CN115282260A - Application of KGF-2 in preparing medicine for treating skin dysfunction - Google Patents

Abstract

The invention discloses an application of KGF-2 in preparing a medicine for treating skin dysfunction. Belongs to the technical field of medicine. The invention discloses an application of KGF-2 in preparing a medicine for treating skin dysfunction, wherein scar tissues are characterized by compact collagen fibers, vigorous extracellular matrix secretion and low KGF-2 expression. KGF-2 can significantly inhibit mechanical stress-induced scar formation in mice, and reduce the expression of extracellular matrix of primary fibroblasts. Whereas STAP2 plays a key role in the process of scar formation. KGF-2 regulates the expression of STAP2 through P38, and further regulates the level of P-STAT3, thereby influencing the expression of downstream fibrosis-related proteins and reducing the formation of scars. KGF-2 holds promise as an effective agent for the prevention of scarring.

Description

Application of KGF-2 in preparing medicine for treating skin dysfunction

Technical Field

The invention relates to the technical field of medicines, in particular to an application of KGF-2 in preparing a medicine for treating skin dysfunction.

Background

Hypertrophic Scar (HS) is a condition of excessive skin fibrosis, a common complication of wounds such as burns, skin wounds or surgery. The substance of hypertrophic scars is the hyperproliferation and sustained activation of fibroblasts, which in turn synthesize a large amount of extracellular matrix (ECM), resulting in a large deposition of collagen fibers that in turn affects the normal physiological function of the skin.

Although interventions such as skin grafting, pressure therapy, steroids, lasers and silicone dressings have achieved some inhibition of scarring, surgical resection has to date been the only effective method of hypertrophic scarring treatment. Therefore, there is an urgent need to develop a medicine for preventing and treating scars, which can reduce or avoid scars caused by injury and skin dysfunction caused by the scars.

Therefore, how to provide a medicament for treating skin fibrosis and scar is a problem to be solved urgently by the technical personnel in the field.

Disclosure of Invention

In view of the above, the present invention provides an application of KGF-2 in preparing a medicament for treating skin dysfunction. Keratinocyte growth factor-2 (KGF-2) is a growth factor that has important regulatory effects on wound healing. The invention explores the role of KGF-2 in-vivo and in-vitro scar formation through clinical samples, animal models and cell models, discusses the molecular mechanism of KGF-2 for down-regulating scar formation, and provides a basis for KGF-2 in hypertrophic scar treatment.

In order to achieve the purpose, the invention adopts the following technical scheme:

an application of KGF-2 in preparing the medicines for treating skin dysfunction.

Preferably, the following components: skin dysfunction is skin fibrosis and hypertrophic scarring.

Preferably, the following components: the drug down-regulates expression of STAT2, reduces phosphorylation level of STAT3, and thereby affects expression of downstream fibrosis-associated proteins.

Preferably, the following components: the proteins include COL I, COL III and alpha-SMA.

Preferably, the following components: KGF-2 down-regulates the expression of collagen in mouse skin tissue.

Preferably: KGF-2 inhibits mechanical stress induced scar formation in mice.

Preferably, the following components: KGF-2 reduces the expression of extracellular matrix of primary fibroblasts.

The invention also provides a medicament for inhibiting scars, which is characterized by comprising KGF-2, wherein the dosage of the KGF-2 is 250-500 mu g/kg.

Furthermore, the invention specifically uses HE and Masson staining to observe the structure of a clinical scar tissue hyperplastic area, detects the expression of extracellular matrix, alpha-SMA, collagen I and collagen III through WB, and simultaneously detects the mRNA level of alpha-SMA, collagen I and collagen III through RT-PCR, thereby comprehensively analyzing the clinical scar tissue in terms of histopathology and molecular, and determining the pathological characteristics of the scar tissue. Meanwhile, expression changes of common growth factors in scar tissues are detected through WB and RT-qPCR. Establishing a scar mouse model induced by mechanical stress and extracted primary fibroblasts, and verifying the influence of KGF-2 on ECM expression and scar formation in vitro and in vivo by methods such as HE and Masson dyeing, WB, RT-PCR, immunohistochemistry, immunofluorescence and the like. And further, a key protein regulated by KGF-2 is analyzed and found by using a proteomic method, the key protein is inhibited or overexpressed, the influence of the protein on the phosphorylation of downstream STAT3 and the expression of scar-related protein is researched, and the effect of the protein on the regulation of scars by KGF-2 is discussed. Finally, through MAPK pathway inhibitor, the regulation pathway on which KGF-2 depends is researched.

