CN115354047B - Agrobacterium-mediated tripterygium genetic transformation method and method for obtaining A - Google Patents
Agrobacterium-mediated tripterygium genetic transformation method and method for obtaining A Download PDFInfo
- Publication number
- CN115354047B CN115354047B CN202210955250.5A CN202210955250A CN115354047B CN 115354047 B CN115354047 B CN 115354047B CN 202210955250 A CN202210955250 A CN 202210955250A CN 115354047 B CN115354047 B CN 115354047B
- Authority
- CN
- China
- Prior art keywords
- tripterygium wilfordii
- culture medium
- agrobacterium
- culture
- infection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/40—Afforestation or reforestation
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an agrobacterium-mediated tripterygium wilfordii genetic transformation method and a method for acquiring a first element, wherein the agrobacterium-mediated tripterygium wilfordii genetic transformation method comprises the following steps: taking leaves of tripterygium wilfordii as explants, infecting the tripterygium wilfordii explants by adopting recombinant agrobacterium containing target DNA, and then co-culturing on a co-culture medium; culturing the infected explant to obtain the transgenic tripterygium wilfordii plant. The invention has the advantages of high transformation efficiency, good repeatability and the like, not only comprises the step of obtaining transgenic plants, but also comprises the verification of the transgenic plants, forms a complete transgenic system, has important significance for genetic transformation research of the tripterygium wilfordii, and lays an important foundation for genetic engineering and metabolic engineering of the tripterygium wilfordii, thereby cultivating new tripterygium wilfordii resources with high triptolide yield.
Description
Technical Field
The invention belongs to the field of plants and application thereof, and particularly relates to an agrobacterium-mediated tripterygium genetic transformation method and a method for obtaining a triptolide.
Background
Radix Tripterygii WilfordiiTripterygium wilfordiiHook.f.) is a plant of the genus tripterygium of the family celastraceae, vine shrubs, an important medicinal plant and plant with insecticidal activity. The tripterygium wilfordii contains more than 400 active terpenoid compounds, and has stronger biological activities such as anti-inflammatory, anti-tumor, immunosuppression, anticancer and the like, and agricultural activities such as disinsection, rat killing, bacteriostasis and the like.
Although the tripterygium wilfordii has important biological activity and economic value, the tripterygium wilfordii is mostly adopted in wild resources, and various problems of lack of natural resources, slow growth, low content, complex structure, uneconomical chemical synthesis and the like cause the serious lack of the tripterygium wilfordii resources, so that the market demand is difficult to meet. Therefore, the improvement of the yield of the secondary metabolites of the tripterygium wilfordii by using biotechnology such as gene and metabolic engineering is an important measure for solving the natural resources. However, the genetic transformation system of the tripterygium wilfordii is not sound, which limits the deep development of researches on the functional genes, the synthesis biology and the like of the tripterygium wilfordii to a great extent.
Agrobacterium (Agrobacterium) plantAgrobacterium) The mediated genetic transformation has been widely applied to plant transgenosis due to the advantages of simplicity, high efficiency, low cost, good repeatability and the like, but has not been reported in tripterygium wilfordii. Therefore, in order to advance genetic transformation research of tripterygium wilfordii, genetic improvement of tripterygium wilfordii by genetic engineering and metabolic engineering must be established by a perfect agrobacterium-mediated tripterygium wilfordii genetic transformation method.
Disclosure of Invention
The invention aims to provide an agrobacterium-mediated tripterygium wilfordii genetic transformation method and a triptolide acquisition method, which adopt genetic transformation technology to improve the content of tripterygium wilfordii active substances.
In order to achieve the above purpose, the technical scheme adopted by the invention comprises the following steps:
an agrobacterium-mediated genetic transformation method of tripterygium wilfordii, comprising the following steps: (1) Taking tripterygium wilfordii leaves as explants, and placing the tripterygium wilfordii leaves in agrobacterium infection solution for infection to obtain the infected explants; (2) Placing the infected explant on a co-culture medium for dark culture to obtain a co-culture explant; co-culturing the explant in a screening culture medium for dark culture, and screening the resistant callus; (3) Transferring the resistant callus to a differentiation medium, culturing under illumination, and inducing adventitious bud generation; inducing adventitious buds into rooting culture medium to root, and culturing under light to obtain resistant seedlings; taking leaves of resistant seedlings, and carrying out transgenic identification and screening to obtain positive seedlings; and transferring the positive seedlings into nutrient soil to obtain transgenic plants.
Optionally, theIs prepared by mixing the agrobacterium infection solution containing 10mM MgCl 2 10mM 2-morpholinoethanesulfonic acid and 100. Mu.M acetosyringone; the agrobacterium OD in the agrobacterium infection liquid 600 0.4 to 1.0.
Optionally, the infection is performed by placing the substrate in an agrobacterium infection solution, including: the explant is soaked in agrobacterium infection liquid for 5-20 min, then vacuum infection is carried out, the vacuum infection pressure is-0.05 to-0.09 Mpa, and the infection time is 0-5 min.
Optionally, the co-culture medium is an MS solid medium containing 0.2-1.0 mg/L of 2,4-D, 0.1-0.5 mg/L of KT and 0-100 mu M of acetyl caryophyllone; the culture time of the co-culture is 1-5 d.
Optionally, the screening culture medium is an MS solid culture medium containing 0.2-1.0 mg/L2, 4-D, 0.1-0.5 mg/L KT, 100-400 mg/L timentin and 100 mg/L kanamycin; or kanamycin was replaced with 25mg/L hygromycin B.
Alternatively, the differentiation medium is MS solid medium containing 0.5-2.0 mg/L6-benzyl aminopurine and 0.05-0.5 mg/L naphthylacetic acid.
Optionally, the rooting culture medium is an MS solid culture medium containing 0.5-4 mg/L IBA or NAA.
Optionally, the tripterygium wilfordii leaves in (1) are also subjected to preculture, wherein the preculture condition is darkness.
Optionally, the culture medium for the pre-culture of the tripterygium wilfordii leaves is an MS solid culture medium containing 0.2-1.0 mg/L2, 4-D and 0.1-0.5 mg/L KT; the culture time of the preculture is 2-5 d.
A method for obtaining triptolide comprises the step of extracting triptolide by using a transgenic plant obtained by any agrobacterium-mediated tripterygium genetic transformation method.
The invention has the advantages that:
the invention establishes an agrobacterium-mediated genetic transformation system of tripterygium wilfordii, takes tripterygium wilfordii tissues as explants, and utilizes agrobacterium as mediation to introduce exogenous genes into a tripterygium wilfordii genome, thereby obtaining stable transgenic tripterygium wilfordii. The method can simply and efficiently transform the thunder god vine, solves the bottleneck problem of genetic transformation of the thunder god vine, and has important significance for genetic transformation research of the thunder god vine and improvement of the content of active compounds of the thunder god vine.
Drawings
FIG. 1 Agrobacterium-mediated induction and detection of Tripterygium wilfordii resistant calli. a, a tripterygium wilfordii leaf explant; b, growing a resistant callus by the transgenic explant; c, non-transgenic explants; d, culturing the resistant callus; e, transforming the resistant callus GUS of pCAMBIA1301 for staining; f, performing fluorescence detection on the pJCV53 transferred resistant callus;
FIG. 2 induction of transgenic Tripterygium wilfordii. a, resistant callus; b, green callus and embryoid; c, adventitious buds; d, transgenic seedlings; e, transgenic aseptic seedlings; f, transgenic plants;
identification of transgenic Tripterygium wilfordii in figure 3. a, carrying out fluorescence detection on leaves of a pJCV53 tripterygium wilfordii plant; b, detecting leaf GUS of the tripterygium wilfordii transferred to pCAMBIA 1301; c, converting pJCV53 tripterygium wilfordiinptIIGenome PCR verification; d, performing PCR verification on the genome of the pCAMBIA1301 tripterygium wilfordii hpt;
FIG. 4 overexpressionTwMSGene expression of the gene tripterygium wilfordii and analysis of triptolide content. a, overexpression ofTwMSA genetic tripterygium wilfordii plant; b, in transgenic plantsTwMSAnalyzing the gene expression quantity; c, analyzing the content of triptolide in the transgenic plant.
Detailed Description
In order to better understand the essence of the invention, the technical contents of the invention will be described in detail with examples, but the invention is not limited to these examples.
pCAMBIA1301 vector: addgene company; the pCAMBIA1301 vector contained a hygromycin resistance selection marker gene and a GUS reporter gene.
Vector pENTR221: invitrogen, inc. of America.
Overexpression vector pJCV53: invitrogen corporation, USA; the pJCV53 vector contains kanamycin selectable marker gene and mRFP reporter gene.
Agrobacterium GV3101, EHA105, LBA4404, etc. are purchased from Bio-only company.
The agrobacterium-mediated genetic transformation method of tripterygium wilfordii provided by the invention comprises the following steps:
(1) Taking small blocks of the tripterygium wilfordii leaves which are trimmed to be 0.5-1 cm as explants, and placing the explants on a culture medium for dark culture;
(2) Placing the pre-cultured explant in an agrobacterium infection solution for infection to obtain an infected explant;
(3) Placing the infected explant on sterile filter paper to absorb surface bacterial liquid, and placing the infected explant on a co-culture medium for dark culture to obtain a co-culture explant;
(4) Washing the co-cultured explant with sterile water and sucking surface water with sterile filter paper, transferring to a screening culture medium for dark culture, and screening resistant callus;
(5) Transferring the resistant callus to a differentiation medium, culturing under the condition of illumination time of 16 h/d, and inducing adventitious buds to generate;
(6) Cutting off adventitious buds, transferring the adventitious buds to a rooting culture medium, inducing rooting, and culturing under the condition of illumination time of 16 h/d to obtain resistant seedlings;
(7) Cutting leaves of resistant seedlings, and carrying out transgenic identification and screening to obtain positive seedlings;
(8) And taking out the positive seedlings from the culture medium, cleaning the positive seedlings by using sterile water, and transferring the positive seedlings into nutrient soil to obtain transgenic plants.
In the method, the culture medium for the pre-culture of the explant is MS solid culture medium containing 0.2-1.0 mg/L2, 4-D+0.1-0.5 mg/L KT; the preculture time is 2-5 d.
In the above method, the Agrobacterium invasion solution is 10mM MgCl 2 +10mM 2-morpholinoethanesulfonic acid+100. Mu.M acetosyringone; agrobacterium infection solution Agrobacterium OD 600 0.4 to 1.0.
In the method, in the infection of the agrobacterium, the pre-cultured explant is soaked in the agrobacterium suspension for 5-20 min, and then vacuum infection is carried out by a vacuum pump vacuumizing mode, wherein the pressure is-0.05 to-0.09 Mpa, and the infection time is 0-5 min.
In the method, the co-culture medium is an MS solid medium containing 0.2-1.0 mg/L2, 4-D+0.1-0.5 mg/L KT+0-100 um acetyl caryophyllone; the co-culture time is 1-5 d.
In the method, the screening culture medium is MS solid culture medium plus 0.2-1.0 mg/L2, 4-D plus 0.1-0.5 mg/L KT plus 100-400 mg/L timentin plus 100 mg/L kanamycin or 25mg/L hygromycin B.
In the method, the differentiation medium is MS solid medium containing 0.5-2.0 mg/L6-benzyl aminopurine and 0.05-0.5 mg/L naphthylacetic acid.
In the method, the rooting culture medium is MS solid culture medium containing 0.5-4 mg/L IBA or NAA.
In the method, the identification method of the transgenic seedlings comprises fluorescence identification, GUS staining identification and genome PCR identification.
In the method, the culture is carried out under the mentioned illumination condition, the illumination intensity is not particularly required, and the normal sunlight condition in the daytime or the laboratory simulated sunlight condition can be obtained.
The invention also provides application of the genetic transformation method of the tripterygium wilfordii in improving the content of the tripterygium wilfordii active compound, namely the tripterygium wilfordii plant obtained by the method has obviously improved triptolide content, and can be used for extracting triptolide.
EXAMPLE 1 screening agent concentration screening
Leaf explants were first placed on callus induction medium containing a series of hygromycin B (0, 5, 10, 20, 30 and 40 mg/L) or kanamycin (25-125 mg/L), the status of the explants was observed, and the appropriate screening concentrations were determined.
As a result, as shown in Table 1, calli were normally produced after 2 weeks of leaf explants cultured in medium without hygromycin B and kanamycin. However, leaf explants are highly sensitive to hygromycin B, and even low concentrations of hygromycin B (5 mg/L) can significantly affect callus and shoot induction. With increasing hygromycin B concentration, callus induction was significantly inhibited. 25mg/L hygromycin B was observed to inhibit the formation of all calli and the explants were browned and necrotized. Kanamycin also has obvious influence on the callus induction of the leaf explants of the tripterygium wilfordii, the callus induction rate is obviously reduced along with the increase of the kanamycin concentration, 75mg/L of the explants do not generate callus, but the edge expansion is a precursor of the formation of the callus. 100 mg/L kanamycin inhibited callus production in all explants. However, unlike 25mg/L hygromycin B, 100 mg/L kanamycin treated explants only yellow and fade and do not die completely. Thus, selection of transgenic calli was performed with 25mg/L hygromycin B and 100 mg/L kanamycin, respectively.
TABLE 1 Effect of different concentrations of Kana and HygB on leaf explantation
EXAMPLE 2 Induction of resistant callus
Preparing an explant of a leaf of tripterygium wilfordii (figure 1 a), placing the leaf back of the explant on a preculture medium downwards, and preculturing for 3d; after the Agrobacterium tumefaciens EHA105 containing pJCV53 is cultivated and turbid, the Agrobacterium tumefaciens EHA105 is transferred into a 100 mL medium containing 100 mu m acetosyringone YEB in a ratio of 1:50 for expansion cultivation. When reaching OD 600 At=0.6, the mixture was centrifuged at 4500 rpm for 8 min and resuspended to OD with permeation buffer 600 =0.6. The explants were then placed in an agrobacterium suspension, vacuum treated for 3 minutes and transferred to sterile filter paper to blot surface moisture. After water was sucked dry, transferred to a callus medium containing 100 μm acetosyringone and co-cultured in the dark at 25℃for 3 days.
After co-cultivation, the infected explants were rinsed 3 times with sterile distilled water and dried with filter paper. Finally, the explants were transferred to selection medium for cultivation in the dark. The explant selection medium for pJCV53 transfer was callus medium plus 100 mg/L kanamycin and 400 mg/L timentin, and the explant selection medium for pCAMBIA1301 transfer was callus medium plus 25mg/L hygromycin B and 400 mg/L timentin. After 1 month of culture, resistant callus production was observed (FIG. 1 b), whereas non-transgenic treated explants were brown and no callus was produced (FIG. 1 c). The induced resistant calli were transferred to a new selection medium and continued to culture (FIG. 1 d). Resistant calli were identified by GUS histochemistry and mRFP fluorescence detection, respectively, and pCAMBIA1301 transgenic calli were stained blue by GUS (FIG. 1 e), while pJCV53 transgenic calli were observed to have red fluorescence by fluorescence microscopy (FIG. 1 f).
EXAMPLE 3 Induction of transgenic seedlings
Resistant calli were transferred to MS+2.0BAP+0.1NAA differentiation medium for light culture. The medium was changed every 2-3 weeks. The differentiation process encounters the change of the tissue from white (fig. 2 a) to green and forms a number of green granular processes, embryoid bodies (fig. 2 b); with continued culture, the green projections grew into distinct adventitious buds (FIG. 2 c). When adventitious buds grow to 2 cm (FIG. 2 d), the adventitious buds are transferred from the callus to MS+1m/L IBA for rooting culture, and transgenic aseptic seedlings are obtained (FIG. 2 e).
Opening the bottle mouth of the transgenic seedling after rooting, light culturing and hardening seedlings for 2-3d in a culture room, stopping hardening seedlings after colony occurrence, carefully taking out the aseptic seedlings, cleaning the roots, soaking the roots of the seedlings for 5min by using carbendazim, transplanting the seedlings into humus soil and perlite (1:1) subjected to high-temperature sterilization, covering a plastic cup for moisturizing, placing the seedlings in an illumination incubator for culturing, and removing the plastic cup after 10 d, thereby obtaining the transgenic plants (figure 2 f).
Example 4 identification of transgenic plants
Transgenic plants of the two vectors were identified by GUS histochemistry and mRFP fluorescence detection, respectively. Identification of pJCV53 transformed tissue was performed using a fluorescence stereo microscope (Nikon SMZ 25) and red fluorescence was observed in transgenic plant leaves (FIG. 3 a).
The pCAMBIA1301 transformed tissue was soaked overnight at 37℃in phosphate buffer (pH 7.0, 50 mM) containing 10mM EDTA, 2 mM X-Gluc and 0.1% Triton X-100, and non-transgenic plants were used as controls. The tissues were then decolorized with 95% ethanol and the transgenic plant leaves were blue (fig. 3 b).
The genome of the transgenic plant was extracted using the genome as a template, followed by the use of specific primers Hpt-F/R (Forward gaaaagcctgaactcaccgc and reverse tgctccatacaagccacac)) Detection ofhptInsertion of genes. Verification with specific primers Npt-F/R (Forward ttcggctgggcaca and reverse ggagcggataccgtaaag)nptIIInsertion of genes. In all mRFP-staining positive transgenic plants, a pattern of binding was observednptIIThe gene fragment corresponds to an electrophoresis band of around 689bp, whereas such an electrophoresis band was not observed in non-transgenic plants (FIG. 3 c). Also, in all transgenic plants positive for GUS staining,hptthe 729bp fragment of (A) was amplified but not in non-transgenic plants (FIG. 3 d). The results show that the exogenous gene has been stably integrated into the genome of Tripterygium wilfordii. In conclusion, the transformation system is stable and has good repeatability.
Example 5 overexpressionTwMSDetection of triptolide content in transgenic tripterygium wilfordii
Genetic transformation of tripterygium wilfordii mediated by agrobacterium to obtainTwMS(Genbank: ANO 43011.1) over-expressed transgenic Tripterygium wilfordii (FIG. 4 a), extracting its total RNA, reverse transcription into cDNA, gene expression analysis using primers TmMS-qF (GCCAAGAGTGGAAGCAAGGAAT) and TmMS-qR (GGGCTTGAAAG TAATCCCTGTCGT), and using primers Efα1-qF (CCAAGGGTGAAAGCAAGGAGAGC) and Efα1-qR (CACTGGTGGTT TTGAGGCTGGTATCT) as internal references.
Results As shown in FIG. 4b, in transgenic plants,TwMSthe relative expression level of (2) was significantly increased, 4-13 times that of the control, respectively. The results indicate that the genetic transformation mediated by agrobacterium is over-expressedTwMSThe gene can obviously improve the expression level of the gene in transgenic plants.
Further analysis of its triptolide content, the triptolide content of the over-expressed plants can reach 50.50-63.65 μg/g DW, which is 1.20-1.51 times that of the control (FIG. 4 c). The results indicate that the genetic transformation mediated by agrobacterium is over-expressedTwMSThe gene can obviously improve the triptolide content in the transgenic plant.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Claims (1)
1. An agrobacterium-mediated genetic transformation method of tripterygium wilfordii, which is characterized by comprising the following steps:
(1) Taking tripterygium wilfordii leaves as explants, and placing the tripterygium wilfordii leaves in agrobacterium infection solution for infection to obtain the infected explants;
(2) Placing the infected explant on a co-culture medium for dark culture to obtain a co-culture explant; co-culturing the explant in a screening culture medium for dark culture, and screening the resistant callus;
(3) Transferring the resistant callus to a differentiation medium, culturing under illumination, and inducing adventitious bud generation; inducing adventitious buds into rooting culture medium to root, and culturing under light to obtain resistant seedlings; taking leaves of resistant seedlings, and carrying out transgenic identification and screening to obtain positive seedlings; transferring the positive seedlings into nutrient soil to obtain transgenic plants;
the agrobacterium infection liquid contains 10mM MgCl 2 10mM 2-morpholinoethanesulfonic acid and 100. Mu.M acetosyringone; the agrobacterium OD in the agrobacterium infection liquid 600 0.4 to 1.0;
the method is characterized in that the method is placed in an agrobacterium infection solution for infection and comprises the following steps: soaking the explant in an agrobacterium infection solution for 5-20 min, and then carrying out vacuum infection, wherein the vacuum infection pressure is-0.05 to-0.09 Mpa, and the infection time is 3-5 min;
the co-culture medium is an MS solid medium containing 0.2-1.0 mg/L of 2,4-D, 0.1-0.5 mg/L of KT and 0-100 mu M of acetyl caryophyllone; the culture time of the co-culture is 1-5 d;
the screening culture medium is an MS solid culture medium containing 0.2-1.0 mg/L2, 4-D, 0.1-0.5 mg/L KT, 100-400 mg/L timentin and 100 mg/L kanamycin; or kanamycin is replaced by 25mg/L hygromycin B;
the differentiation culture medium is an MS solid culture medium containing 0.5-2.0 mg/L6-benzyl aminopurine and 0.05-0.5 mg/L naphthylacetic acid;
the rooting culture medium is an MS solid culture medium containing 0.5-4 mg/L IBA or NAA; pre-culturing the tripterygium wilfordii leaves in the step (1), wherein the pre-culturing condition is darkness;
the culture medium for the preculture of the tripterygium wilfordii leaves is an MS solid culture medium containing 0.2-1.0 mg/L2, 4-D and 0.1-0.5 mg/L KT; the culture time of the preculture is 2-5 d.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210955250.5A CN115354047B (en) | 2022-08-10 | 2022-08-10 | Agrobacterium-mediated tripterygium genetic transformation method and method for obtaining A |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210955250.5A CN115354047B (en) | 2022-08-10 | 2022-08-10 | Agrobacterium-mediated tripterygium genetic transformation method and method for obtaining A |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115354047A CN115354047A (en) | 2022-11-18 |
| CN115354047B true CN115354047B (en) | 2023-05-26 |
Family
ID=84033316
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210955250.5A Active CN115354047B (en) | 2022-08-10 | 2022-08-10 | Agrobacterium-mediated tripterygium genetic transformation method and method for obtaining A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115354047B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110577966A (en) * | 2019-10-24 | 2019-12-17 | 江苏省中国科学院植物研究所 | Agrobacterium-mediated genetic transformation method for zoysia matrella |
| CN113215191A (en) * | 2021-04-26 | 2021-08-06 | 华南农业大学 | Agrobacterium-mediated genetic transformation method for toona sinensis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6646185B2 (en) * | 2001-11-15 | 2003-11-11 | Korea Kumho Petrochemical Co., Ltd. | Genetic transformation method for zoysiagrass |
-
2022
- 2022-08-10 CN CN202210955250.5A patent/CN115354047B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110577966A (en) * | 2019-10-24 | 2019-12-17 | 江苏省中国科学院植物研究所 | Agrobacterium-mediated genetic transformation method for zoysia matrella |
| CN113215191A (en) * | 2021-04-26 | 2021-08-06 | 华南农业大学 | Agrobacterium-mediated genetic transformation method for toona sinensis |
Non-Patent Citations (3)
| Title |
|---|
| "基于气生根的雷公藤植株的快速繁殖技术";姜良珍 等;《北方园艺》(第15期);第119-125页 * |
| "过表达TwHMGR和TwDXR基因对雷公藤萜类次生代谢产物的影响";《农业生物技术学报》;第26卷(第6期);第940-948页 * |
| Bin Zhang et al.."Agrobacterium tumefaciens mediated genetic transformation of Tripterygium wilfordii and its application to enhance the accumulation of triptolide".《Industrial Crops & Products》.2022,第187卷第1-9页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115354047A (en) | 2022-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2001279510B2 (en) | Method for genetic transformation of woody trees | |
| AU2001279510A1 (en) | Method for genetic transformation of woody trees | |
| CN102154364A (en) | Method for agrobacterium tumefaciens-mediated genetic transformation of sugarcane | |
| CN103966258A (en) | Agrobacterium tumefaciens mediated cabbage type oilseed rape genetic transformation method | |
| CN105543278A (en) | Dangshan pear genetic transformation method | |
| CN110172476B (en) | Method for establishing genetic transformation and regeneration system of Rhododendron delavayi Franch | |
| CN113265421B (en) | Method for establishing agrobacterium-mediated shortstem ephedra stem callus transgenic system | |
| CN110577966A (en) | Agrobacterium-mediated genetic transformation method for zoysia matrella | |
| CN104004783A (en) | Method for improving cotton transgenosis efficiency | |
| CN107475287B (en) | Eggplant genetic transformation method | |
| CN117070557A (en) | Rapid and efficient agrobacterium-mediated iris seed genetic transformation method | |
| CN116103337B (en) | Agrobacterium-mediated passion flower genetic transformation method | |
| CN108546710A (en) | A kind of castor-oil plant genetic transforming method | |
| CN105063086A (en) | Molecular breeding method fast obtaining large number of transgenosis sedum lineare new species | |
| CN115354047B (en) | Agrobacterium-mediated tripterygium genetic transformation method and method for obtaining A | |
| CN110305894A (en) | A kind of Chinese catalpa genetic transforming method rapidly and efficiently | |
| CN114606257B (en) | Genetic transformation method for pomegranate agrobacterium | |
| CN110592100A (en) | Cassava CAMTA gene and construction and disease-resistant application of suppression expression vector thereof | |
| CN113652446B (en) | Agrobacterium rhizogenes mediated one-step transformation method for hairy roots of Caragana carryover | |
| KR20100053456A (en) | A method for producing transformed rice plant removed selection marker | |
| CN115094086A (en) | Improved method for transforming descurainia sophia by flower soaking method | |
| CN109385446B (en) | High-efficiency agrobacterium-mediated soybean root hair transformation method | |
| CN104630261A (en) | Method for improving genetic transformation transient expression efficiency of neolamarckia cadamba | |
| CN117187294B (en) | Application of BnaC5.ACBP4 gene in improving flooding resistance of plants | |
| CN111937749B (en) | High-efficiency induction and culture method of uncaria hairy roots |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |