CN115261365A

CN115261365A - Tryptophan synthetase mutant and application thereof

Info

Publication number: CN115261365A
Application number: CN202210714273.7A
Authority: CN
Inventors: 秦成; 任丽梅; 张礼; 汤燕; 靳杰
Original assignee: Nantong Zilang Biopharma Tech Co ltd
Current assignee: Nantong Zilang Biopharma Tech Co ltd
Priority date: 2022-06-22
Filing date: 2022-06-22
Publication date: 2022-11-01
Anticipated expiration: 2042-06-22
Also published as: CN115261365B

Abstract

The invention discloses a tryptophan synthase mutant and application thereof, wherein the invention uses a genetic engineering means to connect the 51 st amino acid to the 75 th amino acid of the alpha subunit of the tryptophan synthase to the front of the C-terminal stop codon of the beta subunit of the tryptophan synthase in a direct or short connecting sequence Linker indirect connection mode to obtain the tryptophan synthase mutant; the invention uses the tryptophan synthetase mutant in industrial synthesis of L-cysteine and the derivative thereof, which can obviously improve the production efficiency and the product yield, and the TsMUT3 in the enzyme mutant has the capability of catalyzing the synthesis of the L-cysteine which is 3 times higher than that of the wild type; in addition, tsMUT3 has good stability at 50 ℃, is more prone to the L-cysteine synthesis reaction with ammonium sulfide as a sulfur-based donor, and the L-cysteine generation rate can be more than 98%. The invention is suitable for industrial production of L-cysteine and derivatives thereof.

Description

Tryptophan synthetase mutant and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and relates to a tryptophan synthase mutant, in particular to a tryptophan synthase mutant and application thereof.

Background

Coli tryptophan synthase (Ts) is a tetrameric bifunctional enzyme capable of catalyzing the synthesis of L-tryptophan from L-serine, the tertiary structure of which comprises two subunits, α and β, arranged in a linear manner according to α β α, with the active centers of each α and β subunit dimer unit being connected to each other by a 25a ° long channel. Studies have shown that the catalytic mechanism of Ts is: the alpha subunit independently catalyzes the cracking of indole-3-glycerophosphate into indole and glyceraldehyde-3-phosphate; the beta subunit catalyzes indole and L-serine to synthesize L-tryptophan under the action of pyridoxal phosphate (PLP). Further studies have shown that Ts also has the ability to catalyze the production of L-cysteine from L-serine.

In recent years, L-cysteine and its derivatives have been widely used in pharmaceuticals, foods and cosmetics. In the pharmaceutical field, acetylcysteine is widely used for respiratory diseases; in the food field, L-cysteine and its derivatives are mainly used in bakery products, including dough conditioning, gluten formation promotion, flavor improvement, etc.; in addition, the cysteine product can be used as an antioxidant for whitening and removing freckles.

With the rapid increase of the demand of L-cysteine, the prior method for producing L-cysteine by directly utilizing keratin such as hair and feather to perform acid hydrolysis has very limited yield while generating waste water and waste residues. At present, although the development of bioengineering technology provides a more efficient and environment-friendly method for producing L-cysteine, there still exist some problems, for example, german patent application with publication number DE19539952 discloses that L-cysteine is directly synthesized from glucose in recombinant Escherichia coli cells, but the participation of a series of enzymes such as O-acetylserine mercaptoase in the synthesis route leads to serious feedback inhibition of the reaction by intermediate products, end products and the like, and requires coupling and knocking in mutant enzymes insensitive to the products, and the separation and purification are difficult. In subsequent researches, the yield of the L-cysteine production method based on the principle is about 19.2g/L at most, and a large promotion space is still provided. The Chinese patent publication No. CN102517352B discloses a method for synthesizing L-cysteine by using Escherichia coli tryptophan synthase by using NaHS as a sulfur-based donor, wherein the molar conversion rate of L-serine is 84.9-85.3%.

In order to meet the demand of the market for L-cysteine, a tryptophan synthase mutant which has higher stability, better performance and shorter reaction time and can improve the production efficiency needs to be constructed, and the L-cysteine yield is further improved by popularizing and applying the tryptophan synthase mutant.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a tryptophan synthase mutant, and the enzyme mutant is constructed by a genetic engineering technical means so as to achieve the purposes of improving the stability and catalytic activity of the tryptophan synthase and being capable of being used for the high-efficiency synthesis of L-cysteine;

another object of the present invention is to provide the use of the above tryptophan synthase mutants in the synthesis of L-cystine and its derivatives, for the synthesis of L-cysteine, L-cystine and L-cysteine hydrochloride monohydrate.

In order to achieve the purpose, the invention adopts the technical scheme that:

a tryptophan synthase mutant is obtained by connecting the 51 st amino acid to the 75 th amino acid of the alpha subunit of the tryptophan synthase to the front of the C-terminal stop codon of the beta subunit of the tryptophan synthase;

wherein the tryptophan synthase is derived from Escherichia coli K-12;

tryptophan synthase (Ts) of Escherichia coli str.K-12substr.MG1655, NCBI accession number NC-000913.3; wherein the amino acid sequence from the 51 st to the 75 th position of the alpha subunit is shown as SEQ ID NO.2 and is:

Gly Ile Pro Phe Ser Asp Pro Leu Ala Asp Gly Pro Thr Ile Gln Asn Ala Thr Leu Arg Ala Phe Ala Ala Gly。

the connection mode is direct connection or indirect connection by adopting a short connection sequence Linker.

As a limitation of the invention, the short connecting sequence Linker has a sequence of GG, GGG or GGA. The indirect linkage increases the flexibility of the tryptophan synthase mutant.

As another limitation of the present invention, the nucleotide sequence of the tryptophan synthase mutant is shown in SEQ ID NO.1 and is:

ATGACAACATTACTTAACCCCTATTTTGGTGAGTTTGGCGGCATGTACGTGCCACAAATCCTGATGCCTGCTCTGCGCCAGCTGGAAGAAGCTTTTGTCAGTGCGCAAAAAGATCCTGAATTTCAGGCTCAGTTCAACGACCTGCTGAAAAACTATGCCGGGCGTCCAACCGCGCTGACCAAATGCCAGAACATTACAGCCGGGACGAACACCACGCTGTATCTCAAGCGTGAAGATTTGCTGCACGGCGGCGCGCATAAAACTAACCAGGTGCTGGGGCAGGCGTTGCTGGCGAAGCGGATGGGTAAAACCGAAATCATCGCCGAAACCGGTGCCGGTCAGCATGGCGTGGCGTCGGCCCTTGCCAGCGCCCTGCTCGGCCTGAAATGCCGTATTTATATGGGTGCCAAAGACGTTGAACGCCAGTCGCCTAACGTTTTTCGTATGCGCTTAATGGGTGCGGAAGTGATCCCGGTGCATAGCGGTTCCGCGACGCTGAAAGATGCCTGTAACGAGGCGCTGCGCGACTGGTCCGGTAGTTACGAAACCGCGCACTATATGCTGGGCACCGCAGCTGGCCCGCATCCTTATCCGACCATTGTGCGTGAGTTTCAGCGGATGATTGGCGAAGAAACCAAAGCGCAGATTCTGGAAAGAGAAGGTCGCCTGCCGGATGCCGTTATCGCCTGTGTTGGCGGCGGTTCGAATGCCATCGGCATGTTTGCTGATTTCATCAATGAAACCAACGTCGGCCTGATTGGTGTGGAGCCAGGTGGTCACGGTATCGAAACTGGCGAGCACGGCGCACCGCTAAAACATGGTCGCGTGGGTATCTATTTCGGTATGAAAGCGCCGATGATGCAAACCGAAGACGGGCAGATTGAAGAATCTTACTCCATCTCCGCCGGACTGGATTTCCCGTCTGTCGGCCCACAACACGCGTATCTTAACAGCACTGGACGCGCTGATTACGTGTCTATTACCGATGATGAAGCCCTTGAAGCCTTCAAAACGCTGTGCCTGCACGAAGGGATCATCCCGGCGCTGGAATCCTCCCACGCCCTGGCCCATGCGTTGAAAATGATGCGCGAAAACCCGGATAAAGAGCAGCTACTGGTGGTTAACCTTTCCGGTCGCGGCGATAAAGACATCTTCACCGTTCACGATATTTTGAAAGCACGAGGGGAAATCGGTATCCCCTTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCCTTTGCGGCAGGTTAA。

the sequence SEQ ID NO.1 is the nucleotide sequence of TsMUT3 below.

Wherein, the sequence of the tryptophan synthase mutant also can comprise point mutation, addition of various labels before and after the sequence, conservative substitution at other positions, amino acid truncation and other mutations which do not influence the active center of the tryptophan synthase mutant.

As a further limitation of the present invention, the expression host of the tryptophan synthase mutant is a bacterium or fungus for gene expression; including those commonly found in the art, such as E.coli BL21 (DE 3), E.coli BL21, E.coli M15, bacillus subtilis, yeast, aspergillus, streptomyces, etc.; the expression vector of the tryptophan synthetase mutant removes pET vectors commonly used by prokaryotes, and also comprises vectors matched with each host system, and the integration mode of the vectors and the hosts comprises the free existence in the hosts, the integration at specific positions of genomes and the integration at random positions; the expression pattern of the tryptophan synthase mutant is not limited to expression and secretory expression in the host.

The invention also provides an application of the tryptophan synthetase mutant, and the tryptophan synthetase mutant is used for catalyzing L-serine to synthesize L-cysteine.

The catalytic reaction solution comprises 53-125 g/L of L-serine, 0.1-1 g/L of pyridoxal phosphate and 8-10% of ammonium sulfide by mass concentration;

the dosage of the tryptophan synthetase mutants is 5-35 g/L;

the temperature of the catalysis is 35-38 ℃, and the time of the catalysis is 2-8 h.

The invention also provides the application of the tryptophan synthetase mutant in the preparation of L-cystine, wherein L-cysteine is synthesized from L-serine by adopting the tryptophan synthetase mutant to catalyze the L-serine, and then the L-cysteine is synthesized into the L-cystine through oxidation reaction.

The invention also provides the application of the tryptophan synthetase mutant in the preparation of the L-cysteine hydrochloride monohydrate.

As the limitation of the invention, after L-cysteine is synthesized by catalyzing L-serine by using the tryptophan synthetase mutant, the L-cysteine hydrochloride monohydrate is prepared by using a resin chromatography.

As a further limitation of the invention, L-cysteine is synthesized by catalyzing L-serine by using a tryptophan synthetase mutant, then L-cystine is synthesized by oxidizing L-cysteine, and then an electrolytic reduction method is adopted to prepare L-cysteine hydrochloride monohydrate.

Due to the adoption of the technical scheme, compared with the prior art, the invention has the technical progress that:

(1) the tryptophan synthetase mutant is obtained by shortening the length of alpha subunit to 25 amino acids by a PCR method after analyzing the protein crystal structure, and splicing the alpha subunit to the C-terminal stop codon of beta subunit; the invention changes the primary structure of wild tryptophan synthase, and the tryptophan synthase mutant obtained by gene editing also obviously improves the catalytic activity for synthesizing L-cysteine on the basis of improving the tryptophan synthesis capacity of the tryptophan synthase, and the stability and the substrate specificity of the tryptophan synthase mutant are both suitable for industrial production of the L-cysteine and the derivative thereof;

(2) the capability of the tryptophan synthetase mutant TsMUT3 obtained by the invention for catalyzing the synthesis of L-cysteine is 3 times higher than that of a wild type; meanwhile, tsMUT3 also has the characteristics of high efficiency, good stability after being heated to 50 ℃ and the like, and in the synthesis reaction of L-cysteine with ammonium sulfide as a sulfur-based donor, the catalytic activity is 6 times of that of the wild type, and the highest L-cysteine generation rate is more than 98%;

(3) the tryptophan synthetase mutant obtained by the invention has wide application range, can be used for efficiently producing L-cysteine, L-cystine and L-cysteine hydrochloride monohydrate, the yield of the product in the production process is more than 90 percent, and the purity of the L-cysteine hydrochloride monohydrate can reach as high as 99 percent;

the invention is suitable for industrial production of L-cysteine and derivatives thereof.

The invention is described in detail below with reference to the figures and the embodiments.

Drawings

FIG. 1 is a schematic diagram showing the splicing process of the tryptophan synthase mutant in example 1 of the present invention.

Detailed Description

The invention is explained in more detail below with reference to specific embodiments and the drawing. It should be understood that the described embodiments are only for illustrating the present invention and do not limit the present invention.

