume of 1-3 mu L and the concentration of 2.5mmol/L, a MgCl solution with the volume of 3-8 mu L and the concentration of 0.5mmol/L 2 NaHCO with the solution volume of 2-4 mu L and the concentration of 1mmol/L 3 The volume of the solution is 2-4 mu L, and the concentration is 1mmol/L Mg (OH) 2 The volume of the Tris HCl solution with the pH value of 8.3 and the concentration of 20mmol/L is 1-4 mu L, the volume of the Tris HCl solution is 0.7-1.5 mu L, and the concentration of the Fe (OH) is 1mmol/L 2 The volume of the solution is 0.8-2 mu L, and the concentration is 1mmol/L Fe (OH) 3 Tween20 with a solution volume of 1.5-2.5 μ L and a final concentration of 0.05-0.1%;
adding DNA of a sample to be detected, supplementing deionized purified water to 20-50 mu L, and fully mixing.
2. A kit for rapid detection of KPC-2 according to claim 1, characterized in that: comprises an amplification primer pair, a molecular beacon probe and a buffer solution, wherein the amplification primer pair is used for detecting KPC-2, and the total volume of the amplification primer pair is 30 mu L;
the concentrations and the mixture ratio of the amplification primer pair, the molecular beacon probe and the buffer solution are as follows: the volume of KPC-F solution with concentration of 8umol/L is 1.2 muL, the volume of KPC-R solution with concentration of 8umol/L is 1.2 muL, and the volume of molecular beacon probe solution with concentration of 10umol/L is 0.8 muL;
the buffer solution comprises 2 mu L of Taq DNA polymerase solution with the concentration of 1.6U/mu L, 5 mu L of dNTP solution with the concentration of 2.5mmol/L and 0.5mmol/L MgCl 2 NaHCO with solution volume of 3 mu L and concentration of 1mmol/L 3 The volume of the solution was 3. Mu.L, mg (OH) concentration 1mmol/L 2 Tris HCl solution with pH 8.3 and concentration of 2 μ L and 20mmol/L, fe (OH) with concentration of 1mmol/L and volume of 1 μ L 2 The volume of the solution was 1. Mu.L, and the concentration was 1mmol/L Fe (OH) 3 Tween20 with a solution volume of 2. Mu.L and a final concentration of 0.07%;
adding DNA of a sample to be detected, supplementing deionized purified water to 30 mu L, and fully mixing.
3. A method for rapid detection of KPC-2 with a kit according to claim 2 for non-diagnostic and therapeutic purposes, characterized in that it comprises the following steps:
step 1: extracting DNA of a sample to be detected of thalli in the sample to be detected, and storing at-20 ℃ for later use;
step 2: adding the amplification primer and the molecular beacon probe in the claim 1 into extracted DNA serving as a template, adding a buffer solution, sealing, putting into a PCR fluorescence detection device which is started in advance and preheated to 39 ℃ for real-time fluorescence quantitative PCR experiment, and carrying out curve analysis on an amplification product.