The beneficial effects are that: clinical scar skin tissues have compact collagen fibers, high-expression collagen and high expression of extracellular matrix synthesis related proteins. In addition, the mRNA and protein levels of KGF-2 are down-regulated in scar tissue and the p-STAT3 protein levels are up-regulated in scar tissue. Animal experiment results show that KGF-2 can reduce mechanical stress-induced scarring and reduce areas of hypertrophic scarring. And KGF-2 is capable of down-regulating the expression of extracellular matrix and phosphorylated STAT3 in animal skin tissues. The research on the extracted primary cells shows that KGF-2 not only can reduce the expression of collagen I, collagen III and alpha-SMA of primary hypertrophic scar fibroblasts, but also can reduce the expression of phosphorylated STAT3. The results indicate that STAP2 is a key protein influencing KGF-2 to regulate scar formation by performing proteomic analysis on animal tissues. STAP2 and phosphorylated STAT3 were expressed up-regulated in skin tissues and extracted primary fibroblasts of the mechanical stress-induced scar mouse model to validate this result. Further verification experiments show that the expression of STAP2 is inhibited, and the expression of collagen I, collagen III, alpha-SMA and p-STAT3 of primary fibroblasts can be reduced. Overexpression of STAP2 results in increased expression of p-STAT3 and accumulation of ECM. Through inhibiting the P38 channel, the KGF-2 can not regulate the expression of collagen I, collagen III and alpha-SMA, so that the KGF-2 can regulate the expression of STAP2 through P38 and further regulate the level of P-STAT3, the expression of downstream fibrosis related protein is influenced, and the formation of scars is reduced.

According to the technical scheme, compared with the prior art, the invention discloses and provides the application of KGF-2 in preparing the medicine for treating the skin dysfunction, and compared with the prior art, the invention shows that scar tissues are characterized by compact collagen fibers, vigorous extracellular matrix secretion and low KGF-2 expression. KGF-2 can significantly inhibit mechanical stress-induced scar formation in mice, and reduce the expression of extracellular matrix of primary fibroblasts. Whereas STAP2 plays a key role in the process of scar formation. KGF-2 regulates the expression of STAP2 through P38, and further regulates the level of P-STAT3, thereby influencing the expression of downstream fibrosis-related proteins and reducing the formation of scars. Therefore, STAP2 is hopeful to become a new target for scar prevention and treatment, and KGF-2 is hopeful to become an effective medicament for preventing scar formation.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a graph of immunofluorescence analysis of p-STAT3 expression in clinical skin samples in accordance with the present invention, wherein red: vimentin, green: p-STAT3.

Fig. 2 is a graph of immunofluorescence analysis of STAT3 expression in clinical skin samples provided in the present invention, wherein red: vimentin, green: STAT3.

FIG. 3 is a graph showing the statistical analysis of p-STAT3 in IF according to the present invention.

FIG. 4 is a graph showing the IF statistical analysis of STAT3 according to the present invention.

FIG. 5 is a process diagram of a mouse model of mechanical stress-induced scarring provided by the present invention.

FIG. 6 is a graph showing the appearance of scars on the skin of a mouse before the final sampling of the drug according to the present invention.

FIG. 7 is a graph showing the HE and Masson staining patterns provided by the present invention.

FIG. 8 is a graph of statistical analysis of hypertrophic scar zone of mouse skin according to the present invention.

FIG. 9 is a diagram showing the statistical analysis of p-STAT3 in Western immunoblots according to the present invention.

FIG. 10 is a graph showing the statistical analysis of the type I collagen provided by the present invention in Western immunoblots.

FIG. 11 is a graph showing the statistical analysis of the Western immunoblots of type III collagen produced by the present invention.

FIG. 12 is a graph showing the statistical analysis of α -SMA provided by the present invention in Western immunoblotting.

FIG. 13 is a graph of immunofluorescence analysis of α -SMA and vimentin expression in mouse skin provided by the invention, wherein the red: vimentin, green: alpha-SMA.

FIG. 14 is a graph showing immunofluorescence analysis of p-STAT3 and vimentin expression in mouse skin, wherein the color red: vimentin, green: p-STAT3.

FIG. 15 is the immunofluorescence assay of human primary hypertrophic scar fibroblasts provided by the invention.

FIG. 16 is a graph showing the statistical analysis of the Western immunoblot analysis of α -SMA provided by the present invention.

FIG. 17 is a diagram showing the statistical analysis of p-STAT3 in Western immunoblot analysis.

FIG. 18 is a chart showing the statistical analysis of the Western immunoblot analysis of type I collagen provided by the present invention.

FIG. 19 is a chart showing the statistical analysis of the Western immunoblot analysis of type III collagen provided by the present invention.

FIG. 20 is a diagram showing a cell-component analysis of a differential protein according to the present invention.

FIG. 21 is a drawing showing an analysis of the classes of extracellular matrix-related cell components according to the present invention.

FIG. 22 is a diagram of co-immunoprecipitation of STAT3 and STAP2 provided by the invention.

FIG. 23 is a graph of immunofluorescence analysis of STAT2 and p-STAT3 expression in clinical skin samples provided in accordance with the present invention, wherein the red: STAP2, green: p-STAT3.

FIG. 24 is a graph showing the statistical analysis of STAP2 in clinical skin samples IF according to the present invention.

FIG. 25 is a graph showing the statistical analysis of p-STAT3 in clinical skin samples IF, according to the present invention.

FIG. 26 is a graph showing the experimental results of STAP2 in western blot in mouse skin tissues and primary fibroblasts provided by the present invention.

FIG. 27 is a statistical analysis of STAP2 in Western immunoblot analysis of clinical samples provided by the present invention.

FIG. 28 is a figure showing the statistical analysis of STAP2 in mouse skin tissue Western immunoblot analysis.

FIG. 29 accompanying drawing is a statistical analysis diagram of STAP2 in primary fibroblast Western immunoblot analysis provided by the present invention.

FIG. 30 is a Western immunoblot analysis of KGF-2 provided herein in a cell line overexpressing STAP2.

FIG. 31 figure is a statistical analysis of STAP2 in Western immunoblot analysis provided by the present invention.

FIG. 32 is a graph of the statistical analysis of mRNA levels for α -SMA provided by the present invention.

FIG. 33 is a graph showing the statistical analysis of type I collagen mRNA levels provided by the present invention.

FIG. 34 is a graph showing the statistical analysis of type III collagen mRNA levels provided by the present invention.

FIG. 35 is a graph of immunofluorescence analysis of STAT2 and p-STAT3 in an overexpressing STAP2 cell line provided by the present invention, wherein the red: STAP2, green: p-STAT3.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention discloses an application of KGF-2 in preparing a medicament for treating skin dysfunction.

The necessary instruments, equipment, and experimental materials in the examples are commercially available, for example: CCC-HSF-1 was purchased from Shanghai Bailey Biotechnology Ltd, DMEM high-sugar liquid medium, DMEM-F12 liquid medium was purchased from Gibco; solution of penicillin-streptomycin (double antibody) was purchased from Hyclone; KGF-2 lyophilized powder and FGF-21 lyophilized powder are purchased from key laboratories of pharmaceutical engineering in Zhejiang biotechnology; MTT was purchased from Sigma; anti-fluorescence quenching PVP mounting fluid, RIPA lysate (strong), protease inhibitor (PMSF) and Westernblot hypersensitive chemiluminescent substrate were purchased from Biyun Biotech company; DMSO was purchased from Amresco corporation; sirnas were purchased from gimara biotechnology limited; lipo3000 was purchased from Sigma; the total RNA extraction kit and the reverse transcription kit are purchased from Beijing Solaibao science and technology Limited; overexpressed lentiviruses were purchased from and Biotech, inc.; qPCR SYBR Green MasterMix was purchased from Shanghai assist, biotech Ltd; STAT3 Rabbit Polyclonal antibody was purchased from proteintech; STAP-2Goat Polyclonal antibody available from Abcam; P-STAT3 Rabbit Polyclonal antibody was purchased from SAB (signalling Ant)ibody) corporation; alpha-SMA Rabbitpolyclonal antibody, vitamin Mouse Monoclonal antibody, COL I Rabbitpolyclonal antibody, COL III Rabbitpolyclonal antibody MMP-9 Rabbitpolyclonal antibody available from proteintech; KGF-2Rabbit Polyclonal Antibody, P-ERK1/2Polyclonal Antibody, FGF 2Rabbit Polyclonal Antibody, P38 Rabbit Polyclonal Antibody, and P-P38 Rabbit Polyclonal Antibody are available from SAB (signal Antibody); FGF1 Rabbit Polyclonal antibody was purchased from SANTA CRUZ; AKT Mouse Monoclonal antibody, p-AKT Mouse Monoclonal antibody, GAPDH antibody, goat anti-rabbit IgG-HRP, donkey anti-goat IgG-HRP from proteintech; donkey anti-rabbit IgG H&L(Alexa

488 Etc.), donkey anti-mouse IgG H&L(Alexa

555 Etc.), donkey anti-sheep IgG H&L(Alexa

647 Purchased from Abcam corporation; PPIC protein phosphatase inhibitors and PIC protease inhibitors were purchased from Beijing Quanjin Biotechnology Ltd.

Electrophoresis buffer solution

18.90g of glycine, 3.02g of Tris-Base and 1g of SDS powder are weighed and dissolved in double distilled water, the volume is adjusted to 1000mL, and electrophoresis buffer solution with the volume of 1x is prepared and is kept stand and stored for standby at room temperature.

Electrotransfer buffer solution: 14.42g of glycine and 3.02g of Tris-Base powder are weighed and dissolved in double distilled water, the volume is adjusted to 800mL, 200mL of methanol solution is finally added, the pH is adjusted to 8.2-8.3, a1 Xelectrotransfer buffer solution is prepared, and the mixture is kept stand at room temperature for later use.

TBS solution: 40g NaCl,1g KCl and 15g Tris-Base powder were weighed and dissolved in double distilled water to a volume of 500mL, concentrated HCl was added to adjust the pH to 7.5, and 10 XTBS buffer was prepared and stored at room temperature for further use.

TBST solution: measuring 50mL of 10 × TBS buffer solution, adding 0.1% Tween-20, diluting to 500mL with double distilled water, and storing at room temperature.

Confining liquid (5% skimmed milk powder): 1.5g of skimmed milk powder was dissolved in 30mL of 1 XTBST buffer and ready to use.

10% AP solution: 0.1g of AP is weighed and dissolved in 1mL of double distilled water, and the solution is stored for standby in a refrigerator at 4 ℃ and needs to be used within two weeks.

10% SDS solution: weighing 1g of SDS powder, dissolving in 10mL of double distilled water, uniformly mixing by a shaking table at room temperature, and standing for later use.

KGF-2: KGF-2 powder was stored in a 4 ℃ freezer, dissolved in a cell culture medium and dispensed into 1.5mL EP tubes during use, KGF-2 diluent was stored in a-20 ℃ freezer and thawed at room temperature until next use.

Cell culture medium

(1) DEME cell complete medium: DMEM high-sugar medium, 10% fetal bovine serum and 1X penicillin-streptomycin antibiotic concentrated solution.

(2) DEME cell starvation medium: DMEM high-glucose medium +0.5% fetal bovine serum +1X penicillin-streptomycin antibiotic concentrate.

(3) DEME cell starved heparin medium: DMEM high-glucose medium +0.5% fetal bovine serum +1X penicillin-streptomycin antibiotic concentrate + 100. Mu.g/ml heparin sodium.

Statistical analysis: data processing and statistical analysis were performed using Graphpad prism6.0 software. Group comparisons were followed by normal and homogeneity of variance tests using one-way ANOVA. P <0.05 indicates that the difference is statistically significant. All experiments were repeated 3 or more times.

Sample(s)

Human scar skin fibroblasts and human normal skin fibroblasts were isolated from scar skin biopsies and normal skin biopsies of 6 patients who satisfied hypertrophic scars. Human studies were approved by the ethical committee of the medical institute of the university of wenzhou medical science. All patients and controls signed up consent approved by the local institutional review board.

Tissue embedding referred to in the examples: a paraffin embedding pretreatment process and a stone freezing embedding pretreatment process; HE and Masson staining experiments; immunoblotting; protein denaturation; SDS-PAGE electrophoresis; IHC and IF staining experiment, cell culture, cell recovery, cell passage, cell cryopreservation and cell counting are all conventional experimental modes, and are not described in detail herein.

Real-time quantitative PCR

Total cellular RNA extracted with total RNA extraction kit (solibao) and reverse transcribed using iScript cDNA kit (Bio Rad). The cDNA product was amplified in a 10. Mu.l reaction containing 5. Mu.l of the QSYBR Green SuperMix (Bio Rad) and 200nM primers as described previously (Ray et al, 2010). To normalize template input, GAPDH transcript levels were measured for each sample. Data are expressed as fold changes normalized to GAPDH.

The primers used for RT-PCR were as follows:

col1a1, sense Primer (SP): 5 'GAGGCCAAGACGAAGACATC-3' and antisense primer (AS): 5 'CAGATCACGTCATCGCACAAC-3';

col1A2, SP: 5-: 5 'CTTCCAATAGGACCAGTAGGAC-3';

col3a1, SP:5 'GGAGCTGGCTACTTCGC-3' and AS:5 'GGGAACATCCTCCTCCTTCAACAG-3';

α -SMA, SP: 5: 5 'GCTGGGACATTGAAAGTCTCTCTCA-3';

KGF-2, SP:5 'CAGTAGAAATCGGAGTTGTTGCC-3' and AS:5 'TGAGCCCATAGAGTTCCCCCTTC-3';

aFGF, SP:5 'TTCACACAGACCTGACCGAGAGAA 3' and AS:5 'CGTTGCTACAGAGAGGAGTGTTG-3';

bFGF, SP:5 'AGAAGAGCGACCCTCACATCA-3' and AS:5 'CGGTTAGCACACACACTTCTTG-doped 3';

STAP-2, SP:5 'GACCTTGGGAGTGTGTCGGAAAT-3' and AS:5 'GAAGCAGGGTCAAGTCGGT-3';

GAPDH, SP:5 'GGAGCGAGATCCTCCAAAT-3' and AS:

5'-GGCTGTTGTCATACTTCTCATGG-3'。

example 1

Hypertrophic scar tissue was found by HE and Masson staining to be dense in collagen fibers with small gaps between the collagens.

WesternBlot and RT-PCR experimental results show that alpha-SMA, collagen I and collagen III are highly expressed in hypertrophic scar tissues, and MMP-9 protein expression for promoting collagen degradation is reduced. In addition, through checking the expression of aFGF, bFGF and KGF-2 in the hyperplastic scar tissues, the mRNA and protein expression of KGF-2 in the hyperplastic scar patient tissues are obviously reduced, and the expression of aFGF and bFGF is not obviously changed.

The fibroblast and p-STAT3 immunofluorescence co-localization test reveals that the hyperplastic scar fibroblast has high expression of p-STAT3 (see figures 1, 2, 3 and 4).

And (4) conclusion: scar tissue has excessive deposition of extracellular matrix and upregulated STAT3 phosphorylation expression. Growth factor assays revealed that a deficiency in KGF-2 may be associated with scar formation.

Remarking: as compared to normal skin groups,. P.ltoreq.0.001,. P.ltoreq.0.01,. P.ltoreq.0.05, n =6.

Example 2

Construction of mechanical stress induced scar model

24B 57CL/6 mice, 4-6 weeks old, clean grade (purchased from GmbH laboratory animals, inc., weitongli, beijing). The animal is raised in secondary animal experiment center of pilot base of Wenzhou medical university in cages. The breeding environment is about 23 + -2 deg.C at room temperature, relative humidity is about 60 + -5%, illumination is performed for 12h alternately day and night, and solid particle mouse is fed with the feed and freely drunk with water. And (4) constructing a scar model after the experimental animal is purchased and bred for 1 week.

After mice were anesthetized with 4% chloral hydrate by intraperitoneal injection, the central dorsal hairs were shaved off, and after topical sterilization with 75% alcohol, scar models were prepared. A1.5 cm full-thickness skin incision was made on the back of the mouse and sutured, after healing, a tensioning device was loaded on both ends of the wound, and the tension was adjusted for 3 days for one month.

The medicine is taken once every 3 days, and the treatment time is one month.

The grouping is as follows:

control group: cutting a wound, injecting normal saline without loading a tension device, wherein the volume V =0.1ml;

model group: cutting a wound, loading a tension device, and injecting normal saline with the volume V =0.1ml;

low dose treatment group: cutting a wound, loading a tension device, and injecting 25 mu g/ml KGF-2;

high dose treatment group: the wound was cut, loaded with a tensioning device and 50. Mu.g/ml KGF-2 was injected.

By making a mechanical stress induced hypertrophic scar model in mice, after the cut scar healed, a pull-up device was loaded and the pull force was adjusted every three days while injecting KGF-2 subcutaneously (FIG. 5).

At the end of administration, scar imprints in suture areas are observed, as shown in fig. 6, compared with cutting injury mice without mechanical stress, the scars of the model group are obvious, and after KGF-2 treatment, the scars are obviously reduced and have a dose-effect relationship.

From the HE and Masson staining, we can observe a significant reduction in scar area for the 500. Mu.g/kg KGF-2 dosed group, with scar area being only 30% of the model group (FIGS. 7, 8).

The results of the WesternBlot experiment show that KGF-2 not only significantly reduces the expression of alpha-SMA, type I collagen, type III collagen and the like, but also reduces the expression of p-STAT3 in scar tissue (FIGS. 9-12). However, KGF-2 did not alter STAT3 expression in skin tissues, only affecting STAT3 phosphorylation levels. Immunohistochemical staining of type I collagen also showed that KGF-2 down-regulated the amount of collagen expressed in the skin tissues of mice in a dose-dependent manner. Downregulation of α -SMA and p-STAT3 was also observed in mouse skin tissue immunofluorescent staining experiments (FIGS. 13-14).

The above results show that KGF-2 inhibits the formation of mechanical stress-induced scarring to a certain extent.

Remarking: compared with the normal group, the # p is less than or equal to 0.001, and the # p is less than or equal to 0.05; compared with the model group, p is less than or equal to 0.001, p is less than or equal to 0.01, p is less than or equal to 0.05, n is less than or equal to 6.

Example 3

Cells were digested, centrifuged, transferred to a clean bench and the supernatant discarded. Add 3mL complete medium, gently blow and resuspend and mix well. Covering the prepared cell counting plate with a cover glass, sucking a certain amount of cell suspension, and dripping into the gapAnd avoiding the generation of bubbles. The cell counting plate is placed on an inverted microscope, and the total number of cells in the four lattices is recorded according to the counting principle of not counting down and not counting up. The formula: cell number per ml = (sum of four large cell number/4) × 10 ⁴ And (4) respectively.

MTT: to examine the effect of KGF-2 on cells, extracted primary cells were plated in 96-well plates with 5000 cells per well, cultured for 24h and replaced with starvation medium overnight, and KGF-2 was applied to the cells the following day by dilution with a three-fold concentration gradient, starting at a concentration of 300. Mu.g/ml. After 24h of action 20ul of MTT was added to each well, after 4h the culture medium was aspirated, 120ul of DMSO was added to each well, shaking was performed on a shaker for 5-10 min, and the absorbance was measured on a microplate reader at 490nm (Abs 490). Data were statistically analyzed and graphed using GraphpadPrism 6.0.

To further demonstrate the modulation of extracellular matrix expression by KGF-2, primary scar fibroblasts (HSF) were extracted from clinical tissues and stimulated with a concentration of KGF-2.

The results show that:

primary cell immunofluorescence differential experiments showed that scar fibroblast cells (HSF) have highly expressed α -SMA (fig. 15). The results of clinical specimens and animal experiments were also confirmed in the following immunofluorescence and Western Blot experiments: KGF-2 downregulated the expression of α -SMA, collagen I, collagen III, and p-STAT3 in scar fibroblast (HSF) in a dose-dependent manner (FIGS. 16-19).

Example 4

KGF-2 treated scar mice, the normal group, model group and KGF-2 treated mice were sampled at the end of the experiment. Taking a proper amount of tissue sample, and fully grinding the tissue sample in liquid nitrogen. 4 volumes of lysis buffer were added and treated 3 times using a high intensity sonicator (Scientz). Centrifugation at 12000g for 10min at 4 ℃ removed cell debris, collected supernatant and assayed for protein concentration using BCA kit (Biyuntian Biotech Co., ltd.) according to the manufacturer's instructions.

Dithiothreitol was added to the protein solution to give a final concentration of 5mM, and the solution was reduced at 56 ℃ for 30min. After that, iodoacetamide was added to give a final concentration of 11mM, and incubated for 15min at room temperature in the absence of light. Finally the urea concentration of the sample was diluted to below 2M. Pancreatin was added in a mass ratio of 1. And adding pancreatin according to the mass ratio of 1. The tryptic peptide fragments were desalted using StrataX C18 (Phenomenex) and vacuum freeze-dried. Thawing the labeled reagent, dissolving the reagent in acetonitrile, mixing the reagent with the peptide fragment, incubating the mixture at room temperature for 2 hours, mixing the labeled peptide fragment, desalting, and freeze-drying in vacuum. The protein is labeled by TMT and then detected by liquid chromatography-mass spectrometry, the obtained data is analyzed for differential protein by bioinformatics software (InterProScan, KEGG Mapper, wolfpsort, CELLO, perl module, blast), and the differential protein is subjected to clustering analysis to form a transcriptome network of the KGF-2 regulatory gene.

The results showed that proteomics analysis was performed on mouse skin tissues, and the mouse skin protein expression profile was significantly changed before and after the KGF-2 administration treatment (fig. 20).

The class analysis of the cellular components showed that the extracellular matrix-related proteins such as fibrinogen complex in the model group were higher than those in the control group and the administered group (FIG. 21). Networks with STAP2 as the center for fibrosis and scarring were constructed by comparing the expression of the inverse proteins in the administered groups and by bioinformatics analysis (Perl module) around the transcriptome network of the KGF-2 regulatory genes. Further, co-immunoprecipitation demonstrated that there was a protein-protein interaction between STAP2 and STAT3, i.e., KGF-2 regulated STAT3 phosphorylation by down-regulating STAP-2 expression, thereby inhibiting the formation of skin scarring (fig. 22).

Example 5

Transfection of siRNA

STAP2 siRNA (germa) was changed at 40% confluence in NF and HSF following the manufacturer's instructions 5 hours after transfection in serum-free and double-antibody-free medium, cells were harvested 24h and used for protein or total RNA extraction.

STAP2 and p-STAT3 accumulation in fibrotic skin

To confirm that STAP2 is an important target for scar regulation, expression of STAP2 in Normal Skin (Normal Skin), hypertrophic scar (HS Skin) tissue, scar mouse Skin tissue and primary scar fibroblasts was comparatively analyzed.

Immunofluorescence data showed a significant increase in phosphorylation levels of STAP2 protein and STAT3 in HS patient skin compared to control (figures 23-25).

Scar mouse model STAP2 protein levels were 6-fold higher than normal mice. STAP2 and p-STAT3 expression was down-regulated and normalized in scar mouse tissue following KGF-2 administration. In primary scar fibroblasts, STAP2 protein levels were 1.6 times higher than normal skin. Notably, KGF-2 down-regulated STAP2 and p-STAT3 expression in a dose-dependent manner.

The above results were also confirmed in western blot experiments (FIGS. 26 to 29). The above results confirm the presence of highly expressed phosphorylation of the STAP2 and STAT3 proteins in scar tissue.

Remarking: compared with the normal group, the # p is less than or equal to 0.001, and the # p is less than or equal to 0.01; compared with the model group, p is less than or equal to 0.001, p is less than or equal to 0.01, p is less than or equal to 0.05, and n is less than or equal to 6.

An RNA interference technology is utilized to construct a STAP2 knockdown cell model. Western-blot and Q-RT-PCR results show that STAP2 expression is remarkably reduced after the STAP2 interference vector is transfected.

Compared with the control, the STAT2 deficiency reduces the phosphorylation of STAT3 and the accumulation of extracellular matrixes such as type I collagen, type III collagen and alpha-SMA. The above results demonstrate that STAP2 is a key target for fibrosis and scarring.

Remarking: NC: negative Control; KD: positive STAP2-siRNA; as compared to the control group,. P.ltoreq.0.001,. P.ltoreq.0.01,. P.ltoreq.0.05, n =6.

Example 6

Use of overexpressed lentiviruses

The over-expressed lentiviruses are constructed and identified from elements and organisms. Transfection efficiency was determined under an inverted microscope at NF 60% confluence, following the manufacturer's instructions, by changing the medium 5 hours after transfection in serum-free and double-antibody-free medium. Cells were harvested 24h after dosing and used for protein or total RNA extraction.

KGF-2 regulates scarring through the interaction of STAT2 and STAT3 (STAT 2-induced STAT3 phosphorylation)

Construction of STAP2 overexpressing CCC-HSF-1 cell line. Western blot analysis showed that STAP2 was expressed in 2-fold higher levels in the STAP 2-overexpressing cell line (FIGS. 30 and 31). The data indicate that STAP2 overexpression significantly increases the expression level of p-STAT3 and that extracellular matrix levels are significantly increased.

Real-time quantitative PCR analysis showed that mRNA of ECM genes such as alpha-SMA, type I collagen, type III collagen, etc. were significantly up-regulated in the over-expressed cell lines (FIGS. 32 to 34).

Immunofluorescence results showed that p-STAT3 expression was significantly increased in STAP2 overexpressing cell lines (fig. 35).

The results show that: STAP2 can cause alterations in STAT3 phosphorylation levels, which in turn affect deposition of ECM leading to scar formation. Real-time qPCR analysis also showed that STAP2 over-expressed cells had higher collagen type i and type iii expression and alpha-SMA levels.

Western-blot results showed that p-STAT3 tended to increase in the overexpressed cells. Levels of collagen and alpha-SMA are elevated in over-expressed cells, as are fibrotic proteins (including COL I, COL III and alpha-SMA), and MMP9 is down-regulated.

To confirm that KGF-2 is involved in the regulation of scar formation by STAP2, 50. Mu.g/ml KGF-2 was added to STAP2 overexpressing cells.

Western-blot results showed that the levels of p-STAT3 protein were reduced in STAP2 overexpressing cell lines and the levels of ECM associated factors (including COL I, COL III and. Alpha. -SMA) were also reduced after 50. Mu.g/ml KGF-2 treatment.

Real-time qPCR analysis indicated that the mRNA of COL i, COL iii and α -SMA was down-regulated by KGF-2. KGF-2 is able to reverse to some extent the accumulation of extracellular matrix proteins caused by overexpression of STAP2.

Example 7

Use of pathway inhibitors

To see if KGF-2 affects cells through the MAPK pathway, extracted primary cells were plated in 6-well plates at 1X 10/well ⁵ Culturing the cells for 24 hr, replacing with starvation medium overnight, and adding corresponding pathway inhibitor to pre-treat for one hour the next dayAnd then adding a certain dose of KGF-2 to act on cells, extracting total protein after acting for 24 hours, and carrying out quantitative analysis on the protein through Western Blot. P38 and ERK1/2 kinase together inhibit STAT3 signaling by fibroblasts on STAP2

According to proteome data analysis, mitogen-activated protein kinase (MAPK) signaling pathway is involved in KGF-2 mediated cell proliferation and cell migration.

Therefore, it was investigated whether MAPK signaling mediates overexpression of STAP2 in response to STAT3 phosphorylation. Inhibitors of the MAPK pathway were added in scar fibroblast experiments.

The results show that when the P38 pathway is inhibited, the effects of KGF-2 down-regulation of scarring are inhibited. Whereas when the ERK pathway is inhibited, STAP2 expression is down-regulated.

Furthermore, due to the cascade of ERK and P38 pathways, the regulation of KGF-2 is enhanced in the presence of ERK pathway inhibitors.

It was shown that KGF-2 could regulate STAP2 through the P38 pathway.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (8)

1. An application of KGF-2 in preparing the medicines for treating skin dysfunction.

2. The use of claim 1, wherein the skin dysfunction is skin fibrosis and hypertrophic scarring.

3. The use of claim 2, wherein the medicament down-regulates expression of STAT2 and decreases phosphorylation of STAT3, thereby affecting expression of a downstream fibrosis-associated protein.

4. The use according to claim 3, wherein the protein comprises COLI, COLIII and α -SMA.

5. The use of claim 1, wherein KGF-2 down-regulates the amount of collagen expression in mouse skin tissue.

6. The use according to claim 1, wherein KGF-2 inhibits mechanical stress-induced scar formation in mice.

7. Use according to claim 1, wherein KGF-2 reduces the expression of extracellular matrix of primary fibroblasts.

8. A medicament for inhibiting scars, which is characterized by comprising KGF-2, wherein the dosage of the KGF-2 is 250-500 mug/kg.

Images