Materials, reagents and the like used in examples of the present invention are commercially available unless otherwise specified. The experimental procedures, in which specific conditions are not indicated in the examples, are generally carried out under conventional conditions or conditions recommended by the manufacturer.

Example 1 construction and expression of Tryptophan synthetase mutants

The embodiment comprises the following steps which are carried out in sequence:

construction of (I) Tryptophan synthetase mutants

Construction of Ts wild type expression strain: according to the sequence (1316416-1318415) of wild-type tryptophan synthase of Escherichia coli strain K-12substr MG1655 and the characteristics of Escherichia coli expression vector pET-21a, a single-cut site connected with EcoR1 is selected, and primers P1 and P2 shown in Table 1 are constructed into the pET-21a expression vector by PCR. The positive plasmid after verification is transformed into E.coli BL21 (DE 3) to obtain Ts wild-type expression strain. Wherein, the PCR program is as follows: 1 cycle at 95 ℃ for 10 min; 30 cycles in total, 30s at 95 ℃, 15s at 55 ℃ and 1min at 72 ℃;72 ℃ for 5min,1 cycle.

TABLE 1 primer sequences

Primer name	Sequence numbering	Sequence of
			P1	SEQ ID NO.3	5’-GGGAATTCATGACAACATTACTTAACC-3’
P2	SEQ ID NO.4	5’-CCGGAATTCTTAACTGCGCGTCGCCGCTTTC-3’

Construction of Ts mutant expression strains: as shown in figure 1, the alpha subunit sequence in the wild type is randomly truncated to form 30 alpha subunit fragments with different lengths, the position where the alpha subunit and the beta subunit are connected in the wild type is taken as alpha 1, primers are respectively designed for the alpha subunit fragments, and the alpha subunit fragments are respectively spliced and combined to the C end of the wild type beta subunit to obtain 30 Ts mutant sequences. Wherein, different splicing combination modes are selected according to the length of the alpha subunit fragment, when the length of the alpha subunit fragment is not included in the alpha 1 position and is larger than 100aa, the Overlap PCR mode is adopted for splicing combination; when the length of the alpha subunit fragment is less than 100bp excluding the alpha 1 position, splicing and combining are carried out by adopting a primer annealing mode. Ts mutant expression strains are respectively constructed by referring to the construction method of the Ts wild type expression strain and are marked as TsMUT expression strains.

Culture and expression of (II) tryptophan synthetase mutants

The Ts wild type and TsMUT expressing strains were placed in LB liquid medium containing 100mg/L ampicillin (resistance marker), respectively, and shake-cultured at 37 ℃ and 200 rpm. When the density OD600 of the thalli is 0.7, IPTG with the final concentration of 0.2mM is added, after the thalli is induced at 20 ℃ for 18 hours, the thalli is collected by centrifugation at 6000rpm for 10 minutes, the concentration is 80g/L, and enzyme liquid is obtained by ultrasonic cracking and used for performance detection so as to screen TsMUT with strong L-cysteine synthesis capacity.

Example 2 detection and screening of tryptophan synthase mutants

In this example, L-tryptophan and L-cysteine synthesis activity, color reaction detection, stability determination and substrate spectrum test were performed on the Ts wild type and TsMUT enzyme solutions prepared in example 1, respectively, to screen out tryptophan synthase mutants having high L-cysteine synthesis ability. The specific process is as follows:

(1) And (3) determining the synthesis activity: preparing 1mL reaction system with pH of 8.0 by using 900uL reaction liquid and 100uL enzyme liquid to be detected, wherein the reaction liquid is prepared by 1mM indole, 80Mm L-serine, 1mM PLP and 200mM PBK buffer solution; reacting the reaction system at 37 ℃ for 10min, and testing the synthesis condition of the L-tryptophan by using HPLC after dilution; the HPLC detection conditions were as follows: selecting a chromatographic column by ODS-2.5,4.6X 150mm; 0.1% of a phosphoric acid solution at ph 2.0, mobile phase a phase is methanol, and the volume ratio of mobile phase a phase to B phase is =4:1; the sample loading amount is 10uL; the flow rate is 0.8mL/min; the detection temperature is 30 ℃; the detection wavelength is 205nm; wherein, the enzyme activity is defined as: under the above reaction conditions, 1um L-tryptophan is produced per min to be 1U. The L-cysteine synthesis activity was determined in the same manner, and the results are shown in Table 2.

(2) And (3) detecting a color reaction: preparing a 1mL reaction system with the pH value of 8.0 by using 900uL of reaction liquid and 100uL of enzyme liquid to be detected, wherein the concentration of each component in the reaction liquid is NaHS 5g/L, L-serine 80Mm, PLP 1mM and PBK buffer solution 100mM; reacting at 37 ℃ for 10min, diluting, performing color reaction test by using ninhydrin, comparing with a standard curve, and obtaining the synthetic amount of the L-cysteine by percentage. Wherein the enzyme activity is defined as: the amount of enzyme required to produce 1um L-cysteine per min under the above reaction conditions was defined as 1U. L-tryptophan was measured in the same manner, and the results are shown in Table 2.

(3) And (3) stability determination: heating the enzyme solution to 50 ℃, treating for 10min, cooling to room temperature, and detecting the stability through L-cysteine color reaction. The results are shown in Table 2.

The results of the above-described performance tests were analyzed to find that TsMUT1 to TsMUT5 obtained in example 1 had a strong L-cysteine synthesizing ability, and that the primary structures of the TsMUT are shown in Table 2.

TABLE 2 Performance test results

Table 2 shows that the synthetic activities of the L-tryptophan of TsMUT 1-TsMUT 5 are improved compared with the wild type, and the phenomenon is consistent with the synthetic function of the beta subunit containing the L-tryptophan. Wherein TsMUT3 and TsMUT4 obviously enhance the L-cysteine synthesis capacity, which is 4.07 times and 2.38 times of that of the wild type respectively, and the 2 design-selected alpha subunit segments obviously enhance the L-cysteine synthesis capacity of the enzyme. In stability analysis, the stability of TsMUT3 was significantly enhanced compared to the wild type, and more than 60% of catalytic activity was retained. The gene sequence of TsMUT3 is shown in SEQ ID NO. 1.

(4) Substrate spectrum test: to further investigate whether the primary structure change of Ts could bring about a more suitable sulfur-based donor, naHS was replaced with (Na) in the reaction system of (2)₂S and (NH)₄)₂S two common sulfur-based donors, followed by (Na)₂S group and (NH)₄)₂S groups and two groups of chromogenic reactions, wherein the concentration of the S element in each group of substrates is controlled to be the same, wherein the concentration of the L-cysteine combined by NaHS is 100 percent, and the (Na) is calculated₂S group and (NH)₄)₂The amount of L-cysteine synthesized in the group S. The results are shown in Table 3.

TABLE 3 results of substrate Spectrum measurements

As is clear from Table 3, the Ts wild type and six enzymes TsMUT1 to TsMUT5 contained (Na) in the substrate₂In the S system, the synthesis capacity of L-cysteine is poorer than that of a system taking NaHS as a sulfur-based donor. In particular, tsMUT1, tsMUT3, and TsMUT4 pairs (NH) of TsMUT1 to TsMUT5₄)₂S shows a higher tendency to be a sulfur-based donor, particularly TsMUT3 or (NH)₄)₂When S is a sulfur-based donor, the L-cysteine synthesizing ability is about 50% or more of that of the Ts wild type.

As described above, by analyzing the results of L-tryptophan and L-cysteine synthesis activity assay, color reaction assay, stability assay, and substrate profile test, all of the mutants of tryptophan synthase prepared in example 1, tsMUT 1-TsMUT 5 are more comprehensively expressed than wild type, especially have stronger L-tryptophan and L-cysteine synthesis capacities of TsMUT3, and also show high efficiency utilization (NH)₄)₂S is the capability of a sulfur-based donor.

EXAMPLES 3-8 method of catalyzing L-cysteine Synthesis by Tryptophan synthetase mutants

Embodiment 3 is a method for catalyzing the synthesis of L-cysteine by using a tryptophan synthase mutant, specifically, a 1L system: taking a small amount of PBK buffer solution to completely dissolve 53g of L-serine, and then adding the TsMUT3 enzyme solution prepared in example 1, 1g of pyridoxal phosphate and 16% of ammonium sulfide by mass concentration, wherein in the system, the final concentration of the TsMUT3 enzyme is 10g/L, the final concentration of the ammonium sulfide is 8% and the final concentration of the PBK buffer solution is 200mM; stirring at 100rpm, monitoring and supplementing ammonium sulfide by using a pH electrode, maintaining the pH value at 8.0-9.5, reacting for 2 hours at 37 ℃, and detecting the reaction liquid obtained after the reaction is finished by a color reaction, wherein the result shows that the L-cysteine is successfully synthesized, the content of the L-cysteine is 60.70g/L, and the generation rate of the L-cysteine is more than 98%.

Examples 4 to 8 are methods for catalyzing the synthesis of L-cysteine using a tryptophan synthase mutant, which are substantially the same as in example 3 except for different parameter settings, and are shown in table 4:

table 4 table of parameters of examples 4 to 8

The contents of other portions of examples 4 to 8 are the same as those of example 3.

The reaction solutions obtained after the reactions of examples 3 to 8 were subjected to color reaction detection, and the results showed that L-cysteine was synthesized successfully, and the content of L-cysteine was 53.13 to 117.60g/L.

Comparative example Ts catalytic ability of wild type and TsMUT3 to different concentrations of reaction substrate

This comparative example is used to compare the catalytic capacity of Ts wild type and TsMUT3 for L-cysteine synthesis at different concentrations of L-serine and PLP as substrates. The catalytic reaction system of this comparative example was substantially the same as that of example 3, and the concentrations of L-serine and PLP were different as shown in Table 5, wherein the Ts wild type group used Ts wild type in place of TsMUT3. The L-cysteine production rates of the Ts wild-type group and TsMUT3 group were determined by color reaction at different concentrations of L-serine and PLP, and the results are shown in Table 5:

TABLE 5 substrate concentration settings and L-cysteine production rates

The results show that the Ts wild type has a low level although it has a certain ability to convert L-serine into L-cysteine. TsMUT3 has a production rate of 84.31-98.35% and a maximum L-cysteine production rate of more than 98% relative to wild type at an L-serine concentration of 53-125 g/L, and shows better catalytic ability.

Example 9 Tryptophan synthetase mutants for the preparation of L-cystine

This example used the reaction mixture obtained in the reaction of example 3 and having an L-cysteine content of 55g/L to prepare L-cystine. The specific method comprises the following steps: taking 2L of reaction solution, adjusting pH to 2.0, standing at 100 deg.C for 10min to make the system free of H₂And (3) filtering the S gas by adopting a 500nm ceramic membrane to remove solids such as denatured protein and the like. Adding 1.0% active carbon, decolorizing at 60 deg.C for 30min, filtering to remove carbon, and recovering filtrate. And continuously introducing compressed air into the filtrate, performing oxidation reaction on the L-cysteine under the action of oxygen to generate L-cystine, continuously oxidizing for 24 hours, taking supernatant, detecting the concentration of the L-cysteine until the concentration of the L-cysteine is less than 0.1g/L, and determining that the L-cysteine is completely oxidized. After the oxidation is finished, stirring for 2h continuously, precipitating, vacuum filtering, and washing with pure waterPrecipitating, vacuum filtering to obtain wet product, and oven drying to obtain crude L-cystine product.

The yield of the embodiment is 98 percent through detection.

EXAMPLE 10 preparation of L-cysteine hydrochloride monohydrate by resin chromatography

In this example, the reaction solution containing 55 g/L-cysteine obtained in the reaction of example 3 was used for the preparation of L-cysteine hydrochloride monohydrate by resin chromatography.

The specific method comprises the following steps: taking 2L of reaction solution, adjusting pH to 2.0 with 6mol/L hydrochloric acid solution, standing at 100 deg.C for 10min to make the system free of H₂And (3) filtering the S gas by adopting a 500nm ceramic membrane to remove solids such as denatured protein and the like. Adding 1.0% active carbon, decolorizing at 60 deg.C for 30min, filtering to remove carbon, and recovering filtrate. Adjusting the pH of the filtrate to 5.0 by using 6mol/L hydrochloric acid, filtering out solids, performing ultrafiltration concentration on the obtained filtrate by using a membrane ultrafiltration device with the limited molecular weight of 5000, introducing the obtained filtrate into a strong cation resin LX160 chromatographic column, eluting the chromatographic solution by using 2mol/L hydrochloric acid, performing nanofiltration on the obtained eluent by using a membrane with the limited molecular weight of 200, and performing reduced pressure concentration, low-temperature cooling crystallization, centrifugal separation and drying on the nanofiltration liquid to obtain the L-cysteine hydrochloride monohydrate.

The yield of the embodiment is up to 95% by detection.

EXAMPLE 11 preparation of L-cysteine hydrochloride monohydrate by electrolytic reduction method

This example used the L-cystine obtained in example 9 in the electrolytic reduction process to prepare L-cysteine hydrochloride monohydrate.

The specific method comprises the following steps: adding 100g of L-cystine and 6mol/L hydrochloric acid into an electrolytic reactor, stirring at room temperature for 1.5h to fully dissolve the L-cystine, filtering, and transferring the filtrate into the cathode area of an electrolytic cell; 6mol/L hydrochloric acid is added into the anode region of the anode electrolytic cell, so that the liquid level is kept equal to that of the cathode region. Electrifying at 50 deg.C, and controlling current density to 5A/dm²And electrolyzing for 11h. And continuously replenishing 6mol/L hydrochloric acid to the anode region in the electrolysis process, and maintaining the original volume. And (3) before the reaction reaches the end point, taking the cathode area electrolyte to detect the optical rotation every 15min until the optical rotation value of the cathode electrolyte is not increased any more, namely the reaction reaches the end point. After the electrolysis is finishedTransferring the cathode electrolyte into a decoloring reactor, maintaining the temperature at 80 ℃, adding 1% of activated carbon, decoloring for 30min, filtering, concentrating the filtrate under reduced pressure, crystallizing at low temperature, centrifugally separating, and drying to obtain the L-cysteine hydrochloride monohydrate.

The yield of the L-cysteine hydrochloride monohydrate obtained in the embodiment is more than 99%, and the purity is more than 99%.

In another embodiment, L-cystine is used in an amount of any number between 100 and 500g to give L-cysteine hydrochloride monohydrate in a purity of more than 99%.

The results show that the invention successfully constructs the tryptophan synthase mutant which can be used for synthesizing the L-cysteine and the derivatives thereof, and remarkably enhances the ability of Ts in catalyzing the synthesis of tryptophan. In addition, tsMUT3 in the enzyme mutant catalyzes L-cysteine synthesis 3-fold more than the wild type. Meanwhile, tsMUT3 also has the characteristics of good stability, high efficiency and the like, and in the synthesis reaction of L-cysteine taking ammonium sulfide as a sulfur-based donor, the catalytic activity is 6 times of that of the wild type, and the highest L-cysteine generation rate is more than 98%.

Although the present invention has been described in detail with reference to the above embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments described above, or equivalents may be substituted for elements thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the scope of the claims of the present invention.

SEQUENCE LISTING

<110> Nantong purple Lang biomedical science and technology Co., ltd

<120> tryptophan synthase mutant and application thereof

<130> 1

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 1269

<212> DNA

<213> Escherichia coli K-12 (Escherichia coli K-12)

<400> 1

atgacaacat tacttaaccc ctattttggt gagtttggcg gcatgtacgt gccacaaatc 60

ctgatgcctg ctctgcgcca gctggaagaa gcttttgtca gtgcgcaaaa agatcctgaa 120

tttcaggctc agttcaacga cctgctgaaa aactatgccg ggcgtccaac cgcgctgacc 180

aaatgccaga acattacagc cgggacgaac accacgctgt atctcaagcg tgaagatttg 240

ctgcacggcg gcgcgcataa aactaaccag gtgctggggc aggcgttgct ggcgaagcgg 300

atgggtaaaa ccgaaatcat cgccgaaacc ggtgccggtc agcatggcgt ggcgtcggcc 360

cttgccagcg ccctgctcgg cctgaaatgc cgtatttata tgggtgccaa agacgttgaa 420

cgccagtcgc ctaacgtttt tcgtatgcgc ttaatgggtg cggaagtgat cccggtgcat 480

agcggttccg cgacgctgaa agatgcctgt aacgaggcgc tgcgcgactg gtccggtagt 540

tacgaaaccg cgcactatat gctgggcacc gcagctggcc cgcatcctta tccgaccatt 600

gtgcgtgagt ttcagcggat gattggcgaa gaaaccaaag cgcagattct ggaaagagaa 660

ggtcgcctgc cggatgccgt tatcgcctgt gttggcggcg gttcgaatgc catcggcatg 720

tttgctgatt tcatcaatga aaccaacgtc ggcctgattg gtgtggagcc aggtggtcac 780

ggtatcgaaa ctggcgagca cggcgcaccg ctaaaacatg gtcgcgtggg tatctatttc 840

ggtatgaaag cgccgatgat gcaaaccgaa gacgggcaga ttgaagaatc ttactccatc 900

tccgccggac tggatttccc gtctgtcggc ccacaacacg cgtatcttaa cagcactgga 960

cgcgctgatt acgtgtctat taccgatgat gaagcccttg aagccttcaa aacgctgtgc 1020

ctgcacgaag ggatcatccc ggcgctggaa tcctcccacg ccctggccca tgcgttgaaa 1080

atgatgcgcg aaaacccgga taaagagcag ctactggtgg ttaacctttc cggtcgcggc 1140

gataaagaca tcttcaccgt tcacgatatt ttgaaagcac gaggggaaat cggtatcccc 1200

ttctccgacc cactggcgga tggcccgacg attcaaaacg ccactctgcg cgcctttgcg 1260

gcaggttaa 1269

<210> 2

<211> 25

<212> PRT

<213> Escherichia coli K-12 (Escherichia coli K-12)

<400> 2

Gly Ile Pro Phe Ser Asp Pro Leu Ala Asp Gly Pro Thr Ile Gln Asn

1 5 10 15

Ala Thr Leu Arg Ala Phe Ala Ala Gly

20 25

<210> 3

<211> 27

<212> DNA

<213> Escherichia coli K-12 (Escherichia coli K-12)

<400> 3

gggaattcat gacaacatta cttaacc 27

<210> 4

<211> 31

<212> DNA

<213> Escherichia coli K-12 (Escherichia coli K-12)

<400> 4

ccggaattct taactgcgcg tcgccgcttt c 31

Claims

1. A tryptophan synthase mutant is characterized in that the 51 st amino acid to the 75 th amino acid of the alpha subunit of the tryptophan synthase are connected before the C-terminal stop codon of the beta subunit of the tryptophan synthase to obtain the tryptophan synthase mutant;

wherein the tryptophan synthase is derived from Escherichia coli K-12;

2. The tryptophan synthase mutant according to claim 1, wherein the short-linking sequence Linker has the sequence GG, GGG or GGA.

3. The tryptophan synthase mutant according to claim 1, wherein the nucleotide sequence is represented by SEQ ID No. 1.

4. The tryptophan synthase mutant according to any one of claims 1 to 3, wherein an expression host of the tryptophan synthase mutant is a bacterium or a fungus for gene expression.

5. The use of the tryptophan synthase mutant as claimed in any one of claims 1 to 4, wherein the tryptophan synthase mutant is used to catalyze the synthesis of L-cysteine from L-serine.

6. The use according to claim 5, wherein the catalyzed reaction solution comprises 53 to 125g/L of L-serine, 0.1 to 1g/L of pyridoxal phosphate, and 8 to 10% by mass of ammonium sulfide;

the dosage of the tryptophan synthetase mutant is 5-35 g/L;

the temperature of the catalysis is 35-38 ℃, the time is 2-8h, and the pH value is 8.0-9.5.

7. Use of the tryptophan synthase mutant according to any one of claims 1 to 4 in the preparation of L-cystine, wherein L-cysteine is synthesized from L-serine by catalyzing the tryptophan synthase mutant, and then L-cystine is synthesized from L-cysteine by oxidation reaction.

8. Use of the tryptophan synthase mutant according to any one of claims 1 to 4 for the preparation of L-cysteine hydrochloride monohydrate.

9. The use of the tryptophan synthase mutant according to claim 8, wherein the tryptophan synthase mutant is used for catalyzing L-serine to synthesize L-cysteine, and then the L-cysteine hydrochloride monohydrate is prepared by resin chromatography.

10. The use of the tryptophan synthase mutant according to claim 8, wherein the tryptophan synthase mutant is used to catalyze L-serine to synthesize L-cysteine, the L-cysteine is then synthesized into L-cystine by oxidation, and then the L-cysteine hydrochloride monohydrate is prepared by electrolytic reduction.