CN115260314B

CN115260314B - Recombinant thermophilic neutral protease and application thereof in degradation of protein

Info

Publication number: CN115260314B
Application number: CN202210505122.0A
Authority: CN
Inventors: 解桂秋; 高仁钧; 轩小然
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2022-05-10
Filing date: 2022-05-10
Publication date: 2023-10-24
Anticipated expiration: 2042-05-10
Also published as: CN115260314A

Abstract

A recombinant thermophilic neutral protease and application thereof in degrading protein belong to the technical field of bioengineering. The invention provides a recombinant thermophilic neutral protease capable of being secreted and expressed in a bacillus subtilis host, which comprises the recombinant thermophilic neutral protease with secretion signal peptide sequences shown in SEQ ID No.1, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 and the recombinant thermophilic neutral protease without secretion signal peptide sequences shown in SEQ ID No.2. The thermophilic neutral protease is secreted and expressed in bacillus subtilis in the form of a pro-peptide sequence, and experimental results show that the thermophilic neutral protease has higher enzyme activity, can degrade bean pulp to obtain small molecular polypeptides with high antioxidant activity, can stably exert the enzyme activity in various detergents, can well degrade hemoglobin and remove blood stains.

Description

Recombinant thermophilic neutral protease and application thereof in degradation of protein

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to recombinant thermophilic neutral protease capable of being secreted and expressed in a bacillus subtilis host and application of the recombinant thermophilic neutral protease in protein degradation.

Background

Proteases are a class of hydrolytic enzymes that cleave peptide bonds in macromolecular proteins to make them small molecular proteins or polypeptides. The types of amino acid residues at the active center can be classified into serine protease, cysteine protease, aspartic protease and metalloprotease, and the pH of the reaction can be classified into acid protease, neutral protease and alkaline protease.

Proteases find wide application in industry. In the medical field, protease is one of the pharmaceutical enzymes with earliest clinical use and widest application, and can be used for treating dyspepsia, diminishing inflammation, activating blood vessels and treating hypertension. In the food industry, proteases are used for meat softening, cheese production, beer decontamination, peptone production and the like. Proteases are one of the main enzymes added in enzymatic detergents for the removal of proteinaceous soils. Besides being added into daily detergents, the protease can also be used in medical multi-enzyme detergents for degrading hemoglobin and the like on surgical instruments. The protease added in the detergent is mainly from Bacillus, including wild type enzyme and mutant, such as subtilisin Carlsberg (ALCALASE) produced by Novozymes company ^Ⓡ ) Subtilisin 147 (ESPERASE) ^Ⓡ ) Subtilisin 309 (SAVINASE) ^Ⓡ ) And subtilisin PB92 from Genencor (MAXACAL) ^Ⓡ ) Etc. The novelin company published a subtilisin mutant in patent CN 101228343B; patent CN 1606626a discloses a novel alkaline protease of bacillus species (DSM 14390) and washing and cleaning products comprising the novel alkaline protease; CN 103305493a and CN 103305493B disclose the production and use of thermophilic proteases and mutants from geobacillus, which are at P at 32 ℃ in liquid detergents&GTIDE ^Ⓡ Is 68 times more stable than NprE purified from the bacillus species supernatant. Protease main added in enzyme-added detergent in domestic market at presentThe development of proteases with high activity and stability is important in economic, social and environmental benefits by virtue of importation and high price.

Neutral protease is protease with optimal reaction pH of 7.0, and has been used in food, detergent and textile industries. However, the enzyme preparation enterprises which are currently engaged in the research and the sales of neutral protease are few, so that the research and the development of the neutral protease have better research and application prospects.

Chinese patent CN 1446911a discloses a method for producing thermolysin by artificial gene, constructing escherichia coli expression strain to induce expression of thermolysin, but the expression product is inclusion body, and needs to use high concentration urea for renaturation. This enzyme is well known in the literature under the english name Thermolysin, which is known in Ca ²⁺ The enzyme can exist stably at 80 ℃, but has limited cleavage sites, which only cut at the N end of hydrophobic amino acid residues, including methionine, leucine, isoleucine, valine, phenylalanine and alanine, and limited cleavage sites, so that the enzyme is commonly used for polypeptide profiling and rarely used for other purposes. CN 103667150 discloses bacillus subtilis for producing thermostable neutral protease, the optimum reaction temperature of the neutral protease is 70 ℃, the optimum reaction pH is 7.2, the enzyme activity is reduced by 5% in 30 min at 60 ℃, the enzyme activity is reduced by 15% in 1 h, and the stability is limited.

The condition of the enzyme is complex in practical application, while the disadvantage of neutral protease is poor stability, which limits its application range. Compared with chemical catalysts, thermophilic enzymes from thermophilic and hyperthermophilic microorganisms have the advantages of high catalytic efficiency, strong substrate specificity, good stability and the like, and are a very potential source of industrial enzymes. Therefore, the development of a thermophilic neutral protease with high activity and stability can provide a good candidate enzyme for industrial proteases.

We report from thermophilic archaebacteriaThermus thermophilus HB8Inducible expression of the thermophilic protease of (E.coli host) (Xie GQ, shao ZK, zong L, et al Heterologous expression and characterization of anoverl subtilisin-like protease from a thermophilic Thermus thermophilus H)B8,International journal of biological macromolecules, 2019, 138: 528-535.). The enzyme belongs to a Subtilisin-like protease family, and is analyzed by similarity comparison, the sequence contains secretion signal peptide (1-19), a propeptide sequence and a mature protease sequence, the sequence needs to be removed when the enzyme is expressed in escherichia coli, the coding sequence with the propeptide amino acid sequence is connected to an escherichia coli expression vector pET20b through PCR amplification, and only the mature protease after self-shearing is obtained after induction expression, heat treatment and purification. Mature enzyme shows maximum catalytic activity at 65-80 ℃ and pH 7.5, the half-life of enzyme at 75 ℃ exceeds 48 h, the half-life of enzyme at 85 ℃ also exceeds 3 h, and the mature enzyme has very high stability. Subtilisin-like family proteases have no specific cleavage sites and are more suitable for industrial use in degrading proteins.

Disclosure of Invention

The invention aims to provide a recombinant thermophilic neutral protease which can be secreted and expressed in a bacillus subtilis host and application of the thermophilic neutral protease in degrading proteins, wherein the recombinant thermophilic neutral protease comprises recombinant thermophilic neutral proteases with secretion signal peptide sequences (the amino acid sequences are shown as SEQ ID No.1, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6) and recombinant thermophilic neutral proteases without secretion signal peptide sequences (the amino acid sequences are shown as SEQ ID No. 2).

The recombinant thermophilic neutral protease of the invention is derived from thermophilic bacteriaThermus thermophilus HB8Serine proteases belonging to the subtilisin-like family. The recombinant thermophilic neutral protease is constructed on a bacillus subtilis expression vector pBE-S in the form of a propeptide sequence, and is fused with a secretion signal peptide aprE on the vector for expression, the nucleotide sequence and the amino acid sequence of the fusion protein are shown as SEQ ID No.1, wherein 1-87 nucleotide sequences are coding sequences (coding 1-29 amino acid sequences) of the secretion signal peptide aprE, 88-111 nucleotide sequences are identification sequences (coding 30-37 amino acid sequences) of restriction enzymes on the vector, 112-390 nucleotide sequences are coding sequences (coding 38-130 amino acid sequences) of the propeptide, and 391-1353 nucleotide sequencesThe coding sequence is listed as mature enzyme coding sequence (coding 131-451 amino acid sequences), and the 1354-1407 nucleotide sequence is the coding sequence (coding 452-468 amino acid sequences) of restriction enzyme recognition sequence and histidine His purification tag on the carrier. The secretion signal peptide aprE can guide the thermophilic neutral protease to enter a culture medium through a secretion channel of a bacillus subtilis cell membrane, and in the process, the secretion signal peptide aprE is excised by the signal peptidase on the cell membrane to obtain the recombinant thermophilic neutral protease without the secretion signal peptide sequence, and the amino acid sequence of the recombinant thermophilic neutral protease is shown as SEQ ID No.2. The secretory signal peptide aprE on the expression vector is further replaced by yoaW (the sequence is shown as SEQ ID No. 3), ykwD (the sequence is shown as SEQ ID No. 4), yurI (the sequence is shown as SEQ ID No. 5) and yrrS (the sequence is shown as SEQ ID No. 6), so that the secretory expression quantity of the thermophilic neutral protease in bacillus subtilis can be improved.

Serine proteases are typically expressed in the form of a precursor protein (pre-pro-protease) comprising a signal peptide sequence, an N-terminal propeptide and a mature enzyme. The function of the signal peptide is to ensure that the protein is released from the production cell into the cytosol or extracellular medium and cleaved from the precursor protein by the signal peptidase upon transport across the cell membrane to the outside of the cell. Proteins from which the signal peptide has been removed, known as zymogens (pro-proteases), are usually inactive and are treated to remove the N-terminal propeptide and become active mature enzymes, the cleavage resulting from self-digestion or autocatalytic cleavage by serine proteases. However, the thermophilic neutralizing protease of the invention was expressed in Bacillus subtilis as a pro-peptide sequence 48 h, the protease activity was detected in the supernatant, and SDS-PAGE electrophoresis detected at 45 kDa.

The invention relates to a recombinant thermophilic neutral protease, which is prepared by the following steps:

(1) The recombinant expression plasmid pET20b-Tth0724 is used as a template, a thermophilic neutral protease gene fragment (coding 21-434 aa) is obtained through PCR amplification, then the gene is inserted into a secretion signal peptide aprE downstream Sac I and BamH I site of an expression vector pBE-S to construct a recombinant expression plasmid of bacillus subtilis, the recombinant expression plasmid is screened by transforming E.coli DH5 alpha competent cells, the recombinant expression plasmid obtained by screening is transformed into bacillus subtilis competent RIK1285, and after the bacillus subtilis is subjected to shaking culture at 37 ℃ based on the LB liquid culture for 48 h, the thermophilic neutral protease is detected in a culture medium, so that the secretion signal peptide aprE can guide the secretory expression of the thermophilic neutral protease in the bacillus subtilis RIK 1285;

(2) In order to further increase the secretory expression amount of the thermophilic neutral protease in bacillus subtilis, the secretory expression amount can be achieved by optimizing a secretory signal peptide: cutting the recombinant expression plasmid obtained in the step (1) by Mlu I and Eco 52I, removing aprE secretion signal peptide on the recombinant expression plasmid, connecting with mixture SP DNA containing 173 bacillus subtilis secretion signal peptides, transforming E.coli DH5 alpha competent cells, coating on LB solid medium containing 100 mug/mL Amp, and culturing at 37 ℃ overnight; transferring all the obtained colonies into 5 mL LB liquid medium, shaking and culturing at 37 ℃ and 180 rpm for overnight, extracting recombinant expression plasmid mixture connected with different secretion signal peptides, electrically converting bacillus subtilis competent RIK1285, screening engineering bacteria with improved enzyme activity, and optimizing to obtain secretion signal peptides with improved secretion and expression of thermophilic neutral protease, wherein the secretion signal peptide yoaW is used for improving the secretion and expression of the thermophilic neutral protease most obviously, and the expression bacteria are used as the expression engineering bacteria of bacillus subtilis of the thermophilic neutral protease;

(3) Inoculating the expression engineering bacteria obtained in the step (2) to an LB liquid culture medium, carrying out shaking culture at 37 ℃ and 180 rpm for 48 h, centrifuging and collecting supernatant to obtain crude enzyme liquid, and carrying out ultrafiltration to obtain thermophilic neutral protease;

the secretion signal peptide optimized in the above step (2) includes yoaW, ykwD, yurI and yrrS. Compared with protease expressed by colibacillus, the thermophilic neutral protease of the invention mainly exists in the form of having a propeptide sequence, and only mature enzyme is obtained after expression and purification in colibacillus. The traditional subtilisin only has the activity of mature protein, and the zymogen with the propeptide sequence has no activity, but the thermophilic neutral protease provided by the invention has the propeptide sequence and has the proteolytic activity, and the protease does not need to be sheared, so that the production process is greatly simplified, and the production cost is reduced.

The second technical scheme of the invention: measurement of optimum temperature, optimum pH, thermal stability and pH stability of the thermophilic neutral protease catalytic reaction is carried out, and the specific operation is as follows;

(1) The optimal reaction temperature of the thermophilic neutral protease is explored by measuring the hydrolysis rate of the thermophilic neutral protease within the range of 65-95 ℃, and the optimal pH of the thermophilic neutral protease is measured within the range of pH 6.0-10.0;

(2) The thermophilic neutral protease was sampled at 75℃for different times and the residual activity of the thermophilic neutral protease was determined to investigate the thermostability of the thermophilic neutral protease.

The third technical scheme of the invention: use of a thermophilic neutralizing protease in the field of degrading proteins, comprising the following three aspects:

(1) Preparing heparin sodium by hydrolyzing the casing with thermophilic neutral protease: adding casing liquid in the small intestine of a 2 mL pig and 10-240U of neutral thermal protease into a 10 mL and 50 mmol/L phosphate buffer reaction system, and carrying out oscillation reaction at 75 ℃ and 120 rpm for 2 h to prepare heparin sodium;

(2) Preparing soybean bioactive peptide by hydrolyzing soybean meal with thermophilic neutral protease: crushing large-particle soybean meal by using a wall breaking machine, removing large particles by using a 100-mesh sieve, and continuously crushing for 10 min and fully grinding to obtain soybean meal powder; the enzymolysis system is 50 mL, 50 mmol/L phosphate buffer solution, contains bean pulp powder with the final concentration of 2.5% (m/v) and 100-1500U of thermophilic neutral protease, and performs oscillation reaction at 75 ℃ and 150 rpm for 3 h to prepare the soybean bioactive peptide;

(3) Use of a thermophilic neutralizing protein in a detergent: firstly, heat-treating an delicate detergent at 100 ℃ for 1 h, and inactivating the original enzyme preparation in the detergent; the treated detergent with the final concentration of 1% (v/v) and 10-240U of thermophilic neutral protease are contained in a 10 mL and 50 mmol/L phosphate buffer solution system, and the dirty cloth with pig blood is soaked in the liquid and is washed for 20 min at 60 ℃ under shaking at 120 rpm.

The thermophilic neutral protease is secreted and expressed by bacillus subtilis secretory expression engineering bacteria, is not limited to a specific expression vector, adopts eukaryotic or prokaryotic expression vectors as preferred expression vectors, and is further preferred to be a pBE-S vector; not limited to a specific secretion signal peptide, various secretion signal peptides of Bacillus subtilis may be used, and aprE, yoaW, ykwD, yurI and yrrS are further preferred; the expression vector is not limited to any particular host cell as long as it can express the above-mentioned expression vectors, such as bacillus subtilis RIK1285, BS168, WB600, WB800, etc., and in a preferred embodiment, bacillus subtilis RIK1285 strain is used.

All basic molecular biology procedures in the above technical schemes are referred to the "molecular cloning experimental guidelines" (third edition, scientific press, 2002).

The expression vectors pBE-S and bacillus subtilis host bacterium RIK2185 used in the invention are common vectors and host bacteria in the technical field and can be purchased from Bao Ri doctor Material technology (Beijing) company, the website of which: http:// www.takarabiomed.com.cn. May be purchased through a contact address given by the company or purchased through a proxy company for each province in the country.

Drawings

Fig. 1: secretory expression SDS-PAGE electrophoresis of thermophilic neutral protease; m is a standard molecular weight Marker, lane 1 is the secretion signal peptide aprE, lane 2 is the secretion signal peptide yoaW, and lane 3 is the secretion signal peptide ykwD. The arrow indicates the thermophilic neutral protease with a propeptide sequence, the molecular weight is 45 kDa, which indicates that the thermophilic neutral protease is secreted and expressed in the bacillus subtilis host RIK1285, and the secretory expression quantity of the thermophilic neutral protease is higher when the secretory signal peptide is yoaW.

Fig. 2: temperature-activity curve of thermophilic neutral protease; the abscissa is temperature and the ordinate is relative vigor. The activity of the thermophilic neutral protease is maintained to be more than 80% in the range of 65-95 ℃, and the maximum activity is shown at 80 ℃.

Fig. 3: a thermostability profile of a thermophilic neutralizing protease; the abscissa is time and the ordinate is residual vitality. The thermophilic neutral protease incubated at 75℃for 6 h reduced enzyme activity by only about 10%.

Fig. 4: pH-activity profile of thermophilic neutral protease; the abscissa is pH, the ordinate is relative activity, the thermophilic neutral protease maintains more than 80% of activity within the range of pH 6.0-8.0, and 60% of activity remains at pH 10.0.

Fig. 5: preparing heparin sodium titer chart by degrading casing liquid with thermophilic neutral protease; the abscissa indicates the type of protease and the ordinate indicates heparin sodium titer. The potency of heparin sodium produced by hydrolyzing casing liquid 2 h with thermophilic neutral protease is 10.8U/mL, and the effect is slightly weaker than that of commercial enzyme Bacillus subtilis neutral protease (Nanning Pang Bo bioengineering Co., ltd.) and better than that of P2000 alkaline protease (Jenergy bioengineering Co.).

Fig. 6: an antioxidant activity diagram of soybean polypeptide prepared by degrading soybean meal with thermophilic neutral protease; the abscissa indicates the protease species and the ordinate indicates the DDPH clearance. The effect of soybean polypeptide obtained by degrading soybean meal by thermophilic neutral protease for eliminating DPPH is obviously better than that of commercial enzymes of bacillus subtilis neutral protease (Nanning Pang Bo biological engineering Co., ltd.) and P2000 alkaline protease (Jenergic biological engineering Co., ltd.), which shows that the antioxidation activity is better.

Fig. 7: an antioxidant activity diagram of each component of soybean polypeptide prepared by degrading soybean meal by thermophilic neutral protease; the abscissa is the components of soy polypeptides of different molecular weights and the ordinate is DPPH clearance. After the soybean meal is degraded by the thermophilic neutral protease, the soybean polypeptide is divided into four components of more than 30 kDa, 10-30 kDa, 3-10 kDa and less than 3 kDa, wherein the component of less than 3 kDa has the best DPPH removing effect, namely the component has the best antioxidation effect.

Fig. 8: a map of compatibility of thermophilic neutralizing proteases with surfactants and bleaching agents; the abscissa is the type of surfactant and bleach, and the ordinate is the relative activity, and the control group was not added with surfactant and bleach, taking the enzyme activity of the control group as 100%. The compatibility of the thermophilic neutral protease with the surfactant and the bleaching agent added in the detergent is good, the relative activity of the enzyme is maintained above 90%, and the enzyme activity is improved by about 35% when 5% (v/v) Tween 20 and 80 exist, which indicates that the thermophilic neutral protease can stably exert the enzyme activity in the detergent.

Fig. 9: a map of the compatibility of a thermophilic neutral protease with commercial detergents; the abscissa is the brand of the detergent, the ordinate is the relative activity, and the control group is not added with the detergent, and the enzyme activity of the control group is 100%. The thermophilic neutral protease can keep more than 80% of enzyme activity in various detergents except the Bilang detergent, and the activity is improved by 6% in the delicate detergent.

Fig. 10: an effect diagram of thermophilic neutral protease for washing pig blood stains; 1: before washing, 2: an subtle detergent wash effect of heating 1 h at 100 ℃,3: washing effect of the addition of 240U thermophilic neutral protease to group 2 detergent. Indicating that the thermophilic neutral protease can well degrade hemoglobin and remove blood stains.

Detailed Description

Example 1: construction of engineering bacteria for secretory expression of thermophilic neutral protease bacillus subtilis and protein expression, comprising the following steps:

1. cloning of thermophilic neutral protease Gene

The recombinant plasmid pET20b-Tth0724 (Xie GQ, shao ZK, zong L, et al Heterologous expression and characterization of a noverlsubtilisin-like protease from a thermophilic Thermus thermophilus HB,International journal of biological macromolecules2019, 138:528-535) as template, and PCR amplification to obtain the thermophilic neutral protease gene, coding 414aa. The primer sequences for the thermophilic neutral protease are as follows:

an upstream primer: AGTAATGAGCTCCCCCAGACCCCA, restriction enzyme Sac I recognition site;

a downstream primer: GATTTGGGATCCGGGGAAGCAGTA, the restriction enzyme BamHI recognition site is located along the horizontal line.

And (3) PCR reaction: in a 100. Mu.L reaction system, 1. Mu.L pET20b-Tth0724 plasmid, 2. Mu.L upstream primer, 2. Mu.L downstream primer, 45. Mu.L ultra pure water, 50. Mu. L Premix PrimerSTART were contained ^Ⓡ HS enzyme cocktail (Bao Ri doctor Material technology (Beijing) company). Denaturation at 98℃for 10 s, annealing at 62℃for 5 s and elongation at 72℃for 85 s for 35 cycles per cycle.

The thermophilic neutral protease gene is recombined into an expression vector pBE-S by utilizing SacI and BamH I cleavage sites, and is connected to become a recombinant expression plasmid to transform competent cells of the escherichia coli. The recombinant plasmid construction process comprises the following steps: the thermophilic neutral protease PCR product and the expression vector pBE-S are respectively digested with restriction enzymes Sac I and BamH I, 5 mu L of restriction enzyme digestion buffer solution K and 2.5 mu L of the PCR product or the expression vector pBE-S are sequentially added into the digestion system, and the two restriction enzymes are uniformly mixed and reacted at 37 ℃ for 3 h. The resulting 5. Mu.L of the digested thermophilic neutral protease PCR product was mixed with 1. Mu.L of pBE-S vector fragment, 1. Mu.L of 10 XT 4 DNA ligase buffer, 1. Mu. L T4 DNA ligase and 2. Mu.L of sterile water and ligated in a water bath at 25℃for 4 h. The ligation mixture was transformed into E.coli DH 5. Alpha. Competent cells, plated on LB solid medium containing ampicillin at a final concentration of 100. Mu.g/mL, and cultured upside down at 37℃overnight. Single colony inoculation is selected, and the single colony inoculation is carried out on 5 mL LB liquid medium containing 100 mug/mL ampicillin, and shake culture is carried out at 37 ℃ and 180 rpm for overnight, and recombinant expression plasmid is extracted by using a plasmid extraction kit.

2. Expression of thermophilic neutral proteases

And (3) transforming the recombinant expression plasmid in the step (1) into bacillus subtilis RIK1285 competent cells to construct secretory expression engineering bacteria. Preparation of bacillus subtilis RIK1285 competent cells: inoculating bacillus subtilis RIK1285 into 5 mL of LB liquid medium, and culturing at 37 ℃ and 180 rpm under shaking for overnight; inoculating 2.5. 2.5 mL overnight culture solution into 40 mL sorbitol liquid medium (100 mL sorbitol liquid medium containing 1 g peptone, 0.5 g yeast extract, 1 g NaCl and 9 g sorbitol, sterilizing with 121 deg.C high pressure steam for 15 min), shaking culturing at 37deg.C and 180 rpm to OD ₆₀₀ Centrifuging at 4000 rpm at 4deg.C for 10 min to collect thallus at 0.85-0.95; washing the cells with 40 mL electrotransformation solution (100 mL electrotransformation solution contains sorbitol 9 g, mannitol 9.25 g and glycerol 10 mL), centrifuging at 4000 rpm at 4deg.C for 10 min to collect cells, and repeating washing for 3 times; bacillus subtilis RIK1285 competent cells were prepared by resuspension of the cells with 1 mL electrotransformation solution. Adding 5 mu L of the recombinant expression plasmid in the step 1 into 100 mu L of competent cells, and transferring to precooled 0.2. 0.2 mm electricityIn a rotor, 2.5 ms was shocked by 2 kv in an electrotransfer apparatus, 1 mL resuscitating medium (100 mL resuscitating medium comprising peptone 1 g, yeast extract 0.5 g, naCl 1 g, sorbitol 9 g and mannitol 7 g, and sterilized by high-pressure steam at 121deg.C for 15 min) was immediately added, 2 h was cultured by shaking at 37deg.C and 180 rpm, spread on LB solid plate containing 50 μg/mL kanamycin, and cultured upside down overnight at 37deg.C. Single colonies are picked and inoculated into LB liquid medium containing 50 mug/mL kanamycin, the culture is carried out at 37 ℃ under 180 rpm shaking for 48 hours, the centrifugation is carried out at 12000 rpm for 15 minutes, the supernatant is collected, and the secretory expression of the thermophilic neutral protease in bacillus subtilis is identified and confirmed through SDS-PAGE electrophoresis, and the result is shown as lane 1 in the figure 1. The single colony verified by the steps can be used as engineering bacteria for expressing the thermophilic neutral protease, the secretion signal peptide aprE on the expression vector can guide the thermophilic neutral protease to be secreted and expressed in bacillus subtilis into a culture medium, the signal peptide aprE is excised by the signal peptidase on a cell membrane when passing through a secretion channel, and the thermophilic neutral protease without a secretion signal peptide sequence is obtained, and the amino acid sequence is shown as SEQ ID No.2.

3. Optimization of Signal peptides

The amino acid composition and the property of the secretion signal peptide are important factors influencing different secretion expression amounts of exogenous proteins in bacillus subtilis, and in order to further improve the secretion expression amount of the thermophilic neutral protease in bacillus subtilis, the secretion signal peptide aprE of the recombinant expression plasmid in the step 1 is replaced by other bacillus subtilis signal peptides, and the expression engineering bacteria with improved secretion expression amount of the thermophilic neutral protease are screened. The recombinant expression plasmid of step 1 was digested with restriction enzymes Mlu I and Eco 52I at 37℃for 3 h, the aprE secretion signal peptide on the recombinant expression plasmid was removed, the plasmid DNA fragment from which the signal peptide was removed was purified using a DNA recovery kit, 4. Mu.L of the plasmid DNA fragment, 1.5. Mu.L of SP DNA mixture containing 173 kinds of Bacillus subtilis secretion signal peptides, 2. Mu.L of 5 Xligase In-fusion HD enzyme premix and 2.5. Mu.L of ultrapure water were taken, and the mixture was ligated at 50℃for 15 minutes to transform E.coli HST08 competent cells, and the mixture was spread on 5 mL LB solid medium containing 100. Mu.g/mL ampicillin, and cultured upside down at 37℃overnight. All colonies on the plates were transferred to 5 mL LB liquid medium containing 100. Mu.g/mL ampicillin, plasmids were extracted after overnight incubation at 37℃and transformed into competent cells of Bacillus subtilis RIK1285, and engineering bacteria with improved enzyme activity were selected. The signal peptides which are verified by DNA sequencing to improve the secretory expression quantity of the thermophilic neutral protease comprise yoaW, ykwD, yurI and yrrS (the secretory signal peptide coding genes are upstream of the target genes, fusion proteins with the secretory signal peptide are expressed, the secretory signal peptide guides the secretory expression of the target protein through the cell membrane of a host cell and is cut off when passing through the cell membrane channel, so that the obtained protein is only the target protein of SEQ ID No. 2), wherein the secretory signal peptides yoaW and ykwD are more beneficial to the secretory expression of the thermophilic neutral protease, and the result is shown in lanes 2 and 3 in FIG. 1. The secretion signal peptide sequence which can enable the thermophilic neutral protease to carry out secretory expression in bacillus subtilis is shown in SEQ ID No.3-6.

In this example, the bacillus subtilis strain used is RIK1285, but not limited to RIK1285, and the bacillus subtilis strain used for expression of the recombinant plasmid also comprises host cells such as BS168, WB600 and WB 800.

Example 2: optimum temperature, optimum pH and thermostability of thermophilic neutral protease

1. Optimum reaction temperature and thermal stability

The activity of the thermophilic neutral protease is measured within the range of 65-95 ℃, the relative activity of the enzyme is plotted against the temperature, as shown in figure 2, the optimal reaction temperature of the thermophilic neutral protease is 80 ℃, and the activity of the enzyme is maintained to be more than 80% within the range of 65-95 ℃.

Detection of protease activity: protease activity was determined using azocasein as substrate. Preparation of azo-casein substrate for this assay: 0.5. 0.5 g azocasein was dissolved in 100 mL, 0.2 mol/L phosphate buffer (pH 7.0) to prepare a substrate solution containing 0.5% azocasein. A substrate solution of 0.1. 0.1 mL was incubated at 75℃for 5 min, followed by addition of an enzyme solution of 0.3. 0.3 mL and reaction at 75℃for 30 min. Then, 0.4 mL of a 0.6mol/L trichloroacetic acid (TCA) solution was added to terminate the reaction, the mixture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was collected and absorbance was measured at 335 and nm by a UV-1601 spectrophotometer. The control group was treated identically with 0.6mol/L TCA prior to the addition of the enzyme solution. Under the above reaction conditions, the enzyme activity unit is defined as the amount of enzyme required to hydrolyze azocasein for 1 min with a change in absorbance value of 0.001, which is 1 enzyme activity unit.

The residual activities of the thermoneutral proteases were measured by the above-mentioned protease activity measurement method by incubating the thermoneutral proteases at a concentration of 0.1. 0.1 mg/mL at 75℃for various periods of time. The result of the heat stability of the thermophilic neutral protease is shown in figure 3, and the residual activity of the thermophilic neutral protease after being incubated at 75 ℃ for 6 h is more than 90%, which indicates that the thermophilic neutral protease has very good heat stability.

2. Optimal reaction pH

The activity of the thermophilic neutral protease is measured at 75 ℃ within the pH range of 6.0-10.5, and the buffer solution is 50 mmol/L Na ₂ HPO ₄ -NaH ₂ PO ₄ Buffer solution (pH 6.0-8.0), tris-HCl buffer solution (pH 8.0-9.0), glycine-NaOH buffer solution (pH 9.0-11.0). The activity-pH curve of the thermophilic neutral protease is shown in fig. 4, the thermophilic neutral protease can effectively catalyze the hydrolysis of casein at the pH of 6.0-10.0, the optimal pH is 7.0, and the residual enzyme activity is more than 80% within the pH range of 6.0-8.0.

Example 3: application of thermophilic neutral protease in degrading protein

1. Heparin sodium produced by degrading casing liquid with thermophilic neutral protease

The reaction system of 10 mL contains 50 mmol/L phosphate buffer solution (pH 7.0), casing solution of 2 mL pig small intestine and 240U thermophilic neutral protease (amino acid sequence is shown as SEQ ID No. 2), and the reaction system is subjected to shaking reaction at 75 ℃ and 120 rpm for 0.5 h and 2 h, and the sodium heparin content is detected by using a azure A kit for sampling. The control group was not added with enzyme and the other conditions were identical to the experimental group. Commercial enzyme neutral protease and P2000 alkaline protease are compared, wherein the reaction system and the enzyme dosage of the neutral protease are the same as those of the thermophilic neutral protease, and the neutral protease reacts at 40 ℃; the buffer used for P2000 was glycine-NaOH (pH 10.0) at 50 mmol/L and reacted at 50 ℃. The results of the heparin sodium titers plotted against the three proteases are shown in FIG. 5.

2. Production of soybean polypeptide by degrading soybean meal with thermophilic neutral protease

The reaction of degrading soybean meal by thermophilic neutral protease to produce soybean polypeptide: pulverizing large-particle soybean meal with a wall breaking machine, sieving with a 100 mesh sieve to remove large particles, and continuously pulverizing for 10 min to obtain soybean meal powder. The enzymolysis system is 50 mL phosphate buffer (pH 7.0), contains soybean meal powder with a final concentration of 2.5% (m/v) and 1500U thermophilic neutral protease (amino acid sequence shown as SEQ ID No. 2), and is subjected to oscillation reaction at 75deg.C and 150 rpm for 3 h. Antioxidant activity of enzymatic hydrolysis to produce soybean polypeptide by detecting the clearance rate of the enzymatic hydrolysis product to DPPH (2, 2-Diphenyl-1-picrylhydrazyl, 2-Diphenyl-1-picrylhydrazyl) free radical, the following specific reactions are carried out: 200 mu L of enzymolysis product is taken, 400 mu L of 0.1 mmol/L DPPH solution is added, the reaction is carried out at room temperature for 30 min in a dark place, and the absorbance value of 517 and nm is detected. The control group was identical to the experimental group except that no enzyme was added. Commercial enzyme neutral protease and P2000 alkaline protease are compared, wherein the reaction system and the enzyme dosage of the neutral protease are the same as those of the thermophilic neutral protease, and the neutral protease reacts at 40 ℃; the buffer used for P2000 was glycine-NaOH (pH 10.0) at 50 mmol/L and reacted at 50 ℃. The results of the DDPH patterns for the three enzymatic hydrolysis products are shown in FIG. 6, and show that the soybean polypeptide produced by degrading soybean meal by thermophilic neutral protease has the strongest antioxidant activity.

Centrifuging the product of degrading soybean meal by using the thermophilic neutral protease at 4000 rpm for 10 min by using an ultrafiltration tube with a molecular weight cut-off of 30 kDa, wherein the supernatant is a polypeptide component with a molecular weight of >30 kDa; centrifuging the filtrate with ultrafiltration tube with molecular weight cut-off of 10 kDa, and collecting supernatant with 10-30 kDa polypeptide component; and centrifuging the filtrate by using an ultrafiltration tube with a molecular weight cutoff of 3 kDa, wherein the supernatant is a 3-10 kDa polypeptide component, and the filtrate is a <3 kDa polypeptide component. The clearance of DDPH from the four fractions was determined using the method described above and the antioxidant activity of the different polypeptide fractions was analyzed, as shown in fig. 7, with the antioxidant activity of the <3 kDa polypeptide fraction being strongest.

3. Use of thermophilic neutral proteases in detergents

(1) Compatibility of thermophilic neutral proteases with surfactants and bleaching agents

Surfactant and bleaching agent are added into the detergent to enhance the washing effect, and compatibility experiment of the thermophilic neutral protease and the surfactant and the bleaching agent: 1% or 5% (v/v) of surfactants SDS, DMSO, tween 20, tween 80 and triton X-100, bleaching agents such as hydrogen peroxide and sodium perborate, were added to the thermophilic neutral protease (amino acid sequence shown in SEQ ID No. 2), respectively, and the mixture was allowed to stand at room temperature for 0.5. 0.5 h to examine the residual activity of the thermophilic neutral protease, and the result is shown in FIG. 8. The method for measuring the enzyme activity is shown in example 1.

(2) Compatibility of thermophilic neutral protease with detergent

Six liquid detergents of the delicate, super-energy, blue moon, white, eliminating stains and green waves are respectively heat treated at 100 ℃ for 1 h, and the original enzyme preparation in the detergent is thoroughly inactivated. The residual activity of the thermophilic neutral protease was measured by adding 1% (v/v) of the treated detergent to the thermophilic neutral protease, mixing the mixture and standing the mixture at room temperature for 0.5. 0.5 h, and the result is shown in FIG. 9. The method for measuring the enzyme activity is shown in example 1.

(3) Effects of thermophilic neutral protease on washing blood stains

The white cloth was cut into square pieces of 3 cm ×3 cm for use. Taking 300 mu L of pig blood, placing 100 mu L of pig blood at the center of a white cloth block each time, placing the pig blood in a 37 ℃ incubator, standing for 20 min, drying, repeating for three times, and preparing blood stain cloth. The delicate detergent is heat treated at 100 ℃ for 1 h, and the original enzyme preparation in the detergent is inactivated. The treated detergent was immersed in 10 mL (v/v) phosphate buffer (pH 7.0) at a final concentration of 1% (v/v) and 240U thermophilic neutral protease (amino acid sequence shown in SEQ ID No. 2) to wash the blood stain cloth at 60℃and 120 rpm for 20 minutes, and the washing effect was observed, and the result is shown in FIG. 10. The control group was the same as the experimental group except that the thermophilic protease was not added.

The present disclosure is believed to be of the best use of the invention by those skilled in the art. Accordingly, the foregoing preferred embodiments should be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

<110> Jilin university

<120> a recombinant thermophilic neutral protease and its use for degrading proteins

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1407

<212> DNA

<213> Thermus thermophilus HB8

<220>

<221> CDS

<222> (1)..(1407)

<220>

<221> aprE SP

<222> (1)..(87)

<220>

<221> thermophilic neutral protease

<222> (88)..(1407)

<400> 1

atg aga agc aaa aaa ttg tgg atc agc ttg ttg ttt gcg tta acg tta 48

Met Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu

1 5 10 15

atc ttt acg atg gcg ttc agc aac atg tct gtg cag gct gcg gcc ggt 96

Ile Phe Thr Met Ala Phe Ser Asn Met Ser Val Gln Ala Ala Ala Gly

20 25 30

gca cat atg gag ctc ccc cag acc cca ccg ccg ccc gtg aac ccc gcc 144

Ala His Met Glu Leu Pro Gln Thr Pro Pro Pro Pro Val Asn Pro Ala

35 40 45

gag tgc ccg gta ggt ccc ctg cgg gtg cag agc ctg gat gct cct tct 192

Glu Cys Pro Val Gly Pro Leu Arg Val Gln Ser Leu Asp Ala Pro Ser

50 55 60

aag ctg cac ggt ttg gga agc ttt aaa ggg gag ttc gtt ccg gga gaa 240

Lys Leu His Gly Leu Gly Ser Phe Lys Gly Glu Phe Val Pro Gly Glu

65 70 75 80

ctc att gta gtg ccc aaa cca ggt ctt tcc ctt cag agc ttg cgg gcc 288

Leu Ile Val Val Pro Lys Pro Gly Leu Ser Leu Gln Ser Leu Arg Ala

85 90 95

tca gga gta gag ccc cag gcc cag ctc gcc ctg gac gta atc aag gtg 336

Ser Gly Val Glu Pro Gln Ala Gln Leu Ala Leu Asp Val Ile Lys Val

100 105 110

aag gtt ccc cat ggg gag gag aaa gtc cga gcg gaa gct ctt ttg cgg 384

Lys Val Pro His Gly Glu Glu Lys Val Arg Ala Glu Ala Leu Leu Arg

115 120 125

gcg ggt gct cag tat gtc cag ccc aac tac gtt tac cgg cct ttg cgg 432

Ala Gly Ala Gln Tyr Val Gln Pro Asn Tyr Val Tyr Arg Pro Leu Arg

130 135 140

gct ccg aat gac ctc tat tac ccc gat caa agc gcc tac ttg aat cgg 480

Ala Pro Asn Asp Leu Tyr Tyr Pro Asp Gln Ser Ala Tyr Leu Asn Arg

145 150 155 160

ttg gtg cgc tta gaa agc gct tgg gac ttc agc aca ggc agg gga tgc 528

Leu Val Arg Leu Glu Ser Ala Trp Asp Phe Ser Thr Gly Arg Gly Cys

165 170 175

ccg ccc ctt gtg gcc gtg cta gac acg gga gtt ctt gcc cac gag gac 576

Pro Pro Leu Val Ala Val Leu Asp Thr Gly Val Leu Ala His Glu Asp

180 185 190

ttt cag gcc agc aag tac ctc ccc gcc ggg gtt aac ctg gac gtg gct 624

Phe Gln Ala Ser Lys Tyr Leu Pro Ala Gly Val Asn Leu Asp Val Ala

195 200 205

gac gga gat gcc aat ccc acg gac gac tcg gct ccc aac aat tgg ggg 672

Asp Gly Asp Ala Asn Pro Thr Asp Asp Ser Ala Pro Asn Asn Trp Gly

210 215 220

cat ggt tta gag gtg gcc tcg gtc ttg ggg gcg gat acc aac aac tct 720

His Gly Leu Glu Val Ala Ser Val Leu Gly Ala Asp Thr Asn Asn Ser

225 230 235 240

aag gga ata gca gga act acc tgg ggt gga tac gtt gtt cca atc aag 768

Lys Gly Ile Ala Gly Thr Thr Trp Gly Gly Tyr Val Val Pro Ile Lys

245 250 255

gtt ttc tac cgg ggt ggt gga gcc acg tat gaa acc ctt ttc aag ggg 816

Val Phe Tyr Arg Gly Gly Gly Ala Thr Tyr Glu Thr Leu Phe Lys Gly

260 265 270

gtt cgg tta gcc cgc caa ctg ggg gcc cag gtc atc aac att tcg ctg 864

Val Arg Leu Ala Arg Gln Leu Gly Ala Gln Val Ile Asn Ile Ser Leu

275 280 285

ggg ggt aac gac tat gac gag gtt ctg gat gag gag ctg gcc cgg gct 912

Gly Gly Asn Asp Tyr Asp Glu Val Leu Asp Glu Glu Leu Ala Arg Ala

290 295 300

cgg aac gag ggg agg gtt att gta gct gcg gcg gga aac tac gag acc 960

Arg Asn Glu Gly Arg Val Ile Val Ala Ala Ala Gly Asn Tyr Glu Thr

305 310 315 320

ggg aat ggg gga ccg gtt atg ttc cct gcc agc agc ccc aac act ctc 1008

Gly Asn Gly Gly Pro Val Met Phe Pro Ala Ser Ser Pro Asn Thr Leu

325 330 335

gct gtg ggt gcg gta gat ctc ctt aaa agg cgg gcg aat ttt tcg gcc 1056

Ala Val Gly Ala Val Asp Leu Leu Lys Arg Arg Ala Asn Phe Ser Ala

340 345 350

tat ggc ccc gag ctt gac cta atg gct cca ggg gtg gag gtt ttg gcg 1104

Tyr Gly Pro Glu Leu Asp Leu Met Ala Pro Gly Val Glu Val Leu Ala

355 360 365

gca ggc cct tca ggc aac tat cgc ttt gtg agc ggc acc tct ttg gct 1152

Ala Gly Pro Ser Gly Asn Tyr Arg Phe Val Ser Gly Thr Ser Leu Ala

370 375 380

agc ccc atc gtg gcc ggg gtg gtg gcc ctc tac atg agc aag tac gcc 1200

Ser Pro Ile Val Ala Gly Val Val Ala Leu Tyr Met Ser Lys Tyr Ala

385 390 395 400

agc gag cgg aag gcg tgg cct agc ccg gac cag gtc tac caa tgc ctc 1248

Ser Glu Arg Lys Ala Trp Pro Ser Pro Asp Gln Val Tyr Gln Cys Leu

405 410 415

atc aac acc gcc gag gac cta ggg cct tcc ggt tgg gac ccg gaa tac 1296

Ile Asn Thr Ala Glu Asp Leu Gly Pro Ser Gly Trp Asp Pro Glu Tyr

420 425 430

ggc ttc ggc ctg gtc cgg gcc gac cgg gcg atg acg gac acc acc tac 1344

Gly Phe Gly Leu Val Arg Ala Asp Arg Ala Met Thr Asp Thr Thr Tyr

435 440 445

tgc ttc ccc gga tcc gaa ttc aag ctt gtc gac ctg cag tct cat cac 1392

Cys Phe Pro Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser His His

450 455 460

cat cat cac cac taa 1407

His His His His

465

<210> 2

<211> 439

<212> PRT

<213> Thermus thermophilus HB8

<400> 2

Ala Ala Gly Ala His Met Glu Leu Pro Gln Thr Pro Pro Pro Pro Val

1 5 10 15

Asn Pro Ala Glu Cys Pro Val Gly Pro Leu Arg Val Gln Ser Leu Asp

20 25 30

Ala Pro Ser Lys Leu His Gly Leu Gly Ser Phe Lys Gly Glu Phe Val

35 40 45

Pro Gly Glu Leu Ile Val Val Pro Lys Pro Gly Leu Ser Leu Gln Ser

50 55 60

Leu Arg Ala Ser Gly Val Glu Pro Gln Ala Gln Leu Ala Leu Asp Val

65 70 75 80

Ile Lys Val Lys Val Pro His Gly Glu Glu Lys Val Arg Ala Glu Ala

85 90 95

Leu Leu Arg Ala Gly Ala Gln Tyr Val Gln Pro Asn Tyr Val Tyr Arg

100 105 110

Pro Leu Arg Ala Pro Asn Asp Leu Tyr Tyr Pro Asp Gln Ser Ala Tyr

115 120 125

Leu Asn Arg Leu Val Arg Leu Glu Ser Ala Trp Asp Phe Ser Thr Gly

130 135 140

Arg Gly Cys Pro Pro Leu Val Ala Val Leu Asp Thr Gly Val Leu Ala

145 150 155 160

His Glu Asp Phe Gln Ala Ser Lys Tyr Leu Pro Ala Gly Val Asn Leu

165 170 175

Asp Val Ala Asp Gly Asp Ala Asn Pro Thr Asp Asp Ser Ala Pro Asn

180 185 190

Asn Trp Gly His Gly Leu Glu Val Ala Ser Val Leu Gly Ala Asp Thr

195 200 205

Asn Asn Ser Lys Gly Ile Ala Gly Thr Thr Trp Gly Gly Tyr Val Val

210 215 220

Pro Ile Lys Val Phe Tyr Arg Gly Gly Gly Ala Thr Tyr Glu Thr Leu

225 230 235 240

Phe Lys Gly Val Arg Leu Ala Arg Gln Leu Gly Ala Gln Val Ile Asn

245 250 255

Ile Ser Leu Gly Gly Asn Asp Tyr Asp Glu Val Leu Asp Glu Glu Leu

260 265 270

Ala Arg Ala Arg Asn Glu Gly Arg Val Ile Val Ala Ala Ala Gly Asn

275 280 285

Tyr Glu Thr Gly Asn Gly Gly Pro Val Met Phe Pro Ala Ser Ser Pro

290 295 300

Asn Thr Leu Ala Val Gly Ala Val Asp Leu Leu Lys Arg Arg Ala Asn

305 310 315 320

Phe Ser Ala Tyr Gly Pro Glu Leu Asp Leu Met Ala Pro Gly Val Glu

325 330 335

Val Leu Ala Ala Gly Pro Ser Gly Asn Tyr Arg Phe Val Ser Gly Thr

340 345 350

Ser Leu Ala Ser Pro Ile Val Ala Gly Val Val Ala Leu Tyr Met Ser

355 360 365

Lys Tyr Ala Ser Glu Arg Lys Ala Trp Pro Ser Pro Asp Gln Val Tyr

370 375 380

Gln Cys Leu Ile Asn Thr Ala Glu Asp Leu Gly Pro Ser Gly Trp Asp

385 390 395 400

Pro Glu Tyr Gly Phe Gly Leu Val Arg Ala Asp Arg Ala Met Thr Asp

405 410 415

Thr Thr Tyr Cys Phe Pro Gly Ser Glu Phe Lys Leu Val Asp Leu Gln

420 425 430

Ser His His His His His His

435

<210> 3

<211> 1392

<212> DNA

<213> Thermus thermophilus HB8

<220>

<221> CDS

<222> (1)..(1392)

<220>

<221> yoaW SP

<222> (1)..(72)

<220>

<221> thermophilic neutral protease

<222> (73)..(1392)

<400> 3

atg aaa aag atg ttg atg tta gct ttt aca ttt ctt ttg gct ttg act 48

Met Lys Lys Met Leu Met Leu Ala Phe Thr Phe Leu Leu Ala Leu Thr

1 5 10 15

atc cat gta ggg gaa gct tcg gct gcg gcc ggt gca cat atg gag ctc 96

Ile His Val Gly Glu Ala Ser Ala Ala Ala Gly Ala His Met Glu Leu

20 25 30

ccc cag acc cca ccg ccg ccc gtg aac ccc gcc gag tgc ccg gta ggt 144

Pro Gln Thr Pro Pro Pro Pro Val Asn Pro Ala Glu Cys Pro Val Gly

35 40 45

ccc ctg cgg gtg cag agc ctg gat gct cct tct aag ctg cac ggt ttg 192

Pro Leu Arg Val Gln Ser Leu Asp Ala Pro Ser Lys Leu His Gly Leu

50 55 60

gga agc ttt aaa ggg gag ttc gtt ccg gga gaa ctc att gta gtg ccc 240

Gly Ser Phe Lys Gly Glu Phe Val Pro Gly Glu Leu Ile Val Val Pro

65 70 75 80

aaa cca ggt ctt tcc ctt cag agc ttg cgg gcc tca gga gta gag ccc 288

Lys Pro Gly Leu Ser Leu Gln Ser Leu Arg Ala Ser Gly Val Glu Pro

85 90 95

cag gcc cag ctc gcc ctg gac gta atc aag gtg aag gtt ccc cat ggg 336

Gln Ala Gln Leu Ala Leu Asp Val Ile Lys Val Lys Val Pro His Gly

100 105 110

gag gag aaa gtc cga gcg gaa gct ctt ttg cgg gcg ggt gct cag tat 384

Glu Glu Lys Val Arg Ala Glu Ala Leu Leu Arg Ala Gly Ala Gln Tyr

115 120 125

gtc cag ccc aac tac gtt tac cgg cct ttg cgg gct ccg aat gac ctc 432

Val Gln Pro Asn Tyr Val Tyr Arg Pro Leu Arg Ala Pro Asn Asp Leu

130 135 140

tat tac ccc gat caa agc gcc tac ttg aat cgg ttg gtg cgc tta gaa 480

Tyr Tyr Pro Asp Gln Ser Ala Tyr Leu Asn Arg Leu Val Arg Leu Glu

145 150 155 160

agc gct tgg gac ttc agc aca ggc agg gga tgc ccg ccc ctt gtg gcc 528

Ser Ala Trp Asp Phe Ser Thr Gly Arg Gly Cys Pro Pro Leu Val Ala

165 170 175

gtg cta gac acg gga gtt ctt gcc cac gag gac ttt cag gcc agc aag 576

Val Leu Asp Thr Gly Val Leu Ala His Glu Asp Phe Gln Ala Ser Lys

180 185 190

tac ctc ccc gcc ggg gtt aac ctg gac gtg gct gac gga gat gcc aat 624

Tyr Leu Pro Ala Gly Val Asn Leu Asp Val Ala Asp Gly Asp Ala Asn

195 200 205

ccc acg gac gac tcg gct ccc aac aat tgg ggg cat ggt tta gag gtg 672

Pro Thr Asp Asp Ser Ala Pro Asn Asn Trp Gly His Gly Leu Glu Val

210 215 220

gcc tcg gtc ttg ggg gcg gat acc aac aac tct aag gga ata gca gga 720

Ala Ser Val Leu Gly Ala Asp Thr Asn Asn Ser Lys Gly Ile Ala Gly

225 230 235 240

act acc tgg ggt gga tac gtt gtt cca atc aag gtt ttc tac cgg ggt 768

Thr Thr Trp Gly Gly Tyr Val Val Pro Ile Lys Val Phe Tyr Arg Gly

245 250 255

ggt gga gcc acg tat gaa acc ctt ttc aag ggg gtt cgg tta gcc cgc 816

Gly Gly Ala Thr Tyr Glu Thr Leu Phe Lys Gly Val Arg Leu Ala Arg

260 265 270

caa ctg ggg gcc cag gtc atc aac att tcg ctg ggg ggt aac gac tat 864

Gln Leu Gly Ala Gln Val Ile Asn Ile Ser Leu Gly Gly Asn Asp Tyr

275 280 285

gac gag gtt ctg gat gag gag ctg gcc cgg gct cgg aac gag ggg agg 912

Asp Glu Val Leu Asp Glu Glu Leu Ala Arg Ala Arg Asn Glu Gly Arg

290 295 300

gtt att gta gct gcg gcg gga aac tac gag acc ggg aat ggg gga ccg 960

Val Ile Val Ala Ala Ala Gly Asn Tyr Glu Thr Gly Asn Gly Gly Pro

305 310 315 320

gtt atg ttc cct gcc agc agc ccc aac act ctc gct gtg ggt gcg gta 1008

Val Met Phe Pro Ala Ser Ser Pro Asn Thr Leu Ala Val Gly Ala Val

325 330 335

gat ctc ctt aaa agg cgg gcg aat ttt tcg gcc tat ggc ccc gag ctt 1056

Asp Leu Leu Lys Arg Arg Ala Asn Phe Ser Ala Tyr Gly Pro Glu Leu

340 345 350

gac cta atg gct cca ggg gtg gag gtt ttg gcg gca ggc cct tca ggc 1104

Asp Leu Met Ala Pro Gly Val Glu Val Leu Ala Ala Gly Pro Ser Gly

355 360 365

aac tat cgc ttt gtg agc ggc acc tct ttg gct agc ccc atc gtg gcc 1152

Asn Tyr Arg Phe Val Ser Gly Thr Ser Leu Ala Ser Pro Ile Val Ala

370 375 380

ggg gtg gtg gcc ctc tac atg agc aag tac gcc agc gag cgg aag gcg 1200

Gly Val Val Ala Leu Tyr Met Ser Lys Tyr Ala Ser Glu Arg Lys Ala

385 390 395 400

tgg cct agc ccg gac cag gtc tac caa tgc ctc atc aac acc gcc gag 1248

Trp Pro Ser Pro Asp Gln Val Tyr Gln Cys Leu Ile Asn Thr Ala Glu

405 410 415

gac cta ggg cct tcc ggt tgg gac ccg gaa tac ggc ttc ggc ctg gtc 1296

Asp Leu Gly Pro Ser Gly Trp Asp Pro Glu Tyr Gly Phe Gly Leu Val

420 425 430

cgg gcc gac cgg gcg atg acg gac acc acc tac tgc ttc ccc gga tcc 1344

Arg Ala Asp Arg Ala Met Thr Asp Thr Thr Tyr Cys Phe Pro Gly Ser

435 440 445

gaa ttc aag ctt gtc gac ctg cag tct cat cac cat cat cac cac taa 1392

Glu Phe Lys Leu Val Asp Leu Gln Ser His His His His His His

450 455 460

<210> 4

<211> 1398

<212> DNA

<213> Thermus thermophilus HB8

<220>

<221> CDS

<222> (1)..(1398)

<220>

<221> ykwD SP

<222> (1)..(78)

<220>

<221> thermophilic neutral protease

<222> (79)..(1398)

<400> 4

atg aag aaa gca ttt att tta tct gct gcc gct gcg gtt gga tta ttc 48

Met Lys Lys Ala Phe Ile Leu Ser Ala Ala Ala Ala Val Gly Leu Phe

1 5 10 15

aca ttc ggg ggc gta cag caa gca tca gcg gcg gcc ggt gca cat atg 96

Thr Phe Gly Gly Val Gln Gln Ala Ser Ala Ala Ala Gly Ala His Met

20 25 30

gag ctc ccc cag acc cca ccg ccg ccc gtg aac ccc gcc gag tgc ccg 144

Glu Leu Pro Gln Thr Pro Pro Pro Pro Val Asn Pro Ala Glu Cys Pro

35 40 45

gta ggt ccc ctg cgg gtg cag agc ctg gat gct cct tct aag ctg cac 192

Val Gly Pro Leu Arg Val Gln Ser Leu Asp Ala Pro Ser Lys Leu His

50 55 60

ggt ttg gga agc ttt aaa ggg gag ttc gtt ccg gga gaa ctc att gta 240

Gly Leu Gly Ser Phe Lys Gly Glu Phe Val Pro Gly Glu Leu Ile Val

65 70 75 80

gtg ccc aaa cca ggt ctt tcc ctt cag agc ttg cgg gcc tca gga gta 288

Val Pro Lys Pro Gly Leu Ser Leu Gln Ser Leu Arg Ala Ser Gly Val

85 90 95

gag ccc cag gcc cag ctc gcc ctg gac gta atc aag gtg aag gtt ccc 336

Glu Pro Gln Ala Gln Leu Ala Leu Asp Val Ile Lys Val Lys Val Pro

100 105 110

cat ggg gag gag aaa gtc cga gcg gaa gct ctt ttg cgg gcg ggt gct 384

His Gly Glu Glu Lys Val Arg Ala Glu Ala Leu Leu Arg Ala Gly Ala

115 120 125

cag tat gtc cag ccc aac tac gtt tac cgg cct ttg cgg gct ccg aat 432

Gln Tyr Val Gln Pro Asn Tyr Val Tyr Arg Pro Leu Arg Ala Pro Asn

130 135 140

gac ctc tat tac ccc gat caa agc gcc tac ttg aat cgg ttg gtg cgc 480

Asp Leu Tyr Tyr Pro Asp Gln Ser Ala Tyr Leu Asn Arg Leu Val Arg

145 150 155 160

tta gaa agc gct tgg gac ttc agc aca ggc agg gga tgc ccg ccc ctt 528

Leu Glu Ser Ala Trp Asp Phe Ser Thr Gly Arg Gly Cys Pro Pro Leu

165 170 175

gtg gcc gtg cta gac acg gga gtt ctt gcc cac gag gac ttt cag gcc 576

Val Ala Val Leu Asp Thr Gly Val Leu Ala His Glu Asp Phe Gln Ala

180 185 190

agc aag tac ctc ccc gcc ggg gtt aac ctg gac gtg gct gac gga gat 624

Ser Lys Tyr Leu Pro Ala Gly Val Asn Leu Asp Val Ala Asp Gly Asp

195 200 205

gcc aat ccc acg gac gac tcg gct ccc aac aat tgg ggg cat ggt tta 672

Ala Asn Pro Thr Asp Asp Ser Ala Pro Asn Asn Trp Gly His Gly Leu

210 215 220

gag gtg gcc tcg gtc ttg ggg gcg gat acc aac aac tct aag gga ata 720

Glu Val Ala Ser Val Leu Gly Ala Asp Thr Asn Asn Ser Lys Gly Ile

225 230 235 240

gca gga act acc tgg ggt gga tac gtt gtt cca atc aag gtt ttc tac 768

Ala Gly Thr Thr Trp Gly Gly Tyr Val Val Pro Ile Lys Val Phe Tyr

245 250 255

cgg ggt ggt gga gcc acg tat gaa acc ctt ttc aag ggg gtt cgg tta 816

Arg Gly Gly Gly Ala Thr Tyr Glu Thr Leu Phe Lys Gly Val Arg Leu

260 265 270

gcc cgc caa ctg ggg gcc cag gtc atc aac att tcg ctg ggg ggt aac 864

Ala Arg Gln Leu Gly Ala Gln Val Ile Asn Ile Ser Leu Gly Gly Asn

275 280 285

gac tat gac gag gtt ctg gat gag gag ctg gcc cgg gct cgg aac gag 912

Asp Tyr Asp Glu Val Leu Asp Glu Glu Leu Ala Arg Ala Arg Asn Glu

290 295 300

ggg agg gtt att gta gct gcg gcg gga aac tac gag acc ggg aat ggg 960

Gly Arg Val Ile Val Ala Ala Ala Gly Asn Tyr Glu Thr Gly Asn Gly

305 310 315 320

gga ccg gtt atg ttc cct gcc agc agc ccc aac act ctc gct gtg ggt 1008

Gly Pro Val Met Phe Pro Ala Ser Ser Pro Asn Thr Leu Ala Val Gly

325 330 335

gcg gta gat ctc ctt aaa agg cgg gcg aat ttt tcg gcc tat ggc ccc 1056

Ala Val Asp Leu Leu Lys Arg Arg Ala Asn Phe Ser Ala Tyr Gly Pro

340 345 350

gag ctt gac cta atg gct cca ggg gtg gag gtt ttg gcg gca ggc cct 1104

Glu Leu Asp Leu Met Ala Pro Gly Val Glu Val Leu Ala Ala Gly Pro

355 360 365

tca ggc aac tat cgc ttt gtg agc ggc acc tct ttg gct agc ccc atc 1152

Ser Gly Asn Tyr Arg Phe Val Ser Gly Thr Ser Leu Ala Ser Pro Ile

370 375 380

gtg gcc ggg gtg gtg gcc ctc tac atg agc aag tac gcc agc gag cgg 1200

Val Ala Gly Val Val Ala Leu Tyr Met Ser Lys Tyr Ala Ser Glu Arg

385 390 395 400

aag gcg tgg cct agc ccg gac cag gtc tac caa tgc ctc atc aac acc 1248

Lys Ala Trp Pro Ser Pro Asp Gln Val Tyr Gln Cys Leu Ile Asn Thr

405 410 415

gcc gag gac cta ggg cct tcc ggt tgg gac ccg gaa tac ggc ttc ggc 1296

Ala Glu Asp Leu Gly Pro Ser Gly Trp Asp Pro Glu Tyr Gly Phe Gly

420 425 430

ctg gtc cgg gcc gac cgg gcg atg acg gac acc acc tac tgc ttc ccc 1344

Leu Val Arg Ala Asp Arg Ala Met Thr Asp Thr Thr Tyr Cys Phe Pro

435 440 445

gga tcc gaa ttc aag ctt gtc gac ctg cag tct cat cac cat cat cac 1392

Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser His His His His His

450 455 460

cac taa 1398

His

465

<210> 5

<211> 1404

<212> DNA

<213> Thermus thermophilus HB8

<220>

<221> CDS

<222> (1)..(1404)

<220>

<221> yurI SP

<222> (1)..(84)

<220>

<221> thermophilic neutral protease

<222> (85)..(1404)

<400> 5

atg aca aaa aaa gca tgg ttt ctg ccg ctc gtc tgt gta tta ctg att 48

Met Thr Lys Lys Ala Trp Phe Leu Pro Leu Val Cys Val Leu Leu Ile

1 5 n 10 15

tcc gga tgg ctt gcg cca gca gct tca gca agc gcg gcg gcc ggt gca 96

Ser Gly Trp Leu Ala Pro Ala Ala Ser Ala Ser Ala Ala Ala Gly Ala

20 25 30

cat atg gag ctc ccc cag acc cca ccg ccg ccc gtg aac ccc gcc gag 144

His Met Glu Leu Pro Gln Thr Pro Pro Pro Pro Val Asn Pro Ala Glu

35 40 45

tgc ccg gta ggt ccc ctg cgg gtg cag agc ctg gat gct cct tct aag 192

Cys Pro Val Gly Pro Leu Arg Val Gln Ser Leu Asp Ala Pro Ser Lys

50 55 60

ctg cac ggt ttg gga agc ttt aaa ggg gag ttc gtt ccg gga gaa ctc 240

Leu His Gly Leu Gly Ser Phe Lys Gly Glu Phe Val Pro Gly Glu Leu

65 70 75 80

att gta gtg ccc aaa cca ggt ctt tcc ctt cag agc ttg cgg gcc tca 288

Ile Val Val Pro Lys Pro Gly Leu Ser Leu Gln Ser Leu Arg Ala Ser

85 90 95

gga gta gag ccc cag gcc cag ctc gcc ctg gac gta atc aag gtg aag 336

Gly Val Glu Pro Gln Ala Gln Leu Ala Leu Asp Val Ile Lys Val Lys

100 105 110

gtt ccc cat ggg gag gag aaa gtc cga gcg gaa gct ctt ttg cgg gcg 384

Val Pro His Gly Glu Glu Lys Val Arg Ala Glu Ala Leu Leu Arg Ala

115 120 125

ggt gct cag tat gtc cag ccc aac tac gtt tac cgg cct ttg cgg gct 432

Gly Ala Gln Tyr Val Gln Pro Asn Tyr Val Tyr Arg Pro Leu Arg Ala

130 135 140

ccg aat gac ctc tat tac ccc gat caa agc gcc tac ttg aat cgg ttg 480

Pro Asn Asp Leu Tyr Tyr Pro Asp Gln Ser Ala Tyr Leu Asn Arg Leu

145 150 155 160

gtg cgc tta gaa agc gct tgg gac ttc agc aca ggc agg gga tgc ccg 528

Val Arg Leu Glu Ser Ala Trp Asp Phe Ser Thr Gly Arg Gly Cys Pro

165 170 175

ccc ctt gtg gcc gtg cta gac acg gga gtt ctt gcc cac gag gac ttt 576

Pro Leu Val Ala Val Leu Asp Thr Gly Val Leu Ala His Glu Asp Phe

180 185 190

cag gcc agc aag tac ctc ccc gcc ggg gtt aac ctg gac gtg gct gac 624

Gln Ala Ser Lys Tyr Leu Pro Ala Gly Val Asn Leu Asp Val Ala Asp

195 200 205

gga gat gcc aat ccc acg gac gac tcg gct ccc aac aat tgg ggg cat 672

Gly Asp Ala Asn Pro Thr Asp Asp Ser Ala Pro Asn Asn Trp Gly His

210 215 220

ggt tta gag gtg gcc tcg gtc ttg ggg gcg gat acc aac aac tct aag 720

Gly Leu Glu Val Ala Ser Val Leu Gly Ala Asp Thr Asn Asn Ser Lys

225 230 235 240

gga ata gca gga act acc tgg ggt gga tac gtt gtt cca atc aag gtt 768

Gly Ile Ala Gly Thr Thr Trp Gly Gly Tyr Val Val Pro Ile Lys Val

245 250 255

ttc tac cgg ggt ggt gga gcc acg tat gaa acc ctt ttc aag ggg gtt 816

Phe Tyr Arg Gly Gly Gly Ala Thr Tyr Glu Thr Leu Phe Lys Gly Val

260 265 270

cgg tta gcc cgc caa ctg ggg gcc cag gtc atc aac att tcg ctg ggg 864

Arg Leu Ala Arg Gln Leu Gly Ala Gln Val Ile Asn Ile Ser Leu Gly

275 280 285

ggt aac gac tat gac gag gtt ctg gat gag gag ctg gcc cgg gct cgg 912

Gly Asn Asp Tyr Asp Glu Val Leu Asp Glu Glu Leu Ala Arg Ala Arg

290 295 300

aac gag ggg agg gtt att gta gct gcg gcg gga aac tac gag acc ggg 960

Asn Glu Gly Arg Val Ile Val Ala Ala Ala Gly Asn Tyr Glu Thr Gly

305 310 315 320

aat ggg gga ccg gtt atg ttc cct gcc agc agc ccc aac act ctc gct 1008

Asn Gly Gly Pro Val Met Phe Pro Ala Ser Ser Pro Asn Thr Leu Ala

325 330 335

gtg ggt gcg gta gat ctc ctt aaa agg cgg gcg aat ttt tcg gcc tat 1056

Val Gly Ala Val Asp Leu Leu Lys Arg Arg Ala Asn Phe Ser Ala Tyr

340 345 350

ggc ccc gag ctt gac cta atg gct cca ggg gtg gag gtt ttg gcg gca 1104

Gly Pro Glu Leu Asp Leu Met Ala Pro Gly Val Glu Val Leu Ala Ala

355 360 365

ggc cct tca ggc aac tat cgc ttt gtg agc ggc acc tct ttg gct agc 1152

Gly Pro Ser Gly Asn Tyr Arg Phe Val Ser Gly Thr Ser Leu Ala Ser

370 375 380

ccc atc gtg gcc ggg gtg gtg gcc ctc tac atg agc aag tac gcc agc 1200

Pro Ile Val Ala Gly Val Val Ala Leu Tyr Met Ser Lys Tyr Ala Ser

385 390 395 400

gag cgg aag gcg tgg cct agc ccg gac cag gtc tac caa tgc ctc atc 1248

Glu Arg Lys Ala Trp Pro Ser Pro Asp Gln Val Tyr Gln Cys Leu Ile

405 410 415

aac acc gcc gag gac cta ggg cct tcc ggt tgg gac ccg gaa tac ggc 1296

Asn Thr Ala Glu Asp Leu Gly Pro Ser Gly Trp Asp Pro Glu Tyr Gly

420 425 430

ttc ggc ctg gtc cgg gcc gac cgg gcg atg acg gac acc acc tac tgc 1344

Phe Gly Leu Val Arg Ala Asp Arg Ala Met Thr Asp Thr Thr Tyr Cys

435 440 445

ttc ccc gga tcc gaa ttc aag ctt gtc gac ctg cag tct cat cac cat 1392

Phe Pro Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser His His His

450 455 460

cat cac cac taa 1404

His His His

465

<210> 6

<211> 1431

<212> DNA

<213> Thermus thermophilus HB8

<220>

<221> CDS

<222> (1)..(1431)

<220>

<221> yrrS SP

<222> (1)..(111)

<220>

<221> thermophilic neutral protease

<222> (112)..(1431)

<400> 6

atg agc aat aat caa tct cgt tat gaa aat cgt gat aaa cgc aga aaa 48

Met Ser Asn Asn Gln Ser Arg Tyr Glu Asn Arg Asp Lys Arg Arg Lys

1 5 10 15

gcc aat tta gtg ctt aac att tta atc gca atc gta tcc ata cta att 96

Ala Asn Leu Val Leu Asn Ile Leu Ile Ala Ile Val Ser Ile Leu Ile

20 25 30

gtc gta gta gca gcg gcg gcc ggt gca cat atg gag ctc ccc cag acc 144

Val Val Val Ala Ala Ala Ala Gly Ala His Met Glu Leu Pro Gln Thr

35 40 45

cca ccg ccg ccc gtg aac ccc gcc gag tgc ccg gta ggt ccc ctg cgg 192

Pro Pro Pro Pro Val Asn Pro Ala Glu Cys Pro Val Gly Pro Leu Arg

50 55 60

gtg cag agc ctg gat gct cct tct aag ctg cac ggt ttg gga agc ttt 240

Val Gln Ser Leu Asp Ala Pro Ser Lys Leu His Gly Leu Gly Ser Phe

65 70 75 80

aaa ggg gag ttc gtt ccg gga gaa ctc att gta gtg ccc aaa cca ggt 288

Lys Gly Glu Phe Val Pro Gly Glu Leu Ile Val Val Pro Lys Pro Gly

85 90 95

ctt tcc ctt cag agc ttg cgg gcc tca gga gta gag ccc cag gcc cag 336

Leu Ser Leu Gln Ser Leu Arg Ala Ser Gly Val Glu Pro Gln Ala Gln

100 105 110

ctc gcc ctg gac gta atc aag gtg aag gtt ccc cat ggg gag gag aaa 384

Leu Ala Leu Asp Val Ile Lys Val Lys Val Pro His Gly Glu Glu Lys

115 120 125

gtc cga gcg gaa gct ctt ttg cgg gcg ggt gct cag tat gtc cag ccc 432

Val Arg Ala Glu Ala Leu Leu Arg Ala Gly Ala Gln Tyr Val Gln Pro

130 135 140

aac tac gtt tac cgg cct ttg cgg gct ccg aat gac ctc tat tac ccc 480

Asn Tyr Val Tyr Arg Pro Leu Arg Ala Pro Asn Asp Leu Tyr Tyr Pro

145 150 155 160

gat caa agc gcc tac ttg aat cgg ttg gtg cgc tta gaa agc gct tgg 528

Asp Gln Ser Ala Tyr Leu Asn Arg Leu Val Arg Leu Glu Ser Ala Trp

165 170 175

gac ttc agc aca ggc agg gga tgc ccg ccc ctt gtg gcc gtg cta gac 576

Asp Phe Ser Thr Gly Arg Gly Cys Pro Pro Leu Val Ala Val Leu Asp

180 185 190

acg gga gtt ctt gcc cac gag gac ttt cag gcc agc aag tac ctc ccc 624

Thr Gly Val Leu Ala His Glu Asp Phe Gln Ala Ser Lys Tyr Leu Pro

195 200 205

gcc ggg gtt aac ctg gac gtg gct gac gga gat gcc aat ccc acg gac 672

Ala Gly Val Asn Leu Asp Val Ala Asp Gly Asp Ala Asn Pro Thr Asp

210 215 220

gac tcg gct ccc aac aat tgg ggg cat ggt tta gag gtg gcc tcg gtc 720

Asp Ser Ala Pro Asn Asn Trp Gly His Gly Leu Glu Val Ala Ser Val

225 230 235 240

ttg ggg gcg gat acc aac aac tct aag gga ata gca gga act acc tgg 768

Leu Gly Ala Asp Thr Asn Asn Ser Lys Gly Ile Ala Gly Thr Thr Trp

245 250 255

ggt gga tac gtt gtt cca atc aag gtt ttc tac cgg ggt ggt gga gcc 816

Gly Gly Tyr Val Val Pro Ile Lys Val Phe Tyr Arg Gly Gly Gly Ala

260 265 270

acg tat gaa acc ctt ttc aag ggg gtt cgg tta gcc cgc caa ctg ggg 864

Thr Tyr Glu Thr Leu Phe Lys Gly Val Arg Leu Ala Arg Gln Leu Gly

275 280 285

gcc cag gtc atc aac att tcg ctg ggg ggt aac gac tat gac gag gtt 912

Ala Gln Val Ile Asn Ile Ser Leu Gly Gly Asn Asp Tyr Asp Glu Val

290 295 300

ctg gat gag gag ctg gcc cgg gct cgg aac gag ggg agg gtt att gta 960

Leu Asp Glu Glu Leu Ala Arg Ala Arg Asn Glu Gly Arg Val Ile Val

305 310 315 320

gct gcg gcg gga aac tac gag acc ggg aat ggg gga ccg gtt atg ttc 1008

Ala Ala Ala Gly Asn Tyr Glu Thr Gly Asn Gly Gly Pro Val Met Phe

325 330 335

cct gcc agc agc ccc aac act ctc gct gtg ggt gcg gta gat ctc ctt 1056

Pro Ala Ser Ser Pro Asn Thr Leu Ala Val Gly Ala Val Asp Leu Leu

340 345 350

aaa agg cgg gcg aat ttt tcg gcc tat ggc ccc gag ctt gac cta atg 1104

Lys Arg Arg Ala Asn Phe Ser Ala Tyr Gly Pro Glu Leu Asp Leu Met

355 360 365

gct cca ggg gtg gag gtt ttg gcg gca ggc cct tca ggc aac tat cgc 1152

Ala Pro Gly Val Glu Val Leu Ala Ala Gly Pro Ser Gly Asn Tyr Arg

370 375 380

ttt gtg agc ggc acc tct ttg gct agc ccc atc gtg gcc ggg gtg gtg 1200

Phe Val Ser Gly Thr Ser Leu Ala Ser Pro Ile Val Ala Gly Val Val

385 390 395 400

gcc ctc tac atg agc aag tac gcc agc gag cgg aag gcg tgg cct agc 1248

Ala Leu Tyr Met Ser Lys Tyr Ala Ser Glu Arg Lys Ala Trp Pro Ser

405 410 415

ccg gac cag gtc tac caa tgc ctc atc aac acc gcc gag gac cta ggg 1296

Pro Asp Gln Val Tyr Gln Cys Leu Ile Asn Thr Ala Glu Asp Leu Gly

420 425 430

cct tcc ggt tgg gac ccg gaa tac ggc ttc ggc ctg gtc cgg gcc gac 1344

Pro Ser Gly Trp Asp Pro Glu Tyr Gly Phe Gly Leu Val Arg Ala Asp

435 440 445

cgg gcg atg acg gac acc acc tac tgc ttc ccc gga tcc gaa ttc aag 1392

Arg Ala Met Thr Asp Thr Thr Tyr Cys Phe Pro Gly Ser Glu Phe Lys

450 455 460

ctt gtc gac ctg cag tct cat cac cat cat cac cac taa 1431

Leu Val Asp Leu Gln Ser His His His His His His

465 470 475

Claims

1. A recombinant thermophilic neutral protease with secretion signal peptide sequence has the amino acid sequence shown in SEQ ID No.1, SEQ ID No.3 or SEQ ID No. 4.

2. The application of recombinant thermophilic neutral protease without secretion signal peptide sequence in decomposing protein is that the recombinant thermophilic neutral protease is secreted by bacillus subtilis in the form of pro-peptide sequence, and has the amino acid sequence shown in SEQ ID No.2 and has protease hydrolysis activity without self-shearing.