4. The method for rapid detection of KPC-2 with a kit for non-diagnostic and therapeutic purposes according to claim 3, wherein the PCR reaction procedure in step 2 is:
s3.1: the temperature rise speed of 2 ℃/s is adopted before the temperature is gradually increased from 39 ℃ to 60 ℃, the temperature is maintained for 5 seconds after the temperature reaches 60 ℃, the temperature is gradually increased from 60 ℃ to 88 ℃ by 1.6 ℃/s, and the temperature is maintained for 30 seconds after the temperature reaches 88 ℃;
s3.2: reducing the temperature to 45 ℃ at a cooling speed of 2 ℃/s for 30 seconds, then increasing the temperature to 60 ℃ at a heating speed of 2 ℃/s for 5 seconds, increasing the temperature to 72 ℃ at a heating speed of 1.6 ℃/s for 40 seconds, collecting a fluorescence signal every 0.1s, and recording the fluorescence signal into a corresponding amplification curve chart;
s3.3: heating the temperature to 88 ℃ at a heating rate of 1.6 ℃/s and maintaining for 30 seconds, then reducing the temperature to 45 ℃ at a cooling rate of 2 ℃/s and maintaining for 30 seconds, heating to 60 ℃ at a heating rate of 2 ℃/s and maintaining for 5 seconds, heating to 72 ℃ at a heating rate of 1.6 ℃/s and maintaining for 40 seconds, collecting fluorescence signals once every 0.1s and recording the fluorescence signals into a corresponding amplification curve graph;
s3.4: the S3.3 cycle was performed 40 times and then completed, and the reaction mixture was cooled to 4 ℃ to terminate the reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211224489.1A CN115369179A (en) | 2022-10-08 | 2022-10-08 | Kit and method for rapidly detecting KPC-2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211224489.1A CN115369179A (en) | 2022-10-08 | 2022-10-08 | Kit and method for rapidly detecting KPC-2 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115369179A true CN115369179A (en) | 2022-11-22 |
Family
ID=84073220
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211224489.1A Pending CN115369179A (en) | 2022-10-08 | 2022-10-08 | Kit and method for rapidly detecting KPC-2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115369179A (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030235535A1 (en) * | 2002-04-15 | 2003-12-25 | Qun-Yong Zhou | Screening and therapeutic methods for treating circadian rhythm disorders |
| CN101403016A (en) * | 2008-10-30 | 2009-04-08 | 兰州普利生物技术开发有限公司 | HBV viral antigen, ligand pipe PCR detection kit, preparation and uses thereof |
| WO2013004933A1 (en) * | 2011-07-05 | 2013-01-10 | Assistance Publique - Hopitaux De Marseille | Culturing and detection of a methanogenic archaeon |
| CN105349685A (en) * | 2007-04-06 | 2016-02-24 | 贝克顿·迪金森公司 | Compositions and methods for the identification of a carbapenemase gene |
| CN105950772A (en) * | 2016-07-11 | 2016-09-21 | 宁波基内生物技术有限公司 | Primer, probe, method and kit for detecting KPC (Klebsiella Pneumoniae Carbapenemases) antibiotic gene |
| CN110438247A (en) * | 2019-08-20 | 2019-11-12 | 中国医学科学院北京协和医院 | For detecting the nucleic acid reagent, kit, system and method for Escherichia coli and Klebsiella pneumoniae and its toxicity and drug resistance |
| CN111549150A (en) * | 2020-05-06 | 2020-08-18 | 南京实践医学检验有限公司 | Kit and method for detecting klebsiella pneumoniae |
| US20210115455A1 (en) * | 2017-04-18 | 2021-04-22 | Yale University | Compositions and methods for regulated gene expression |
| CN114720696A (en) * | 2022-04-02 | 2022-07-08 | 应节(南京)智能科技有限公司 | Kit for detecting canine/feline toxoplasma antibody and blocking ELISA (enzyme-linked immunosorbent assay) detection method |
-
2022
- 2022-10-08 CN CN202211224489.1A patent/CN115369179A/en active Pending
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030235535A1 (en) * | 2002-04-15 | 2003-12-25 | Qun-Yong Zhou | Screening and therapeutic methods for treating circadian rhythm disorders |
| CN105349685A (en) * | 2007-04-06 | 2016-02-24 | 贝克顿·迪金森公司 | Compositions and methods for the identification of a carbapenemase gene |
| CN101403016A (en) * | 2008-10-30 | 2009-04-08 | 兰州普利生物技术开发有限公司 | HBV viral antigen, ligand pipe PCR detection kit, preparation and uses thereof |
| WO2013004933A1 (en) * | 2011-07-05 | 2013-01-10 | Assistance Publique - Hopitaux De Marseille | Culturing and detection of a methanogenic archaeon |
| CN105950772A (en) * | 2016-07-11 | 2016-09-21 | 宁波基内生物技术有限公司 | Primer, probe, method and kit for detecting KPC (Klebsiella Pneumoniae Carbapenemases) antibiotic gene |
| US20210115455A1 (en) * | 2017-04-18 | 2021-04-22 | Yale University | Compositions and methods for regulated gene expression |
| CN110438247A (en) * | 2019-08-20 | 2019-11-12 | 中国医学科学院北京协和医院 | For detecting the nucleic acid reagent, kit, system and method for Escherichia coli and Klebsiella pneumoniae and its toxicity and drug resistance |
| CN111549150A (en) * | 2020-05-06 | 2020-08-18 | 南京实践医学检验有限公司 | Kit and method for detecting klebsiella pneumoniae |
| CN114720696A (en) * | 2022-04-02 | 2022-07-08 | 应节(南京)智能科技有限公司 | Kit for detecting canine/feline toxoplasma antibody and blocking ELISA (enzyme-linked immunosorbent assay) detection method |
Non-Patent Citations (2)
| Title |
|---|
| AGNIESZKA KUFFEL等: "Impact of metal ions on PCR inhibition and RT-PCR efficiency", 《INT J LEGAL MED.》, vol. 135, no. 1, pages 227 - 72 * |
| 蒙正群等: "兔出血症病毒TaqMan荧光定量PCR检测方法的建立", 《中国兽医科学》, no. 06, pages 694 - 700 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11274351B2 (en) | Methods and compositions for detecting bacterial contamination | |
| WO2020215652A1 (en) | Detection technology system for enriching low-abundance dna mutation on the basis of nuclease-coupled pcr principle and application thereof | |
| Qing et al. | Dumbbell DNA-templated CuNPs as a nano-fluorescent probe for detection of enzymes involved in ligase-mediated DNA repair | |
| JP2013521776A5 (en) | ||
| CN112159854B (en) | Primer composition for detecting CRISPR/Cas12a of escherichia coli O157-H7 and detection method | |
| US20220372558A1 (en) | Method and Kit of Detecting the Absence of Micro-Organisms | |
| JPWO2016039377A1 (en) | How to use thermostable mismatch endonuclease | |
| CN113621717A (en) | Streptococcus suis rapid visualization RPA detection kit based on CRISPR-Cas12a and application thereof | |
| CN111936633A (en) | Microbial isolation and detection | |
| CN112522378B (en) | Kit for detecting MCR gene, detection method and application thereof | |
| WO2021114914A1 (en) | Bismuthene nanosheet fluorescence quenching based biosensor, and mirna detection kit and use thereof | |
| CN110241182B (en) | Synthesis method of quenched fluorescent RNA marker and method applied to detection of food-borne pathogenic bacteria | |
| Shen et al. | Dynamic light scattering and fluorescence dual-signal sensing of cancer antigen-125 via recognition of the polymerase chain reaction product with gold nanoparticle probe | |
| Su et al. | RNA‐Cleaving DNAzyme‐Based Amplification Strategies for Biosensing and Therapy | |
| CN115369179A (en) | Kit and method for rapidly detecting KPC-2 | |
| CN106868171B (en) | Kit for detecting clinical common pathogenic bacteria by RNA isothermal amplification melting curve method and application thereof | |
| KR101737314B1 (en) | Genetic Marker for Dectecting Macrobrachium Rosenbergii Nodavirus, and Method for Detecting Macrobrachium Rosenbergii Nodavirus Using the Same | |
| CN114410790B (en) | Biosensing detection system for detecting ctDNA and detection method thereof | |
| JP2013523097A (en) | Methods for controlling oligonucleotide functionality | |
| CN113897416A (en) | CRISPR/Cas12f detection system and application thereof | |
| Wang et al. | An improved recombinase polymerase amplification assay for the visual detection of Staphylococcus epidermidis with lateral flow strips | |
| Jiao et al. | A genosensor platform based on DNA biofunctionalized SNCNCs coupled with “IS-primer” amplification reaction for sensitive and rapid Listeria monocytogenes detection | |
| CN110628923A (en) | Primer combination, kit and PSR method for detecting Klebsiella pneumoniae | |
| US10053727B2 (en) | Oligonucleotide and method for detecting target DNA in a sample by fluorescence from copper nanoparticles | |
| CN114456802B (en) | Ratio type silver nano-cluster fluorescent probe and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |