CN115252622B

CN115252622B - Aldose reductase inhibitor and application thereof in preparation of medicine for treating lung cancer

Info

Publication number: CN115252622B
Application number: CN202211177580.2A
Authority: CN
Inventors: 刘丽宏; 沈国林; 丛菱; 王晓雪; 李鹏飞; 安卓玲
Original assignee: China Japan Friendship Hospital; Chinese Academy of Inspection and Quarantine CAIQ
Current assignee: China Japan Friendship Hospital; Chinese Academy of Inspection and Quarantine CAIQ
Priority date: 2022-09-26
Filing date: 2022-09-26
Publication date: 2023-02-21
Anticipated expiration: 2042-09-26
Also published as: CN115252622A

Abstract

The invention provides an aldose reductase inhibitor, the effective components of which comprise one or more of olanzapine, quercetin and baicalin; also provides the application of the compound in preparing the medicine for treating lung cancer. The invention firstly discovers that olanzapine serving as an aldose reductase inhibitor can obviously inhibit the activity of lung cancer cells and cause apoptosis, and the action mechanism of olanzapine is caused by insufficient ATP supply caused by inhibiting glutamate metabolism, glycolysis and a metabolic pathway of TCA (ternary content addressable memory) cycle of the lung cancer cells. The combination with natural aldose reductase inhibitor (quercetin or baicalin) can obviously inhibit the activity of aldose reductase, and has better effect. More importantly, olanzapine in aldose reductase inhibitor is a marketed drug, has high safety and is mainly used for treating schizophrenia and manic attack clinically. The invention firstly discovers that olanzapine can be used for treating lung cancer by singly using or combining with a natural product aldose reductase inhibitor, and more lung cancer patients can benefit.

Description

Aldose reductase inhibitor and application thereof in preparation of medicine for treating lung cancer

Technical Field

The invention relates to the technical field of medical application, in particular to an aldose reductase stopping agent and application thereof in preparing a medicament for treating lung cancer.

Background

Lung cancer is mainly classified into two major small cell lung cancer types and non-small cell lung cancer, and non-small cell lung cancer is a major subtype of lung cancer, accounting for about 80% -85% of all lung cancer types. For patients with early and locally advanced non-small cell lung cancer, surgical resection or combined radiotherapy and chemotherapy is the current first-line treatment mode, but the effective rate is low. So far, only immunotherapy has a good treatment effect on lung cancer, and chemotherapy is still selected for first-line treatment of many lung cancer patients due to high price. The survival prognosis of lung cancer is still not optimistic, and trying and developing new drugs is an urgent matter.

Aldose Reductase (AR) belongs to a member of aldehyde ketone reductase superfamily, and is reduced nicotinamide adenineDinucleotide Phosphate (NADPH) -dependent oxidoreductase is a key rate-limiting enzyme in the polyol metabolic pathway. The enzyme is expressed in various cells and tissues of different species, and is widely present in animal tissue organs such as nerves, muscles, crystalline lens, brain, kidney, lung and the like. The AR catalyzes the reduction of saturated and unsaturated aldehydes (including aldoses and monosaccharides, as well as a host of other substrates), such as the reduction of glucose to sorbitol. Sorbitol has strong polarity and is difficult to pass through cell membranes, and can accumulate in cells, so that the permeability of the cells is changed, and Na in the cells is changed ⁺ -K ⁺ A decrease in ATPase activity, resulting in loss of myo-inositol, leading to impairment of cellular metabolism and function. In conclusion, AR plays an important role in cancer, diabetic complications, ischemia/reperfusion-induced liver damage and cardiac lipid accumulation. The search for economical, highly effective, low toxicity AR blockers is of great importance in the treatment of diseases such as cancer, diabetes, myocardial infarction and ischemic injury, asthma, transplantation and unwanted inflammatory responses.

AR blockers are classified into 3 classes by source: natural products of plant origin, antibiotics of microbial origin and artificially synthesized compounds. Most of the synthetic AR inhibitors fail clinical tests due to low curative effect and large toxic and side effect. Currently, there are very few AR inhibitors available for clinical use. Therefore, the search for new highly effective, low toxicity AR inhibitors is urgent.

Disclosure of Invention

Aiming at the technical limitations, the invention provides an aldose reductase inhibitor and application thereof in preparing a medicament for treating lung cancer, and overcomes the defects in the background technology.

In order to realize the purpose, the invention adopts the following technical scheme:

the invention provides an aldose reductase inhibitor, and the effective components of the inhibitor comprise one or more of olanzapine, quercetin and baicalin.

Olanzapine is a medicine which is marketed for more than 20 years, is mainly used for treating schizophrenia and manic attacks in clinic, and has few adverse reactions. The invention discovers for the first time that the medicament can effectively inhibit the activity of aldose reductase AR and can be used as a candidate medicament for treating lung cancer. In addition, plants are a rich source of AR inhibitors, and natural products rarely cause serious adverse reactions. At present, natural products AR inhibitors are more and more widely applied to disease treatment and become the best choice besides artificial synthetic drugs.

Further, the aldose reductase stopping agent comprises the effective components of olanzapine, olanzapine compound quercetin, olanzapine compound baicalin, olanzapine compound quercetin and baicalin.

In the embodiment of the invention, relevant cell experiments and animal experiments are carried out aiming at the effective dose of olanzapine, the effective dose of olanzapine in the cell experiments is 25-200 mu M (25 mu M, 50 mu M, 75 mu M, 100 mu M, 125 mu M, 150 mu M, 175 mu M and 200 mu M), and the effective dose of olanzapine in the animal experiments is 3-6 mg/kg; in cell experiments, effective doses of quercetin and baicalin are 25-150 μ M (25 μ M, 50 μ M, 75 μ M, 100 μ M, 125 μ M, 150 μ M) and baicalin 50-200 μ M (50 μ M, 75 μ M, 100 μ M, 125 μ M, 150 μ M, 175 μ M, 200 μ M), respectively, and the optimal effective doses are selected to be 150 μ M and 200 μ M, respectively.

The effective dosage of olanzapine, quercetin and baicalin meets the requirements of clinical medication safety and efficacy.

The second invention of the invention provides the application of the aldose reductase inhibitor in preparing the medicine for treating the lung cancer.

The method for treating lung cancer by combining olanzapine and a natural product AR inhibitor is a novel method and has great social and economic significance.

Further, in the above applications, the lung cancer includes one or more of small cell lung cancer, non-small cell lung squamous carcinoma, non-small cell lung adenocarcinoma, non-small cell adenosquamous carcinoma and large cell lung cancer.

Further, in the above-mentioned use, the aldose reductase inhibitor in the medicament is capable of inhibiting glutamine metabolism of lung cancer cells.

Further, in the above-mentioned use, the aldose reductase inhibitor in the medicament is capable of inhibiting glycolysis of the lung cancer cell.

Further, in the above-mentioned use, the aldose reductase inhibitor in the medicament is capable of inhibiting TCA cycle TCA of lung cancer cells.

Furthermore, in the application, the medicament containing the aldose reductase inhibitor for treating the lung cancer also comprises a pharmaceutically acceptable carrier and auxiliary materials, and the administration mode of the medicament is oral.

Compared with the prior art, the invention has the following technical effects:

1. olanzapine and the pharmaceutical composition thereof can obviously inhibit the activity of aldose reductase;

2. olanzapine can block glutamine metabolism of lung cancer cells at a cellular level, so that proliferation of the lung cancer cells is inhibited, and apoptosis of the lung cancer cells is promoted;

3. olanzapine can block glycolysis process at cellular level, and reduce ATP energy supply, thereby inhibiting proliferation of lung cancer cells and promoting apoptosis;

4. olanzapine can block TCA cycle of lung cancer cells at a cellular level, and reduce ATP energy supply, thereby inhibiting proliferation of the lung cancer cells and promoting apoptosis of the lung cancer cells.

Drawings

FIG. 1 shows the inhibition of AKR1B10, AKRAB1 at the mRNA level by olanzapine; wherein A in figure 1 is the inhibition of AKR1B10 mRNA levels by olanzapine in H520 cells; b in FIG. 1 is the inhibition of AKR1B10 mRNA levels by olanzapine in H520 tumor-bearing mice; c in fig. 1 is the inhibition of AKR1B1 mRNA levels by olanzapine in H520 cells; d in FIG. 1 is the inhibition of AKR1B1 mRNA levels by olanzapine in H520 tumor bearing mice.

Fig. 2 shows the effect of olanzapine on the activity of BASE-2B, H and H226 cells as measured by CCK8 assay, where a in fig. 2 is the results of 24H and 48H cell viability assay after treatment of H520 with different concentrations of olanzapine, B in fig. 2 is the results of 24H and 48H cell viability assay after treatment of H226 with different concentrations of olanzapine, and C in fig. 2 is the results of 24H and 48H cell viability assay after treatment of BASE-2B with different concentrations of olanzapine.

Fig. 3 shows the effect of olanzapine on the proliferation ability of H520 in squamous cell lung carcinoma cells tested by EDU assay, wherein a in fig. 3 is the staining result of the EDU cell proliferation assay performed on H520 in squamous cell lung carcinoma cells, and B in fig. 3 is the statistical result of the EDU cell proliferation assay performed on H520 in squamous cell lung carcinoma cells.

Fig. 4 shows the effect of olanzapine on the migration ability of H520 lung squamous carcinoma cells measured by a cell scratch test, wherein a in fig. 4 is a graph of the measurement result of the cell scratch test, and B in fig. 4 is a data statistics graph of the cell scratch test.

Fig. 5 shows a graph of the effect of olanzapine on the migration ability of lung squamous carcinoma cells H520 measured by a Transwell test, wherein a in fig. 5 is a graph of the test results of the Transwell test, and B in fig. 5 is a graph of the test data statistics of the Transwell test.

Fig. 6 shows the detection of the apoptosis degree of olanzapine on the lung squamous carcinoma cell H520 by the Annexin-7AAD double staining experiment, wherein, a in fig. 6 is a graph of the detection result of the flow cell of the Annexin-7AAD double staining experiment, and B in fig. 6 is a graph of the detection data statistics of the flow cell of the Annexin-7AAD double staining experiment.

FIG. 7 shows the detection of olanzapine on apoptosis protein of H520 cells of lung squamous carcinoma cells by Western Blot experiment, wherein A in FIG. 7 is a detection result chart of the Western Blot experiment, and B in FIG. 7 is a detection data statistical chart of the Western Blot experiment.

FIG. 8 shows the antitumor effect of olanzapine in H520 tumor-bearing mice, wherein A in FIG. 8 is a statistical graph of body weight data of nude mice with olanzapine acting on H520 tumor-bearing mice, B in FIG. 8 is a statistical graph of tumor volume data of olanzapine acting on H520 tumor-bearing mice, C in FIG. 8 is a graph of tumor tissue measurement results of olanzapine acting on H520 tumor-bearing mice, and D in FIG. 8 is a statistical graph of tumor weight data of olanzapine acting on H520 tumor-bearing mice.

FIG. 9 the effect of quercetin, baicalin, on BASE-2B, H cell activity was examined by CCK8 assay.

FIG. 10 is a CCK8 assay to examine the effect of olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin on BASE-2B, H cell activity.

FIG. 11 the effect of olanzapine + baicalin on the proliferative capacity of H520 lung squamous carcinoma cells was examined by EDU assay.

Fig. 12 the effect of olanzapine + quercetin on the proliferative capacity of lung squamous carcinoma cells H520 was examined by EDU assay.

FIG. 13 is an EDU assay to examine the effect of olanzapine + quercetin + baicalin on the proliferative capacity of H520 squamous cell lung carcinoma cells.

Figure 14 tests the effect of olanzapine + baicalin on the migration ability of lung squamous carcinoma cells H520 by cell scratch assay.

Figure 15 the effect of olanzapine + quercetin on the migratory capacity of lung squamous carcinoma cells H520 was examined by cell scratch assay.

Fig. 16 is a graph for examining the effect of olanzapine + quercetin + baicalin on the migration ability of lung squamous carcinoma cells H520 by a cell scratch test.

FIG. 17 is a graph showing the effect of olanzapine + baicalin on the apoptosis degree of H520 squamous cell lung carcinoma cells by Annexin-7AAD double staining assay.

FIG. 18 is a graph showing the effect of olanzapine + quercetin on the apoptosis level of lung squamous carcinoma cells H520 by Annexin-7AAD double staining assay.

FIG. 19 is a graph showing the effect of olanzapine + quercetin + baicalin on the apoptosis degree of lung squamous carcinoma cells H520 by Annexin-7AAD double staining assay.

Fig. 20 plot of PCA scores for intracellular compounds of control-drug group.

FIG. 21 is a schematic diagram of a control-drug group model of the intracellular compound PLS-DA.

Fig. 22 is a diagram illustrating an analysis of a metabolic pathway of a compound in a cell in a control group-drug group.

FIG. 23 effects of olanzapine on mRNA expression of glutamate metabolism, glycolysis, and key enzymes of the TCA cycle pathway.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below. It is to be understood that the description herein is only illustrative of the present invention and is not intended to limit the scope of the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the terminology used herein in the description of the present invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the present invention. The reagents and instruments used in the present invention are commercially available, and the characterization means involved can be referred to the description in the prior art, which is not repeated herein.

For a further understanding of the present invention, reference will now be made in detail to the preferred embodiments of the present invention.

Example 1

An aldose reductase inhibitor comprises one or more of olanzapine, quercetin and baicalin as effective components.

The effective components of the stopping agent are olanzapine, olanzapine compound quercetin, olanzapine compound baicalin, olanzapine compound quercetin and baicalin.

The effective dose of olanzapine in cell experiments is 25-200. Mu.M (25. Mu.M, 50. Mu.M, 75. Mu.M, 100. Mu.M, 125. Mu.M, 150. Mu.M, 175. Mu.M, 200. Mu.M) and the effective dose of olanzapine in animal experiments is 3-6 mg/kg; in cell experiments, effective doses of quercetin and baicalin are 25-150 μ M (25 μ M, 50 μ M, 75 μ M, 100 μ M, 125 μ M, 150 μ M) and baicalin 50-200 μ M (50 μ M, 75 μ M, 100 μ M, 125 μ M, 150 μ M, 175 μ M, 200 μ M), respectively, and the optimal effective doses are selected to be 150 μ M and 200 μ M, respectively.

The optimal effective dose of olanzapine, quercetin and baicalin meets the requirements of clinical medication safety and efficacy.

Also provides the application of the aldose reductase inhibitor in preparing the medicament for treating the lung cancer.

The lung cancer comprises one or more of small cell lung cancer, non-small cell lung squamous carcinoma, non-small cell lung adenocarcinoma, non-small cell adenosquamous carcinoma and large cell lung cancer.

The aldose reductase inhibitor in the medicine can inhibit glutamine metabolism of lung cancer cells.

The aldose reductase inhibitor in the medicine can inhibit glycolysis of lung cancer cell.

Aldose reductase inhibitor in the medicine can inhibit TCA cycle TCA of lung cancer cell.

The oral medicine for treating lung cancer also comprises pharmaceutically acceptable carrier auxiliary materials.

The present invention finds that the mRNA expression level of aldose reductase in lung cancer cells is obviously increased. According to the invention, lung cancer cells (H520 cell strain) are used as a cell model and an H520 tumor-bearing mouse is used as an animal model, olanzapine is used for in vitro cell and animal in vivo experiments, and the experimental result shows that olanzapine can obviously inhibit the mRNA expression level of aldose reductase of the H520 tumor-bearing mouse and the H520 tumor-bearing mouse of the lung squamous carcinoma cells.

CCK8 experiments show that olanzapine can obviously inhibit the proliferation of lung squamous carcinoma cells H520 and has a dose-dependent effect. Cell scratch experiments and Transwell experiments show that olanzapine can obviously inhibit the migration of H520 cells of lung squamous carcinoma and has a dose-dependent effect. Flow cytometry experiments and apoptosis pathway regulation protein level detection show that olanzapine can obviously promote apoptosis of lung squamous carcinoma cells H520. Experiments in H520 tumor-bearing mice show that olanzapine significantly inhibits the growth of H520 tumors in vivo.

The invention discovers that olanzapine as an aldose reductase inhibitor can inhibit glutamine metabolism by inhibiting c-Myc, GLUD, GLS and GS genes in lung cancer cells.

The invention finds that olanzapine as an aldose reductase inhibitor can inhibit glycolysis process by inhibiting HKII, GAPDHS, PK, PDH and LDH genes in lung cancer cells.

The invention finds that olanzapine as an aldose reductase inhibitor can inhibit TCA cycle by inhibiting SDH, MDH, CS and IDH genes in lung cancer cells.

Therefore, olanzapine can be used as an aldose reductase inhibitor for treating the lung cancer.

The compounds of the present invention may be formulated into various suitable pharmaceutical preparation forms. Can be used alone or mixed with medicinal adjuvants (such as excipient, diluent, etc.) to make into oral tablet, capsule, granule or syrup, or powder for injection or solution.

Example 2

Study of olanzapine on the expression of H520 and H520 oncotic murine aldose reductase mRNA of lung squamous carcinoma cells:

the main reagents are as follows: reverse transcription kit KR116-02 (Tiangen Biochemical technology Co., ltd.); fluorescence quantitative kit P205-02 (Tiangen Biochemical technology Co., ltd.); the primer sequences (Huada Gene Co., ltd.) are shown in Table 1.

TABLE 1

The experimental method comprises the following steps:

cell culture:

(1) Cell preparation: the cells in the logarithmic growth phase, which are better, were digested with 0.25% trypsin while being blown into single cells, and the single cells were suspended in a medium containing 10% fetal bovine serum and were ready for use.

(2) Inoculating cells: the cells were seeded at a cell density of 20000/well in 96-well plates at 2000. Mu.L per well, with 3 replicates per group of cells.

(3) Cell dosing: after the cells adhered for 12 hours, 0.1% of DMSO in the control group and olanzapine in different gradient concentrations were added, respectively, and the mixture was placed at 37 ℃ and 5% CO ₂ And 72H in a cell culture box with saturated humidity.

(4) Cell collection: cell scraper scraped each group of cells. Centrifuging at 1000rpm for 5min, discarding the culture solution, washing the cells with PBS, centrifuging at 1000rpm for 5min, and discarding the supernatant.

Animal experiments:

h520 cells (1X 10 cells per mouse) ⁶ 0.2ml PBS) was injected subcutaneously into the right side of the mice. 7 days after inoculation, tumors grew to 80-100 mm ³ The volume of (a). The mice were randomly divided into three groups (3 mice per group) and injected daily by intragastric injection with 3mg/kg,6mg/kg of either PBS (vehicle group) or olanzapine for 21 days. Tumor volumes were measured every 3-4 days after tumor appearance and were determined by the formula V = a × b 2/2 (a = longest axis; b = shortest axis). Mice were sacrificed on day 21 post treatment, tumors isolated, volume measured and weighed.

Total RNA extraction:

the collected cells and tumor tissue were transferred to a 1.5mL enzyme-free centrifuge tube and 1mL of Tirzol was added per tube for sufficient lysis. Add 200. Mu.L chloroform to 1mL TRIzol, shake the centrifuge tube vigorously for 15s, incubate at room temperature for 5min, centrifuge at 12000rpm at 4 ℃ for 15min. After centrifugation, the phases separated into a lower red organic phase, an intermediate white phase and an upper clear aqueous phase. Transfer the aqueous phase containing the RNA to a fresh centrifuge tube. Adding 600ul isopropanol, mixing by up-down reversal, incubating at room temperature for 10min, centrifuging at 4 ℃,12000rpm, and 10min. The supernatant was discarded and a white precipitate was visible. 1ml of 75% ethanol was added, and the mixture was subjected to reverse centrifugation at 4 ℃ at 7500 rpm for 5min. All supernatants were aspirated for 10min at room temperature, dissolved in 20. Mu.L of DEPC water and stored at-80 ℃.

The synthesis of (2):

（1）5×gDNA Buffer 2 μL；Total RNA 2μg；RNase-Free ddH ₂ make up to 10. Mu.L of O, and mix thoroughly. Centrifuging briefly, placing at 42 deg.C, incubating for 3 min, and placing on ice;

（2）10×King RT Buffer 2 μL；FastKing RT Enzyme Mix 1 μL；FQ-RT Primer Mix 2 μL；RNase-Free ddH ₂ o make up to 10. Mu.L. Adding the mixture into the product obtained in the step (1), and fully and uniformly mixing.

(3) Incubate at 42 ℃ for 15 minutes, 95 ℃ for 3 minutes.

Real-time fluorescent quantitative PCR:

using the above cDNA as a template, the amount was determined according to the following reaction system and procedure. Reaction system: 10uL 2 XSuperReal Premix Plus, 1. Mu.L primer F, 1. Mu.L primer R, 2. Mu.L cDNA, 18. Mu.L ddH ₂ And (O). The reaction procedure of the three-step method is adopted: 15min at 95 ℃;95 ℃ 10 sFluorescence signals were collected after 20 s at 60 ℃ and 32s at 72 ℃ for 40 cycles.

The experimental results are as follows:

as shown in the results of fig. 1, olanzapine inhibited the expression of H520 and H520 tumor-bearing murine aldose reductase mRNA of lung squamous carcinoma cells.

Example 3:

research on proliferation and migration ability of lung squamous carcinoma cell H520 with olanzapine:

the experimental method comprises the following steps:

1.1 cell viability was measured by the CCK8 assay.

H520 cells with good growth state are prepared into cell suspension with a certain concentration, and 100ul of each well is added into a 96-well cell culture plate. Incubate overnight. Then 0.1% DMSO and various concentrations of olanzapine were added, respectively, and incubated for 24 and 48 hours. 10ul of CCK-8 solution was added to a 96 well cell culture plate and incubation continued for 2 hours in an incubator at 37 ℃. The absorbance of each well was obtained using an automated fluorescent microplate reader with a wavelength of 450 nm.

1.2 evaluation of the proliferative Capacity of cells by EDU cell proliferation assay

H520 cells were treated with different concentrations of olanzapine for 24 and 48 hours, the medium was replaced with fresh medium containing 10 μ M EdU and incubated for an additional 2 hours. Cells were fixed with 4% neutral paraformaldehyde, permeabilized with 0.5% Triton X-100, and stained with the reaction mixture and Hoechst 33342 according to the manufacturer's instructions. Cells were imaged with a fluorescence inverted microscope.

1.3 cell scratch assay to examine the effect of olanzapine on the migratory capacity of H520 lung squamous carcinoma cells.

When H520 cells reached 90% confluence in a six well plate, the cells were injured on a monolayer of cells with a sterile 200 μ l pipette tip and washed with serum-free medium to remove the detached cells, and images of the scratch gaps were taken using a microscope. Next, the cells were treated with different concentrations of olanzapine for 24 hours and 48 hours. Finally, images of the wound gap were taken using a microscope.

1.4 the effect of olanzapine on the migratory capacity of H520 lung squamous carcinoma cells was examined by Transwell assay.

H520 cells were starved overnight and then cultured in serum free medium in the upper chamber (24-well transwell chamber, 8 μm) while high serum medium (10% FBS containing various concentrations of olanzapine) was added to the lower chamber. After 48 hours incubation at 37 ℃, cells were fixed with methanol and stained with 0.1% crystal violet. Finally, the image is taken using a microscope.

The experimental results are as follows:

in order to investigate whether olanzapine can effectively inhibit the proliferation activity of human lung squamous carcinoma cells, the CCK8 method is adopted to detect the cell proliferation inhibition rate. Olanzapine was treated with BASE-2B (human normal lung cells), H520 (lung squamous carcinoma cells), H226 (lung squamous carcinoma cells) at different concentrations. As shown in fig. 2, the data for 24h and 48h all show that the inhibition of cell proliferation was significantly increased in the treated group compared to the blank control, and was dose-dependent. Furthermore, olanzapine inhibited proliferation of lung squamous carcinoma cells to a significantly greater extent than normal lung cells. After 24 hours. BASE-2B has an IC50 of 211.7. Mu.M; IC50 for H226 is 155.0. Mu.M; h520 Has an IC50 of 162.9. Mu.M. To further investigate the effect of olanzapine on the activity of lung squamous carcinoma cells, EDU cell proliferation experiments were performed on lung squamous carcinoma cells H520. As shown in fig. 3, compared with the control group, olanzapine can significantly reduce the growth rate of H520 of lung squamous carcinoma cells, the proliferation number of cells is significantly less, the EDU positive rate is reduced, the proliferation capability of cells can be inhibited, and the concentration dependence is formed (P < 0.05). This result further supports that olanzapine is capable of inhibiting proliferation of lung squamous carcinoma cells H520. To investigate the effect of olanzapine on the inhibition of cell migration ability, cell scratch experiments were performed, as shown in fig. 4, and cell migration and ability were significantly inhibited after the addition of olanzapine (P < 0.05). To further verify the effect of olanzapine on the inhibition of cell migration, transwell experiments were used, as shown in figure 5, where cell migration and ability were significantly inhibited (P < 0.05) with olanzapine addition. This result further supports that olanzapine is able to inhibit migration of lung squamous carcinoma cells H520.

Example 4:

study of the extent of apoptosis of lung squamous carcinoma cells H520 with olanzapine:

the experimental method comprises the following steps:

1.1 Annexin-7AAD double staining experiment for detecting degree of olanzapine for promoting H520 apoptosis of lung squamous carcinoma cells

H520 cells were grown in 6-well plates and incubated overnight, and H520 cells were treated with different concentrations of olanzapine for 24 hours and 48 hours. Cells were harvested and resuspended in 200. Mu.L of binding buffer, then incubated with 5. Mu.L of Annexin V-FITC and 10. Mu.L of 7AAD for 15min at room temperature in the absence of light. A total of 10000 cells per tube were collected for data analysis.

1.2 Western Blot experiment for detecting degree of olanzapine for promoting H520 apoptosis of lung squamous carcinoma cells

H520 cells were grown in 6-well plates and incubated overnight, and cells were treated with different concentrations of olanzapine for 24 hours and 48 hours. Cells were collected and washed with PBS, then lysed with cold lysis buffer containing protease inhibitor cocktail. 12 After centrifugation at 000rpm for 15 minutes, the protein supernatant was extracted and the protein concentration was measured by BCA protein assay kit. Equal amounts of protein from each sample were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to PDVF membrane. PDVF membrane was blocked with 5% skim milk for 4 hours at room temperature, washed clean and incubated with primary antibody overnight at 4 ℃. The next day PDVF membrane was washed and incubated with secondary antibody for 1 hour. The membrane was washed clean and blots were detected with an odssel infrared imaging system.

The experimental results are as follows: in order to research the mechanism of olanzapine for inhibiting the proliferation of lung squamous carcinoma cells, annexin-7AAD double staining was carried out on lung squamous carcinoma cells H520, and the apoptosis rate of H520 cells is obviously increased (P < 0.05) along with the increase of the drug concentration through flow cytometry analysis, as shown in figure 6. In order to further study the mechanism of olanzapine inducing cell to induce apoptosis, WB was used to detect apoptosis pathway regulatory protein. The results shown in FIG. 7 show that the expression ratio of BCL-2/BAX is significantly reduced (P < 0.05).

Example 5:

study of the antitumor effects of olanzapine in H520 tumor-bearing mice:

the experimental method comprises the following steps: the same as in example 2.

The experimental results are as follows: we evaluated the effect of olanzapine on the growth of H520 lung squamous carcinoma cells in vivo. As shown in fig. 8, treatment did not substantially affect the average body weight of mice, but significantly reduced the weight and volume of H520 tumor-bearing (P < 0.05).

Example 6:

effects of quercetin, baicalin, olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin on BASE-2B, H cell activity.

The experimental method comprises the following steps: the same as in example 3.

The experimental results are as follows: in order to research whether the effect of olanzapine on inhibiting the proliferation activity of human lung squamous carcinoma cells can be effectively increased by quercetin and baicalin, a CCK8 method is adopted to detect the cell proliferation inhibition rate. The quercetin and baicalin are used for treating BASE-2B (human normal lung cells), H520 (lung squamous carcinoma cells) and H226 (lung squamous carcinoma cells) at different concentrations. As shown in fig. 9, the data of 24h and 48h all show that the inhibition rate of cell proliferation is significantly increased in the treated group compared to the blank control, and the effect is dose-dependent. Furthermore, we examined the cell proliferation inhibition rate by the CCK8 method. The degree of inhibition of proliferation of squamous cell lung carcinoma cells was significantly higher than that of normal lung cells. We chose quercetin 150. Mu.M and baicalin 200. Mu.M as the concentrations for the next experiment. In order to study the influence of olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin on the activity of lung squamous carcinoma cells, a CCK8 method is adopted to detect the cell proliferation inhibition rate. As shown in fig. 10, when olanzapine was used in combination with quercetin and baicalin for 48H, the effect of inhibiting the proliferation rate of lung squamous carcinoma cells H520 was significant. To further study the effect of olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin on the activity of lung squamous carcinoma cells, we performed EDU cell proliferation experiments on lung squamous carcinoma cells H520. As shown in fig. 11, 12 and 13, compared with the control group, olanzapine, quercetin and baicalin which are used together with 48H can obviously reduce the growth rate of lung squamous carcinoma cells H520, the cell proliferation number is obviously less, the EDU positive rate is reduced, the cell proliferation capacity can be inhibited, and the concentration dependence is formed (P < 0.05).

Example 7:

research on proliferation and migration capacity of lung squamous carcinoma cells H520 by olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin

The experimental results are as follows: in order to study the effect of olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin on the ability to inhibit cell migration, cell scratch test was performed, as shown in fig. 14 and 15, and cell migration and ability were significantly inhibited after 48H of combined use of olanzapine and quercetin, baicalin (P < 0.05). In fig. 16, we can find that after olanzapine + quercetin + baicalin are used together, the cells are directly suspended in a large area, and it is considered that the olanzapine + quercetin + baicalin can aggravate the inhibition of cell activity under the condition of low serum, so that the cells are not attached to the wall any more.

Example 8:

research on degree of lung apoptosis of lung squamous carcinoma cell H520 by olanzapine + quercetin, olanzapine + baicalin, olanzapine + quercetin + baicalin

The experimental method comprises the following steps: the same as in example 4.

The experimental results are as follows: in order to study the mechanism of olanzapine for inhibiting the proliferation of lung squamous carcinoma cells, the lung squamous carcinoma H520 was subjected to Annexin-7AAD double staining, and analyzed by a flow cytometer, as shown in FIGS. 17, 18 and 19, the increase of the apoptosis rate of H520 cells after the combination use of olanzapine, quercetin and baicalin is obvious (P < 0.05).

Example 9:

study of cellular metabolomics of lung squamous carcinoma cells by olanzapine:

the experimental method comprises the following steps: h520 cells were grown in 6-well plates and incubated overnight, and cells were treated with different concentrations of olanzapine for 72 hours. Then, cells were washed twice with ice-cold PBS and fixed with 1mL in 10% methanol +1% formic acid in ice-cold water. Cells were scraped from the plate for 30min and centrifuged at 10000rpm for 1min. 50 μ L of the supernatant was added to 450 μ L of the sample pretreatment solution, mixed well and centrifuged at 12000rpm for 10min. 5 μ L of supernatant was taken for LC-MS/MS based metabolome assay.

The experimental results are as follows: before formal analysis of MetabioAnalyzt 5.0 software, pareto scaling formatting processing is carried out on a data set so as to obtain a more intuitive and reliable result. In order to judge whether the two groups have difference, a PCA modeling method is adopted to analyze the sample. The principal component analysis was performed thereon, see FIG. 20. To obtain metabolite information that resulted in such significant differences, 4 groups of samples were further analyzed using partial least squares discriminant analysis (PLS-DA) see fig. 21.VIP is a main parameter for importance evaluation of each variable in the PLS-DA model, and the larger the VIP value is, the greater the contribution to the classification model is. VIP >1 is used for screening metabolites, defined as differential metabolites, and used for distinguishing a control group from an experimental group, and endogenous substance change (VIP > 1) in cells of the control group-drug group is shown in a table 2. Major differentiated endogenous metabolites with VIP values greater than 1 were analyzed using the metaboanalyst5.0 software, selecting P values greater than 0.1 as the major metabolic pathway of influence, see table 3 and figure 22. Table 3 shows the results of the intracellular compound metabolic pathway analysis in the control group-drug group.

TABLE 2

No	Metabolites	VIP	15um/0um(%)	50um/0um(%)	150um/0um(%)
						1	Phenylethylamine	12.248	85.31±35.36	76.15±31.21	46.8±17.49
2	Spermine	5.5181	164.15±11.48	159.67±8.05	148.21±7.78
						3	Creatine	5.4879	94.3±5.29	79.56±3.1	51.01±2.08
4	Phosphorylcholine	4.6051	71.27±9.14	47.74±4.04	20.32±1.31
						5	Lactic acid	3.8248	85.26±15.17	107.07±20.59	192.8±7.82
6	Histamine	3.2534	108.65±39.82	126.92±41.22	166.69±49.27
						7	Valine	2.6627	86.48±36.93	91.33±31.15	67.69±35.28
8	L-proline	2.2792	113.79±11.47	143.56±12.12	200.97±9.67
						9	L-arginine	2.2743	17.7±1.66	17.8±1.83	2.08±1.46
10	Spermidine	2.0203	104.25±2.93	94.03±3.16	85.85±5.03
						11	PC(14:0/22:1(13Z))	1.8592	121.1±38.13	205.97±133.35	254.11±192.41
12	PC(14:0/18:1(9Z))	1.8446	69.7±32.73	636.88±490.98	263.03±405.94
						13	L-carnitine	1.7773	151.98±10.66	48.09±2.34	15.7±2.43
14	Caffeine	1.6564	35.28±16.83	19.36±9.39	20.71±7.67
						15	Citric acid	1.5398	271.18±50.97	286.98±64.55	192.46±18.21
16	Propionyl radicalCarnitine	1.5244	55.43±27.92	128.8±58.57	234.79±72.19
						17	N-acetyl-L-aspartic acid	1.4791	165.63±14.27	201.76±34.47	122.79±11.96
18	PC(o-16:1(9Z)/18:0)	1.4153	169.72±131.74	163.71±104.02	230.32±162.07
						19	PC(O-16:0/18:2(9Z，12Z))	1.4086	96.04±49.8	219.44±220.49	204.24±250.83
20	Propionyl carnitine	1.3934	59.55±25.75	151.51±82.07	268.97±114.34
						21	Oleamide (I)	1.3673	96.18±15.04	109.66±18.5	93.93±41.46
22	SM(d18:0/24:1(15Z))	1.3301	327.77±149.1	622.42±227.82	1108.34±422.02
						23	PC(o-18:1(9Z)/18:2(9Z，12Z))	1.3255	134.92±188.12	270.37±283.8	222.4±266.7
24	7-ketolithocholic acid	1.3135	106.28±8.64	122.72±17.24	113.67±23.65
						25	4-methyl phenyl triazole	1.2014	122.8±50.77	140.93±41.17	166.85±51.91
26	PC(14:0/P-18:0)	1.1994	142.65±195.68	261.11±230.23	230.84±212.5
						27	Stearic acid	1.186	107.75±10.19	95.28±11.24	104.16±13.93
28	2,4-diaminobutyric acid	1.1764	87.6±51.48	125.71±73.78	129.09±22.18
						29	L-acetyl carnitine	1.1518	192.74±13.64	106.55±15.75	40.34±2.85
30	PC(o-18:0/18:2(9Z，12Z))	1.1509	114.45±59.02	165.03±103.7	259.43±218.27
						31	L-histidine	1.1503	287.32±124.65	334.71±137.36	260.13±251.88
32	L-acetyl carnitine	1.1489	192.98±13.7	107±15.33	40.04±2.22
						33	Nicotinamide	1.1292	153.81±12.64	141.02±13.48	131.31±12.47
34	L-leucine	1.1243	84.96±9.09	86.53±7.42	103.93±5.85
						35	Creatinine	1.1001	89.3±5.72	85.95±8.12	45.62±3.84
36	D-glucose	1.0878	12.47±3.87	9.1±3.71	6.63±2.16
						37	Adenine	1.0434	143.22±30.24	108.78±18.58	81.85±29.57
38	3-hydroxy-3-methyl-2-oxobutanoic acid	1.0161	90.06±16.61	147.36±72.56	193.03±87.74
						39	PC(16:1(9Z)/22:2(13Z，16Z))	1.004	92.75±66.76	101.84±73.86	105.85±65.94

TABLE 3

NO	Metabolic pathways	Total	Hits	FDR	Impact
							1	Histidine metabolism	16	2	0.5070	0.4098
2	Metabolism of phenylalanine	10	1	1.0000	0.2381
						3	Niacin and nicotinamide metabolism	15	1	1.0000	0.1943
4	Arginine and proline metabolism	38	5	0.0310	0.1818
						5	Metabolism of glycerophospholipids	36	2	1.0000	0.1038

Example 10:

effect of olanzapine on mRNA expression of key enzymes in lung squamous carcinoma cells:

the main reagents are as follows: reverse transcription kit KR116-02 (Tiangen Biochemical technology Co., ltd.); fluorescence quantitative kit P205-02 (Tiangen Biochemical technology Co., ltd.); primers (Huada Gene Co., ltd.). The details are shown in Table 4.

TABLE 4

Name (R)	Primer sequences
		c-MYC	F:5-GTGCCACGTCTCCACACATCAG-3
	R:5-CCTTGGGGGCCTTTTCATTGTTTTC-3
		GS	F:5- AAAATGTCCCTCCGTTCTTATGG -3
	R:5- CTGAAGTTGAGCGTAATACCAGT-3
		GLS	F:5- AGGGTCTGTTACCTAGCTTGG-3
	R:5-ACGTTCGCAATCCTGTAGATTT-3
			R:5- AGTCATCCGTGCGATATGCTC -3
GLUD	F:5- GGGATTCTAACTACCACTTGCTCA-3
			R:5- AACTCTGCCGTGGGTACAAT-3
HKII	F:5-GAGCCACCACTCACCCTACT-3
			R:CCAGGCATTCGGCAATGTG-3
GAPDHS	F:5-CTCACCGGATGCACCAATGTT-3
			R:CGCGTTGCTCACAATGTTCAT-3
PK	F:5-TCAAGGCCGGGATGAACATTG-3
			R:CTGAGTGGGGAACCTGCAAAG-3
PDH	F:5-AAGAGGCGCTTTCACTGGAC-3
			R:ACTAACCTTGTATGCCCCATCA-3
CS	F:5-AACTGCTACCCAAGGCTAAGG-3
			R:CTTTTGAGAGCCAAGATACCTGT-3
IDH	F:5-TGTGGTAGAGATGCAAGGAGA-3
			R:TTGGTGACTTGGTCGTTGGTG-3
SDH	F:5-CAAACAGGAACCCGAGGTTTT-3
			R:CAGCTTGGTAACACATGCTGTAT-3
Mdh	F:5-GGTGCAGCCTTAGATAAATACGC-3
			R:AGTCAAGCAACTGAAGTTCTCC-3
LDH	F:5-ATGGCAACTCTAAAGGATCAGC-3
			R:CCAACCCCAACAACTGTAATCT-3
β-actin	F:5-C TGTGATGGTGGGAATGGGTCAG-3
			R:5- TTTGATGTCACGCACGATTTCC-3

The experimental method comprises the following steps: the same as in example 1.

The experimental results are as follows:

key enzymes to the glutamine metabolic pathway: the mRNA expression level of C-Myc, GLUD, GLS and Glutamine Synthetase (GS) is detected, and as shown in the result of FIG. 23, after the lung squamous carcinoma cell H520 and olanzapine are cultured for 72H, the expression of C-MYC, GLUD, GLS and GS is remarkably reduced and is dose-dependent.

Key enzymes to glycolysis and the TCA cycle pathway: hexokinase (HKII), glyceraldehyde-3-Phosphate Dehydrogenase (gapdh), pyruvate Kinase (Pyruvate Kinase, PK), pyruvate Dehydrogenase (Pyruvate Dehydrogenase, PDH), citrate Synthase (CS), isocitrate Dehydrogenase (IDH), succinate Dehydrogenase (SDH), malate Dehydrogenase (MDH), lactate Dehydrogenase (LDH), and mRNA expression level were examined, and expression of the relevant genes was significantly reduced and dose-dependent after 72 hours of co-culture of lung squamous cancer cells H520 and olanzapine. Olanzapine eventually causes apoptosis by inhibiting glutamate metabolism, glycolysis and the TCA cycle pathway.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents or improvements made within the spirit and principle of the present invention should be included in the scope of the present invention.

Claims

1. The application of the aldose reductase stopping agent in preparing the medicine for treating the lung cancer is characterized in that the effective components of the aldose reductase stopping agent are olanzapine compounded with quercetin and baicalin, and the lung cancer is non-small cell lung squamous carcinoma.

2. The use according to claim 1, wherein the aldose reductase inhibitor in the medicament is capable of inhibiting glutamine metabolism in lung cancer cells.

3. The use according to claim 1, wherein the aldose reductase inhibitor in the medicament is capable of inhibiting glycolysis of a lung cancer cell.

4. The use as claimed in claim 1, wherein the aldose reductase inhibitor in the medicament is capable of inhibiting TCA cycle TCA in lung cancer cells.

5. The use according to any one of claims 1 to 4, wherein the medicament for treating lung cancer further comprises a pharmaceutically acceptable carrier and adjuvant, and the medicament is administered orally.