CN115260287A - Polypeptide specifically targeting human liver cancer cells and application thereof - Google Patents

Polypeptide specifically targeting human liver cancer cells and application thereof Download PDF

Info

Publication number
CN115260287A
CN115260287A CN202110476153.3A CN202110476153A CN115260287A CN 115260287 A CN115260287 A CN 115260287A CN 202110476153 A CN202110476153 A CN 202110476153A CN 115260287 A CN115260287 A CN 115260287A
Authority
CN
China
Prior art keywords
polypeptide
liver cancer
targeting
cells
human liver
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110476153.3A
Other languages
Chinese (zh)
Inventor
门可
段醒妹
魏于全
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
West China Hospital of Sichuan University
Original Assignee
West China Hospital of Sichuan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by West China Hospital of Sichuan University filed Critical West China Hospital of Sichuan University
Priority to CN202110476153.3A priority Critical patent/CN115260287A/en
Publication of CN115260287A publication Critical patent/CN115260287A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention belongs to the field of biological pharmacy, and particularly relates to a polypeptide specifically targeting human liver cancer cells and application thereof. Aiming at the problems that the existing polypeptide targeting liver cancer has insufficient targeting property in vivo tumor cells and the polypeptide with better targeting property in vivo needs to be developed, the invention provides a liver cancer targeting peptide F11 which is obtained by screening through a phage display technology, and the amino acid sequence is shown as SEQ ID NO. 1. The polypeptide can realize the target affinity effect on HepG2 human liver cancer cells, and in a HepG2 human liver cancer tumor-bearing mouse body, the polypeptide can realize the specific affinity on liver cancer tumor tissues to achieve the target delivery effect. The targeting polypeptide has strong specificity and high targeting property, and has good application potential in the fields of early tumor diagnosis and treatment and targeted therapy.

Description

Polypeptide specifically targeting human liver cancer cells and application thereof
Technical Field
The invention belongs to the field of biological pharmacy, and particularly relates to a polypeptide specifically targeting human liver cancer cells and application thereof.
Background
Tumor treatment technology has been a hotspot and difficulty of medical research. Due to the development of chemotherapeutic drugs and immunotherapy, the success rate of cancer treatment continues to increase. However, the mortality rate of some cancers is still at a high level. Among them, liver cancer is one of the common malignant tumors in our country, and the fatality rate of the malignant tumor in our country is the second highest due to its early stage without obvious symptoms and high degree of malignancy in middle and late stages. Therefore, a new liver cancer targeted therapy strategy needs to be found for improving the liver cancer treatment efficiency and reducing the side effects of the drugs. Meanwhile, aiming at the characteristic that a liver cancer patient is difficult to diagnose in the early stage, the invention of a fluorescent dye marked targeting liver cancer polypeptide developing technology is also a new way for finding a more tiny focus and achieving the purpose of finding early treatment. In conclusion, the search and screening of high affinity polypeptide for liver cancer cells is an effective way to solve the problem of liver cancer treatment.
At present, the method for screening the polypeptide targeting the hepatoma cells mainly utilizes a phage display technology for screening. The phage display technology is a new technology capable of fusing and expressing exogenous peptides or proteins and phage surface proteins. By introducing various foreign genes into the phage, a phage display library expressing various proteins on the surface can be constructed. Aiming at the screening of tumor-targeted antigens, the phage display peptide library and tumor cells are specifically combined for panning, so that the tumor-targeted polypeptide with high specificity and affinity can be screened out. Currently, targeting polypeptides with a certain affinity for hepatoma cells have been screened in the prior art. For example, patent CN101918433A discloses a peptide specifically binding to HCC cells, which is capable of specifically binding to HCC cells. Patent CN201110451767.2 discloses a polypeptide specifically binding to a liver cancer HepG2 cell line, which can target the liver cancer HepG2 cell line, and does not disclose the targeting performance of the targeting polypeptide in vivo.
In the actual screening process of the targeting peptide, some receptor cells are synthesized in vitro or the liver cancer targeting peptide is screened by using tumors in a model mouse, so that the growth environment of the tumors in a liver cancer patient cannot be effectively simulated, and the difference from clinical application is large. Therefore, there is a need to develop liver cancer cell targeting polypeptides with better targeting to liver cancer cells in human body.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: the existing polypeptide targeting liver cancer has insufficient targeting property in vivo tumor cells, and the polypeptide with better in vivo targeting property needs to be developed.
The technical scheme for solving the technical problems comprises the following steps: provides a polypeptide specifically targeting human liver cancer cells. The amino acid sequence of the polypeptide of the specific targeting human liver cancer cell is shown in SEQ ID NO. 1.
Amino acid sequence of polypeptide of SEQ ID NO. 1 specific target human liver cancer cell
FYLEHPSGGLAV。
Wherein, the liver cancer cell targeted by the polypeptide of the specific targeting human liver cancer cell is a HepG2 cell line.
The invention also provides a coding nucleotide.
Wherein, the coding nucleotide can code the polypeptide which can be obtained by the specific targeting human liver cancer cell.
Furthermore, the sequence of the coding nucleotide is shown as SEQ ID NO. 2.
Coding nucleotide sequence of polypeptide of SEQ ID NO 2 specific targeting human liver cancer cell
TTTTATCTGGAACATCCGAGCGGCGGCCTGGCGGTG。
The invention also provides an expression vector.
Furthermore, the expression vector contains nucleotide shown as SEQ ID NO. 2.
Wherein, the expression vector is a prokaryotic vector or a eukaryotic vector.
The invention also provides a host cell.
Furthermore, the host cell contains the polypeptide, the coding nucleotide or the expression vector of the specific target human hepatoma cell.
The invention also provides application of the polypeptide specifically targeting the human liver cancer cell in targeting the liver cancer cell.
Furthermore, the liver cancer cell is a HepG2 cell line.
The invention also provides the application of the polypeptide of the specific target human liver cancer cell in preparing anti-liver cancer drugs or developing agents for diagnosing liver cancer.
Further, in the above use, the polypeptide is formulated into a solution for use at a concentration of 1mg/mL.
Further, in the above use, a buffer is added to the polypeptide solution.
Further, the buffer solution is a mixture of dimethyl sulfoxide buffer solution and HEPES buffer solution.
Further, the volume ratio of the dimethyl sulfoxide buffer solution to the HEPES buffer solution is 1:19.
the invention has the beneficial effects that:
the invention provides a polypeptide capable of specifically targeting a human hepatoma cell HepG2 cell line, which is named as F11 polypeptide and proves that the polypeptide has stronger affinity to HepG2 hepatoma cells in vivo. The targeting polypeptide has high specificity, can specifically target human hepatoma cell HepG2, and has no targeting capability on human LO2 cells and human peripheral blood cells. The targeting polypeptide has strong specificity and high targeting property, and has good application potential in the fields of early tumor diagnosis and treatment and targeted therapy.
Drawings
FIG. 1 shows the chemical structure of the F11 polypeptide of the present invention.
FIG. 2 shows the results of the affinity assay of the F11 polypeptide for different cells in test 1; a represents the fluorescence photographing result; b represents the streaming result.
FIG. 3 is a graph showing the distribution of F11 polypeptides in mice targeting hepatoma cells.
FIG. 4 is a graph showing the effect of F11 polypeptide on immunohistochemical staining in cancer and tissues adjacent to the cancer of a liver cancer patient.
Detailed Description
The invention screens a target polypeptide with strong specificity aiming at liver cancer cells HepG2 by a phage display technology, and the target polypeptide is named as F11 polypeptide. The amino acid sequence of the polypeptide is shown as SEQ ID NO. 1.
The phage peptide libraries screened according to the invention are randomly generated volumesGreater than 109The dodecapeptide library is screened in three rounds to obtain F11 polypeptide. In the screening process, when HepG2 is used for screening, the adsorption cells are also selected for removing the polypeptide with affinity with other cells. This makes the final polypeptide F11 screened by us unable to recognize LO2 and human peripheral blood cells while binding to HepG2 cells.
Furthermore, the invention also provides coding nucleotide, a vector and a host cell of the polypeptide specifically targeting the human liver cancer cell.
Furthermore, the invention also provides application of the polypeptide specifically targeting the human liver cancer cell in targeting the liver cancer cell.
The invention also provides application of the polypeptide specifically targeting human liver cancer cells in preparation of a medicament for preventing or treating liver cancer.
The invention also provides application of the polypeptide specifically targeting the human hepatoma cells in preparing a detection reagent for diagnosing hepatoma.
The polypeptide of the invention specifically targeting human liver cancer cells is obtained by screening by the following method:
human hepatoma cells HepG2 and LO2 cells in good growth state were seeded in 24-well plates. Blocking solution (4% milk + PBS) was added and blocked at 37 ℃ for 1h. The blocking solution was aspirated and washed 3 times with PBS. Mu.l phage pool was mixed with 1ml PBS and incubated with LO2 cells at 37 ℃ for 1h. And then the supernatant is incubated with the closed liver cancer HepG2 cells for 2 hours at 37 ℃. And collecting the phage bound on the cells, amplifying the phage by using ER2738 host bacteria, and using the amplified phage for next screening of HepG 2.
And repeating the operation twice, performing titer determination and identification on the phage obtained by the third round of screening by using an LB/IPTG/X-Gal plate, identifying the screened phage clone strain by using an ELISA technology, and selecting the phage clone strain with an ELISA detection result OD value larger than 0.8 for purification and sequencing to obtain the specific polypeptide F11 capable of identifying HepG 2.
The following examples are intended to illustrate specific embodiments of the present invention without limiting the scope of the invention to the examples.
The preparation method of each reagent in the following examples or experimental examples is as follows:
0.2M Gly-HCl pH2.2: 1.5014g of glycine was weighed, dissolved in water, the pH was adjusted to 2.2 with HCl, and the volume was adjusted to 100mL with water.
1M Tris-HCl pH9.1: 121.1g Tris was weighed, dissolved in water, adjusted to pH9.1 with HCl, and made up to 100mL with water.
20% PEG/2.5M NaCl: after 20g of polyethylene glycol and 14.6g of NaCl are dissolved in water, water is added to the mixture to achieve a constant volume of 100mL.
The rest reagents are common commercial products.
Example 1 HepG2 liver cancer cell screening of phage polypeptide library
Respectively subculturing human hepatoma cells HepG2 and LO2 hepatocytes (from ATCC) in good growth state, inoculating the cells in a 24-well cell culture plate, culturing at 37 ℃ under saturation humidity and 5 CO2 for 24h, then changing the culture solution, culturing until the cells adhere to the wall, ensuring good growth state, ensuring that the fusion degree is more than 90%, sucking the culture medium when the cells are converged into a monolayer, slightly washing the cells twice by PBS, adding a serum-free culture medium, culturing at 37 ℃ under 5 CO2 for 1h, sucking the culture solution, adding a sealing solution (4 mil k + PBS), and sealing at 37 ℃ for 1h; the same operation is repeated to seal the liver cancer cell HepG2 cell. After blocking was complete, the blocking solution was aspirated, washed three times with PBS, and a 10. Mu.l phage pool was mixed with 1ml PBS and incubated with LO2 cells at 37 ℃ for 1h for negative cell adsorption. After the adsorption was completed, the supernatant was aspirated, transferred to a 1.5ml sterile centrifuge tube, centrifuged at 1000rpm for 5min, transferred to a new centrifuge tube, and centrifuged again to remove cells that may be contained in the supernatant. And quickly incubating the supernatant and the sealed and washed liver cancer HepG2 cells for 2h at 37 ℃. After the incubation was completed, the supernatant was aspirated and washed five times with PBS. The elution was carried out by adding 1ml of 0.2M Gly-HCl pH2.2, and 150. Mu.l of 1M Tris-HCl pH9.1 was added to neutralize and collect the phage adsorbed on HepG2 cells.
The collected phage were infected with 20ml of ER2738 (shake overnight for 1 inoculation) bacterial solution and infected at 37 ℃ for 4.5h. Centrifuging at 12000g for 10min, collecting supernatant, adding 20% of PEG/2.5M NaCl by volume of 1/6, and extracting phage at 4 deg.C for 2h. The phage solution was centrifuged at 12000g at 4 ℃ for 15min, the supernatant was removed, and 1mL of medium was added to obtain a phage solution. The above steps were repeated for the second and third rounds of screening.
Example 2 ELISA identification of phage clones obtained by screening
After the third round of screening was completed, hepG2/LO2 was cultured with 96-well cell culture plates, respectively, after the cells were attached to the wall, the culture medium was removed, and the cells were washed 2 times with PBS. Blocking with 4% PBSM blocking solution at 37 ℃ for 1h, removing the blocking solution, and washing once with PBS. Add 50. Mu.l 4% PBSM blocking solution and 50. Mu.l of the phage solution from the screen per well and incubate for 1h at 37 ℃. After the incubation is finished, washing the cells for 5 times by PBS, adding an anti-P8/HRP antibody, incubating the cells for 1h at 37 ℃, washing the cells for 5 times by PBS, adding 100 mu l of TMB substrate into each hole, reacting the cells in a dark place for 15min, then terminating the reaction, and detecting the absorbance by an enzyme-linked immunosorbent assay. And (3) selecting a phage clone strain with the absorbance of more than 0.8 for sequencing, wherein the sequence is FYLEHSGGLAV, and the polypeptide of the sequence is named as F11 polypeptide.
EXAMPLE 3 Synthesis and purification of F11 polypeptide
Weighing a certain amount of 2Cl resin, adding into a reactor, and then according to the resin: fmoc-Cys (Trt) -OH: adding amino acid and alkali according to the proportion of DIEA 1. Selecting and accurately weighing the resin according to the specified mole, putting the resin into a clean reactor, and adding DMF (DCM) with the volume being 2 times that of the resin to swell for 60-90 minutes. DMF (DCM) was taken off, three times the volume of 20% piperidine solution was added for 30 minutes, and the 20% piperidine solution was taken off and washed 5 times with DMF. And (3) dropwise adding a small amount of resin into a detection tube, dropwise adding two drops of ninhydrin solutions (A, B and C solutions), heating at 110 ℃ for 3 minutes, and determining that the resin is positive and the Fmoc is removed. After removal, the ratio of AA is 3 times: 6 times of NMM:2.85 HBTU (HATU) were placed in the reactor in order and DMF was added (to allow the resin to stir just well). Adding a small amount of resin into a detection tube, dripping two drops of ninhydrin solutions (solution A, solution B and solution C), heating at 110 deg.C for 3 min to obtain negative resin, and making reaction complete; the resin was positive, and the reaction was incomplete, and the operation was repeated from the point of 30 minutes of reaction with the addition of three times the volume of 20% piperidine solution. After complete assembly of the peptide sequences, the resin was washed with DMF 3, meoh 2, dcm 2, meoh 3 and then placed in a desiccator for overnight evacuation. And adding cutting fluid (E fluid/F fluid) into the drained resin according to 8-10ml per gram, and placing the resin in a shaker for reaction for 2 hours. After the reaction is finished, filtering by using a sand core to obtain filtrate, adding glacial ethyl ether to separate out a crude product, putting the crude product into a centrifugal machine for precipitation, and repeatedly washing the crude product by using ethyl ether for three times. And putting the cleaned crude product into a dryer for overnight pumping and drying to obtain the target polypeptide F11, wherein the structure is shown in figure 1.
EXAMPLE 4 Synthesis and purification of FITC-F11 polypeptide
Weighing a certain amount of 2Cl resin, adding into a reactor, and then according to the resin: fmoc-Lys (Dde) -OH: adding amino acid and alkali according to the proportion of DIEA 1. Selecting and accurately weighing the resin according to the specified mole, putting the resin into a clean reactor, and adding DMF (DCM) with the volume being 2 times that of the resin to swell for 60-90 minutes. The DMF (DCM) was taken off, three times the volume of 20% piperidine solution was added for 30 minutes, and the 20% piperidine solution was taken off and washed 5 times with DMF. And (3) dropwise adding a small amount of resin into a detection tube, dropwise adding two drops of ninhydrin solutions (A, B and C solutions), heating at 110 ℃ for 3 minutes, and determining that the resin is positive and the Fmoc is removed. After removal, the ratio of AA is 3 times: 6 times of NMM:2.85 HBTU (HATU) were placed in the reactor in order and DMF was added (to allow the resin to stir just well). Adding a small amount of resin into a detection tube, dripping two drops of ninhydrin solutions (A, B and C solutions), heating at 110 deg.C for 3 min to obtain negative resin, and completely reacting; the resin was positive, and the reaction was incomplete, and the operation was repeated from the point of 30 minutes of reaction with the addition of three times the volume of 20% piperidine solution. After the linear chain peptide sequence is completely assembled, removing Dde by using 4% hydrazine hydrate/DMF solution, putting the mixture into a reactor in the sequence of 4 times NMM to 2 times FITC, adding DMF, putting a small amount of resin into a detection tube, dropping two drops of ninhydrin solution (A, B and C solution) into the detection tube, heating the detection tube at 110 ℃ for 3 minutes to obtain positive resin, repeating the previous step if the reaction is incomplete, wherein the reaction is complete if the resin is negative, washing the reaction by using methanol, and putting the reaction tube into a dryer for overnight pumping and drying. And adding cutting fluid (E fluid/F fluid) into the drained resin according to 8-10ml per gram, and placing the resin in a shaker for reaction for 2 hours. After the reaction is finished, filtering by using a sand core to obtain filtrate, adding glacial ethyl ether to separate out a crude product, putting the crude product into a centrifugal machine for precipitation, and repeatedly washing by using ethyl ether for three times. And putting the cleaned crude product into a dryer for overnight pumping and drying to obtain the target polypeptide FITC-F11.
Test example 1 verification test of cell-targeting affinity of F11 polypeptide
In order to research the target uptake condition of the liver cancer polypeptide F11 to HepG2 cells in vitro, an in vitro test is established for verification. First, hepG2 cells, LO2 cells, and 293T cells were plated at a density of 5X104 per well, respectively
Figure BDA0003047444770000051
EZ cell slide, 24 hours after the cells were fully attached, FITC-fluorescently labeled F11 polypeptide (prepared in example 4) was added to the culture wells, and 5. Mu.l per well of Hoechst stained nuclei was added 5 minutes later. After 5 minutes the cell sap supernatant was aspirated off, washed three times with PBS, the cell well removed and covered with a coverslip. The uptake of FITC-F11 polypeptide on each cell was observed under a microscope and photographed, as shown in FIG. 2a, F11 polypeptide was abundantly occupied on the surface of HepG2 cells, whereas almost no F11 polypeptide was occupied on the surface of 293T nuclear LO2 cells. Thereafter, the cells from each well were collected and flow-assayed, and as shown in FIG. 2b, it can be seen that the F11 polypeptide had a significantly greater affinity for HepG2 cells than for 293T and LO2 cells. The above results show the targeting affinity of the F11 polypeptide to HepG2 cells.
Test example 2 targeting distribution ability test of F11 polypeptide in mouse
In order to verify the targeting affinity of the liver cancer polypeptide F11 to liver cancer tissues in vivo, a HepG2 subcutaneous tumor model is established in Balb/c-nude mice (4-5 weeks old, female). HepG2 cells cultured in vitro were trypsinized and quantitated in double Dm-free Em medium, 1X 10 cells were inoculated per mouse7And (4) one cell. When the volume of the subcutaneous tumor reaches 1000mm3Thereafter, tumor-bearing mice were injected intravenously with 200. Mu.g of FITC-F11 solution. Two hours later, the mice were sacrificed and the subcutaneous tumors and heart, liver, spleen, lung, kidney were removed. Cutting the tissue, placing into collagenase solution, digesting at 37 deg.C for 4 hr, and mixing with 70 μmCell screen filtration, filtrate with PBS buffer washing three times, flow measurement. Flow detection data of the mouse tumor and the main organs are shown in fig. 3, and it can be seen that the FITC labeled polypeptide F11 is distributed in the tumor tissue obviously higher than other organs, which proves the targeting affinity of the F11 polypeptide to the tumor tissue in the mouse body.
Experiment 3 F11 polypeptide immunohistochemical staining verification experiment for liver cancer patient tissue section
In order to verify whether the F11 polypeptide has the liver cancer targeting effect in the liver cancer patient, an immunohistochemical technology is applied to stain the tissue section of the liver cancer patient. Firstly, slicing and baking a liver cancer patient, and dewaxing and hydrating antigen for repair. After 20 min of blocking with goat serum, the patient tissue chips were coated with 10. Mu.g/ml FITC-F11 polypeptide solution as a primary antibody and incubated overnight at 4 ℃. After three washes with PBS the next day, nuclei were stained with DAPI and washed three more times with PBS. And (4) dripping an anti-fluorescence quencher after staining the core, and sealing the chip. The representative picture of the staining result is shown in fig. 4, and it can be seen that the cancer tissue of the liver cancer patient is more obviously positive than the tissue beside the cancer, which proves the targeting affinity ability of the F11 polypeptide to the liver cancer tissue in the patient.
The polypeptide capable of successfully targeting the liver cancer cell is obtained by screening, and through research, the polypeptide has good affinity to the liver cancer cell HepG2 cell, can specifically target the HepG2 cell, shows good targeting effect in a mouse body, is suitable for preparing anti-liver cancer drugs or developing agents for diagnosing the liver cancer, and has good application prospect.
Sequence listing
<110> Sichuan university Hospital in western China
<120> polypeptide specifically targeting human hepatoma cells and application thereof
<130> A210274K (preface)
<141> 2021-04-29
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 12
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Phe Tyr Leu Glu His Pro Ser Gly Gly Leu Ala Val
1 5 10
<210> 2
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttttatctgg aacatccgag cggcggcctg gcggtg 36

Claims (10)

1. A polypeptide that specifically targets human hepatoma cells, characterized in that: the amino acid sequence is shown as SEQ ID NO. 1.
2. The polypeptide specifically targeting human hepatoma cells according to claim 1, characterized in that: the liver cancer cell is a HepG2 cell line.
3. The nucleotide sequence encoding the polypeptide specifically targeting human hepatoma cells of claim 1.
4. The coding nucleotide according to claim 3, characterized in that: the sequence of the coding nucleotide is shown as SEQ ID NO. 2.
5. An expression vector comprising the polypeptide of claim 1, the coding nucleotide of claim 3 or 4.
6. The expression vector of claim 5, wherein: the expression vector is a prokaryotic vector or a eukaryotic vector.
7. A host cell comprising the polypeptide of claim 1, the coding nucleotide of claim 3 or 4, or the expression vector of claim 5 or 6.
8. Use of the polypeptide of claim 1, the coding nucleotide of claim 3 or 4, the expression vector of claim 5 or 6, or the host cell of claim 7 for targeting hepatoma cells.
9. Use of the polypeptide of claim 1, the coding nucleotide of claim 3 or 4, the expression vector of claim 5 or 6, or the host cell of claim 7 in preparing a medicament for resisting liver cancer or preparing an imaging agent for diagnosing liver cancer.
10. Use according to claim 9, characterized in that: the polypeptide is prepared into a solution for use, and the concentration is 1mg/mL.
CN202110476153.3A 2021-04-29 2021-04-29 Polypeptide specifically targeting human liver cancer cells and application thereof Pending CN115260287A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110476153.3A CN115260287A (en) 2021-04-29 2021-04-29 Polypeptide specifically targeting human liver cancer cells and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110476153.3A CN115260287A (en) 2021-04-29 2021-04-29 Polypeptide specifically targeting human liver cancer cells and application thereof

Publications (1)

Publication Number Publication Date
CN115260287A true CN115260287A (en) 2022-11-01

Family

ID=83745420

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110476153.3A Pending CN115260287A (en) 2021-04-29 2021-04-29 Polypeptide specifically targeting human liver cancer cells and application thereof

Country Status (1)

Country Link
CN (1) CN115260287A (en)

Similar Documents

Publication Publication Date Title
WO2019205866A1 (en) Specific polypeptide targeting human colon cancer cells
CN107459559A (en) A kind of immunotherapy of tumors prediction biomarker PD L1 target polypeptides and its application
CN108409836B (en) Polypeptide and application thereof
WO2019205867A1 (en) Polypeptide specifically binding to human colon cancer cells
WO2019154103A1 (en) Novel polypeptide for tumor targeting and application thereof
CN111253472B (en) Novel polypeptide targeting multiple tumor cells and application thereof
CN112028997A (en) anti-CEACAM 5 nano antibody
CN101492505B (en) Specific combined polypeptide for lung cancer, preparation and uses thereof
CN110330551B (en) Pancreatic cancer specific binding peptide and preparation method and application thereof
JP6276992B2 (en) Molecular markers for early detection of pleural mesothelioma patients and their expression analysis methods
CN115260287A (en) Polypeptide specifically targeting human liver cancer cells and application thereof
CN102471371B (en) Homing peptide for tumor vasculature
CN107353325B (en) Folate receptor alpha specific binding peptide 1 and application thereof
CN115286715B (en) anti-CD3 nano antibody or antigen binding portion thereof and preparation method thereof
Wang et al. Screening peptides binding specifically to colorectal cancer cells from a phage random peptide library
CN106967154B (en) Screening method of human colon cancer cell specific binding polypeptide and application thereof
CN113248569B (en) Leptin receptor affinity peptide and application thereof
CN110981961B (en) Sequence and application of nano antibody H6 specifically binding to cancer cell protein B7-H4
KR100837341B1 (en) Bladder tumor-targeting peptides and uses thereof
CN110776559A (en) CD44v3-v10 structural domain specific polypeptide ligand for gastric cancer diagnosis, obtaining method and application
CN112358531A (en) Polypeptide targeting HER2 protein and application thereof
CN107793471B (en) Folate receptor alpha specific binding peptide 4 and application thereof
JPWO2008084652A1 (en) Vascular endothelial cell binding peptide
CN113527431B (en) Polypeptide specifically targeting human colorectal cancer cells and application thereof
CN112979757B (en) Polypeptide of specific targeting human liver cancer cell

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination