CN115245144A - Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof - Google Patents

Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof Download PDF

Info

Publication number
CN115245144A
CN115245144A CN202210545044.7A CN202210545044A CN115245144A CN 115245144 A CN115245144 A CN 115245144A CN 202210545044 A CN202210545044 A CN 202210545044A CN 115245144 A CN115245144 A CN 115245144A
Authority
CN
China
Prior art keywords
omega
lys
leu
pigs
pig
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210545044.7A
Other languages
Chinese (zh)
Inventor
牛冬
汪滔
马翔
王磊
曾为俊
程锐
赵泽英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Qizhen Genetic Engineering Co Ltd
Original Assignee
Nanjing Qizhen Genetic Engineering Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Qizhen Genetic Engineering Co Ltd filed Critical Nanjing Qizhen Genetic Engineering Co Ltd
Priority to CN202210545044.7A priority Critical patent/CN115245144A/en
Publication of CN115245144A publication Critical patent/CN115245144A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0656—Adult fibroblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Environmental Sciences (AREA)
  • Cell Biology (AREA)
  • Animal Husbandry (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Rheumatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kit for preparing a pig rich in omega-3fatty acid, and a preparation method and application thereof. The invention provides a breeding method of pigs, which comprises the following steps: (1) Integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses omega-3fatty acid desaturase-1; (2) Cloning the recombinant pig cells obtained in the step (1) by somatic cells to obtain cloned pigs, namely breeding pigs; the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining pigs with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.

Description

Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof
Technical Field
The invention belongs to the technical field of biology, and relates to a kit for preparing a pig rich in omega-3fatty acid, and a preparation method and application thereof.
Background
Fatty acids play a role in energy supply to the body, cell membrane formation, and the like, and fatty acids having 2 or more double bonds in their carbon chains are called polyunsaturated fatty acids (PUFAs), and among them, the most important PUFAs include both omega-6 and omega-3. Omega-6 has the effect of protecting cells, and is an important nutrient substance for helping to regulate the metabolic function of the body, promoting immune response, promoting platelet aggregation and the like. However, excessive intake of the drug can cause inflammation of the human body, which causes problems in the endocrine and immune systems. When the ratio of omega-6 to omega-3 is unbalanced, the human body is adversely affected, which is mainly because PG2 generated by linoleic acid derivative ARA (arachidonic acid) in omega-6 can promote inflammation, if the condition can not be improved in time, the human body is in chronic low-grade inflammation for a long time, and the three-high, cardiovascular diseases or autoimmune diseases, such as heart disease, arthritis, stroke, cancer, lupus erythematosus and the like, can be caused. Reduction of the omega-6/omega-3 ratio in vivo has been shown to be effective in alleviating these conditions. Because omega-3 desaturase genes are absent in the genome of vertebrates, including humans, and omega-3 PUFAs cannot be synthesized de novo, one can only meet the normal physiological needs of the human body by ingesting omega-3 in food. Omega-6 polyunsaturated fatty acids are abundant in food sources, and the omega-6 content in vegetable oil and meat which are frequently eaten by people is not enough. Food sources rich in omega-3 are scarce, so that modern people generally take too much omega-6, and the intake of omega-3 is insufficient.
Meat is the main source of protein, mineral, fat and other nutrient components of modern human beings. With the continuous improvement of the life quality of people, the requirements of people on meat gradually change from the requirements on taste to the requirements on the safety and health of meat. Chinese people like to eat pork, which is related to the diet culture of thousands of years. Since 2000 years, pork accounts for over 70% of the meat consumption in China, and is the most important meat consumed in China. If pork rich in omega-3 and having a low omega-6/omega-3 ratio could be produced, consumption of such pork would be beneficial to human health.
Gene editing is a biotechnology that has been under significant development in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, with CRISPR/Cas9 technology being the most advanced gene editing technology at present. Currently, gene editing techniques are increasingly applied to genetic improvement of livestock.
Disclosure of Invention
The invention relates to a kit for preparing pigs rich in omega-3fatty acid, a preparation method and application thereof.
The invention provides a breeding method of pigs, which comprises the following steps:
(1) Integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses omega-3fatty acid desaturase-1;
(2) Preparing a cloned pig from the recombinant pig cell obtained in the step (1) through somatic cell cloning;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining pigs with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
The cloned pig is a pig obtained by breeding.
The offspring obtained by taking the cloned pig as a parent is the pig obtained by breeding.
The invention provides a method for preparing recombinant porcine cells, which comprises the following steps: integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses omega-3fatty acid desaturase-1.
Specifically, the omega-3fatty acid desaturase-1 is shown as SEQ ID NO: as shown at 19.
Specifically, in the DNA molecule A, the fat1 gene encodes omega-3fatty acid desaturase-1.
fat1 gene information: caenorhabditis elegans; the GeneID was 178291.
Specifically, the fat1 gene is shown as SEQ ID NO:20 from 2279 to 3487.
Specifically, the DNA molecule A has a fat1 gene expression cassette.
In the fat1 gene expression cassette, the expression of fat1 gene is driven by the human hEF1 α promoter.
The fat1 gene expression cassette has Poly (a) downstream of the fat1 gene.
Specifically, the Poly (A) is EF1 alpha Poly (A).
Specifically, the human hEF1 alpha promoter is shown as SEQ ID NO:20, nucleotides 1088-2266.
Specifically, EF1 alpha Poly (A) is shown as SEQ ID NO:20 from nucleotide 3510 to 4082.
Specifically, the fat1 gene expression cassette is shown as SEQ ID NO:20 from nucleotide 1088 to nucleotide 4082.
Specifically, the DNA molecule A has a resistance screening gene expression cassette.
The resistance selection gene may be a gene encoding a resistance selection protein.
The resistance screening protein is specifically Puromycin resistance protein.
Specifically, the resistance screening gene expression cassette is shown as SEQ ID NO:20 from nucleotide 4279 to nucleotide 5554.
The DNA molecule A also comprises a LoxP sequence.
The DNA molecule A specifically comprises 2 LoxP sequences which are respectively shown as SEQ ID NO:20, nucleotides 4203 to 4236 and nucleotides 5599 to 5632.
The DNA molecule A also comprises an insulator.
The DNA molecule A specifically comprises 2 insulators which are respectively shown as SEQ ID NO: nucleotides 887-1087 and nucleotides 5641-5841 of 20.
The DNA molecule A sequentially comprises the following sections from upstream to downstream: human hEF1 alpha promoter, fat1 gene, EF1 alpha Poly (A), loxP sequence, SV40 promoter, nucleotide for coding Puromycin resistance protein, SV40 Poly (A) and LoxP sequence.
The DNA molecule A sequentially comprises the following sections from upstream to downstream: insulator 1, human hEF1 alpha promoter, fat1 gene, EF1 alpha Poly (A), loxP sequence, SV40 promoter, nucleotide for coding Puromycin resistance protein, SV40 Poly (A), loxP sequence and insulator 3.
Specifically, the DNA molecule A is shown as SEQ ID NO:20 from nucleotide 887 to nucleotide 5841.
Specifically, the DNA molecule A is shown as SEQ ID NO: nucleotide numbers 881-5841 of 20.
The mode of integrating the DNA molecule named DNA molecule A into the genome DNA of the pig cell is as follows: introducing a DNA molecule designated as DNA molecule B into a pig cell or introducing a recombinant plasmid having the DNA molecule B into a pig cell; and in the DNA molecule B, the DNA molecule A is provided, an upstream homology arm is arranged at the upstream of the DNA molecule A, and a downstream homology arm is arranged at the downstream of the DNA molecule A, and the upstream homology arm and the downstream homology arm are used for integrating the DNA molecule A into the genome DNA of the pig cells.
The homology arm is directed at the COL1A1 gene, the upstream homology arm is an SH4 left arm, and the downstream homology arm is an SH4 right arm. The left arm of SH4 is shown as SEQ ID NO:20, nucleotides 9-880, and the right arm of SH4 is shown in SEQ ID NO: nucleotides 5842 to 6568 of 20.
The DNA molecule B sequentially comprises the following sections from upstream to downstream: an upstream homology arm, an insulator 1, a human hEF1 alpha promoter, a fat1 gene, EF1 alpha Poly (A), a LoxP sequence, an SV40 promoter, a nucleotide encoding Puromycin resistance protein, SV40 Poly (A), a LoxP sequence, an insulator 3 and a downstream homology arm.
Specifically, the DNA molecule B is shown as SEQ ID NO: nucleotides 9-6568 of 20.
Specifically, the recombinant plasmid with the DNA molecule B is shown as SEQ ID NO: shown at 20.
Specifically, the DNA molecule A is integrated into the COL1A1 gene of the genomic DNA of the pig cells.
Specifically, the DNA molecule a is integrated into the COL1A1 safe harbor insertion site of the genomic DNA of the pig cells.
The integration of the DNA molecule A into the COL1A1 gene of the genomic DNA of the pig cells means that the DNA molecule A is inserted into the genomic DNA between the SH4 left arm and the SH4 right arm; the left arm of SH4 is shown as SEQ ID NO:20, nucleotides 9-880, and the right arm of SH4 is shown in SEQ ID NO: nucleotide numbers 5842-6568 of 20.
In the method, a recombinant plasmid having the DNA molecule B is introduced into a pig cell together with two gRNAs (COL 1A1-gRNA1 and COL1A1-gRNA 3) and NCN protein.
The mass ratio of the recombinant plasmid with the DNA molecule B, the COL1A1-gRNA1, the COL1A1-gRNA3 and the NCN protein can be specifically 3:1:1:4.
the proportion of the pig cells, the recombinant plasmid with the DNA molecule B, the COL1A1-gRNA1, the COL1A1-gRNA3 and the NCN protein can be specifically as follows: 10 ten thousand porcine primary fibroblasts: 3 μ g of recombinant plasmid: 1 μ g COL1A1-gRNA1:1 μ g COL1A1-gRNA3: mu.g NCN protein.
Specifically, the COL1A1 safe harbor insertion site and the peripheral region thereof in the pig genome are shown as SEQ ID NO:25, respectively.
The invention also protects the recombinant porcine cells prepared by any one of the methods.
Specifically, the recombinant porcine cell can be a recombinant porcine cell as follows: compared with the pig cell (wild-type pig cell of the same source), the genomic DNA of the recombinant pig cell only differs in that: the gene sequence shown in SEQ ID NO:20 at nucleotides 881-5841.
The recombinant porcine cells are homozygous recombinant (i.e., the DNA molecules A are integrated at the same positions on two homologous chromosomes, respectively).
The recombinant porcine cells are heterozygous recombinant (i.e., the DNA molecule A is integrated into a homologous chromosome).
The recombinant porcine cells are homozygous recombinant (namely, DNA molecules shown as nucleotides 881-5841 in SEQ ID NO:20 are inserted between the left arm and the right arm of SH4 of two homologous chromosomes).
The recombinant porcine cells are heterozygous (i.e., a DNA molecule represented by nucleotides 881-5841 in SEQ ID NO:20 is inserted between the left arm of SH4 and the right arm of SH4 of a homologous chromosome).
The invention also protects the application of the recombinant porcine cells in breeding of pigs.
The invention also provides a breeding method of pigs, which comprises the following steps: and cloning the recombinant porcine cells by somatic cells to obtain cloned pigs.
The cloned pig is a pig obtained by breeding.
The offspring obtained by using the cloned pig as a parent is the pig obtained by breeding.
The invention also provides a kit comprising any one of the DNA molecules B.
The invention also provides a kit which comprises the recombinant plasmid containing any one of the DNA molecules B.
The kit also includes two grnas (COL 1A1-gRNA1 and COL1A1-gRNA 3).
The kit also includes an NCN protein.
The mass ratio of the recombinant plasmid with the DNA molecule B, the COL1A1-gRNA1, the COL1A1-gRNA3 and the NCN protein can be specifically 3:1:1:4.
the kit also comprises a PRONCN protein.
The kit also comprises a specific plasmid.
The kit also includes porcine cells.
The invention also protects the application of any one of the DNA molecules B in the preparation of the kit.
The invention also protects the application of the recombinant plasmid with any one of the DNA molecules B in the preparation of a kit.
The invention also protects the application of the recombinant plasmid with any one of the DNA molecules B, two gRNAs (COL 1A1-gRNA1 and COL1A1-gRNA 3) and NCN protein in preparation of a kit.
The application of any one of the above kits is as follows (I) or (II): preparing a recombinant pig cell; (II) Breeding of pigs.
The invention also protects the application of any one of the DNA molecules B, the recombinant plasmid with any one of the DNA molecules B or any one of the kits, and the application is as follows (I) or (II): preparing a recombinant pig cell; (II) breeding pigs.
The breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
The ratio ω -6/ω -3 refers to: mass ratio of omega-6 fatty acids to omega-3fatty acids.
Omega-3fatty acids are omega-3fatty acids in muscle.
Omega-6 fatty acids are omega-6 fatty acids in muscle.
The increase in omega-3fatty acid content is relative to a cloned pig prepared from wild-type pig cells of the same source.
The reduction in omega-6 fatty acid content is relative to a cloned pig prepared from wild type pig cells from the same source.
The decrease in the omega-6/omega-3 ratio is relative to a cloned pig prepared from wild type pig cells from the same source.
Omega-3fatty acids refer to total omega-3fatty acids.
Omega-6 fatty acids refer to total omega-6 fatty acids.
Omega-3fatty acids refer to ALA (alpha-linolenic acid), EPA (eicosapentaenoic acid), DPA (docosapentaenoic acid) and DHA (docosahexaenoic acid). Omega-6 fatty acids refer to LA (linoleic acid) and AA (eicosatetraenoic acid).
grnas are also known as sgrnas.
The target sequence binding region of COL1A1-gRNA1 is shown in SEQ ID NO: nucleotides 3 to 22 of 23. Specifically, COL1A1-gRNA1 is shown as SEQ ID NO: shown at 23.
The target sequence binding region of COL1A1-gRNA3 is shown in SEQ ID NO: nucleotides 3 to 22 of 24. Specifically, the COL1A1-gRNA3 is shown as SEQ ID NO: as shown at 24.
The target sequence binding region refers to a region of the sgRNA that binds to a target sequence (the target sequence is located in a target region of a target gene).
The NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein.
Specifically, the NCN protein is shown as SEQ ID NO:3, respectively.
The preparation method of the NCN protein comprises the following steps:
(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain recombinant bacteria;
(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;
(3) Crushing the collected thalli, and collecting a crude protein solution;
(4) Purification of the crude protein solution with His by affinity chromatography 6 A fusion protein of the tag;
(5) By using a compound having His 6 Tagged enterokinase cleavage with His 6 The tagged fusion protein was then removed with His using Ni-NTA resin 6 A tagged protein, resulting in a purified NCN protein;
plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotide 5209-9852.
The preparation method of the NCN protein specifically comprises the following steps:
(1) The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.
(2) Inoculating the recombinant bacteria obtained in the step (1) to a liquid LB culture medium containing ampicillin, and performing shake culture;
(3) Inoculating the bacterial liquid obtained in the step (2) to a liquid LB culture medium, and carrying out shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD 600nm The value =1.0, then IPTG was added to make the concentration in the system 0.5mM, followed by shaking culture at 230rpm at 25 ℃ for 12 hours, and then the cells were collected by centrifugation;
(4) Taking the thalli obtained in the step (3), and washing the thalli with a PBS (phosphate buffer solution);
(5) Adding the crude extraction buffer solution into the thalli obtained in the step (4), suspending the thalli, then crushing the thalli, then centrifugally collecting supernate, filtering by adopting a filter membrane with the aperture of 0.22 mu m, and collecting filtrate;
(6) Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His 6 A fusion protein of the tag (the fusion protein shown in SEQ ID NO: 2);
(7) Taking the solution after column chromatography collected in the step (6), concentrating by using an ultrafiltration tube, and then diluting with 25mM Tris-HCl (pH8.0);
(8) Will have His 6 Adding the labeled recombinant bovine enterokinase into the solution obtained in the step (7), and performing enzyme digestion;
(9) Mixing the solution obtained in the step (8) with Ni-NTA resin, incubating, centrifuging and collecting supernatant;
(10) And (5) taking the supernatant obtained in the step (9), concentrating by using an ultrafiltration tube, and then adding the supernatant into an enzyme stock solution to obtain the NCN protein solution.
Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His 6 The specific method of the tagged fusion protein is as follows:
firstly, balancing a Ni-NTA agarose column by using a balancing solution with 5 column volumes (the flow rate is 1 ml/min); then, 50ml of the filtrate obtained in the step (5) is loaded (the flow rate is 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.
Any one of the PRONCN proteins sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, cas9 protein, nuclear localization signal.
The signal peptide has the function of promoting protein secretion expression. The signal peptide may be selected from the group consisting of the escherichia coli alkaline phosphatase (phoA) signal peptide, the staphylococcus aureus protein a signal peptide, the escherichia coli outer membrane protein (ompa) signal peptide or the signal peptide of any other prokaryotic gene, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The signal peptide of alkaline phosphatase is used to guide the secretory expression of the target protein into the bacterial periplasm cavity so as to be separated from the protein in the bacterial cell, and the target protein secreted into the bacterial periplasm cavity is soluble expression and can be cleaved by the signal peptidase in the bacterial periplasm cavity.
The chaperone protein functions to increase the solubility of the protein. The chaperone may be any protein that helps to form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can be used as a molecular chaperone to help a co-expressed target protein (such as a Cas9 protein) to form a disulfide bond, so that the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased.
The protein tag functions for protein purification. The Tag can be His Tag (His-Tag, his) 6 Protein tag), GST tag, flag tag, HA tag, c-Myc tag, or any other protein tag, more preferably His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, so that the purification process of the target protein can be greatly simplified.
The protease cleavage site functions to cleave non-functional segments after purification to release the native form of the Cas9 protein. The protease may be selected from Enterokinase (Enterokinase), factor Xa (Factor Xa), thrombin (thrombobin), TEV protease (TEV protease), HRV 3C protease (HRV 3C protease), WELQut protease or any other endoprotease, further preferably Enterokinase. EK is an enterokinase enzyme cutting site, so that fused TrxA-His segment can be conveniently cut by enterokinase to obtain the Cas9 protein in a natural form. After the commodity enterokinase enzyme digestion fusion protein with the His label is used, the TrxA-His section and the enterokinase with the His label can be removed through once affinity chromatography to obtain the Cas9 protein in a natural form, and the damage and the loss of the target protein caused by repeated purification and dialysis are avoided.
The nuclear localization signal may be any nuclear localization signal, preferably an SV40 nuclear localization signal and/or a nucleocapsin nuclear localization signal. NLS is a nuclear localization signal, and NLS sites are respectively designed at the N end and the C end of Cas9, so that Cas9 can more effectively enter a cell nucleus for gene editing.
The Cas9 protein may be saCas9 or spCas9, preferably is a spCas9 protein.
The PRONCN protein is specifically shown as SEQ ID NO:2, respectively.
Any one of the specific plasmids comprises the following elements from upstream to downstream in sequence: promoter, operator, ribosome binding site, PRONCN protein coding gene and terminator.
The promoter may specifically be a T7 promoter. The T7 promoter is a prokaryotic expression strong promoter and can efficiently drive the expression of exogenous genes.
The operon may specifically be a Lac operon. The Lac operon is a regulatory element for lactose-induced expression, and IPTG can be used for inducing the expression of the target protein at low temperature after bacteria grow to a certain amount, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein can be obviously improved by inducing expression at low temperature.
The ribosome binding site is a ribosome binding site for protein translation, and is essential for protein translation.
The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, and prevent other downstream sequences except the target gene from being transcribed and translated.
For the codon of the spCas9 protein, the codon is optimized, so that the codon preference of the escherichia coli high-efficiency expression strain E.coli BL21 (DE 3) selected by the application is completely adapted, and the expression level of the Cas9 protein is improved.
The T7 promoter is shown as SEQ ID NO:1 from nucleotide 5121 to nucleotide 5139.
The Lac operon is shown as SEQ ID NO:1 from nucleotide 5140 to nucleotide 5164.
The ribosome binding site is shown as SEQ ID NO:1 from nucleotide 5178 to 5201.
The coding sequence of the alkaline phosphatase signal peptide is shown as SEQ ID NO:1, nucleotides 5209-5271.
The coding sequence of the TrxA protein is shown as SEQ ID NO:1, nucleotides 5272-5598.
The coding sequence of His-Tag is shown in SEQ ID NO:1, nucleotides 5620-5637.
The coding sequence of the enterokinase enzyme cutting site is shown as SEQ ID NO:1 from nucleotide 5638 to 5652.
The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 5656 to nucleotide 5670.
The coding sequence of the spCas9 protein is shown in SEQ ID NO:1, nucleotides 5701-9801.
The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1, nucleotides 9802 to 9849.
The T7 terminator is shown as SEQ ID NO: nucleotides 9902-9949 of 1.
Specifically, the specific plasmid is plasmid pKG-GE4.
Plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotides 5121-9949.
Specifically, any one of the plasmids pKG-GE4 is shown as SEQ ID NO:1 is shown.
The porcine cells are porcine primary fibroblasts.
The pig can be any variety of pig, and preferably, the pig can be a fragrant pig from Jiang.
The pig may be a newborn pig.
The cloned pig prepared by somatic cell cloning of the recombinant pig cell can be prepared by the following method:
(1) Taking an isolated ovary, extracting Cumulus-oophorus oocyte complexes (COCs) from a follicle with the diameter of 3-6 mm, and selectingSelecting COCs having at least three layers of compact cumulus cells, inoculating into 4-well plate, each well containing 400 μ L of porcine oocytes in vitro maturation medium, inoculating 50 per well, each well covered with 400 μ L of mineral oil, incubating the plate containing COCs at 38.5 deg.C, 5% 2 And culturing for 42 hours in an incubator with saturated humidity;
(2) After completion of step (1), repeatedly blowing up the expanded cumulus cells from which COCs are removed with 0.1% (w/v) hyaluronidase, culturing the oocytes having intact membranes and containing the first polar body discharged in NCSU23 medium containing 0.1mg/mL dimethoxine, 0.05M sucrose and 4mg/mL bovine serum albumin for 0.5-1h to promote the protrusion of the oocyte nucleus, and then removing the protruded nucleus and polar body in Tyrode lactic acid medium containing 10. Mu.M HEPES, 0.3% (w/v) polyvinylpyrrolidone, 10% FBS, 0.1mg/mL dimethoxine and 5mg/mL cytochalasin B using a tip-tipped microinjection needle; then, a single nuclear donor cell was injected into the perivitelline space of the enucleated oocyte, and the nuclear donor cell was fused with the recipient oocyte for 20. Mu.s with a direct current pulse of 200V/mm in a fusion medium using an embryo cell fusion instrument; the reconstituted embryos were then cultured in PZM-3 medium for 2h to allow nuclear reprogramming, and then activated with a single pulse of 150V/mm for 100 μ s in activation medium; the activated reconstituted embryos are then placed in PZM-3 medium containing 5. Mu.g/mL cytochalasin B and incubated for 2 hours to further activate the embryos; then placing the reconstructed embryo in a PZM-3 culture medium for culture;
(3) Transplanting the activated and cultured 6h reconstructed embryo into the oviduct of the surrogate sow, and normally feeding to obtain offspring, namely the cloned pig.
The surrogate sow can be Erhualian sow.
The surrogate pregnant sow can be a 9-month-old Erhualian sow.
The kit provided by the invention adopts a CRISPR/Cas9 system and a homologous recombination technology to prepare the recombinant porcine cell integrating the DNA molecule A at a specific position of a genome, wherein the DNA molecule A expresses omega-3fatty acid desaturase-1. The recombinant cell can be used as a nuclear transfer donor cell to prepare a cloned pig, and the cloned pig has the following properties: the content of omega-3fatty acid is increased, the content of omega-6 fatty acid is reduced, and the ratio of omega-6/omega-3 is reduced.
The invention can be used in the field of livestock production and has application and popularization values for pig breeding with improved pork quality and improved breeding quality.
Drawings
FIG. 1 is a schematic diagram of the structure of plasmid pET-32 a.
FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE4.
FIG. 3 is an electrophoretogram of optimized dosage ratio of gRNA and NCN protein in example 1.
Fig. 4 is an electrophoretogram comparing gene editing efficiency of NCN protein and a commercial Cas9 protein in example 1.
FIG. 5 is a schematic structural view of plasmid PB-1G 2R 3-puro-ROSA 26.
FIG. 6 is a graph of the green fluorescence expression of GFP regulated by different harbor safety loci.
FIG. 7 shows the fluorescent quantitative PCR results of the transcriptional level of GFP gene regulated by different safe harbor loci.
FIG. 8 shows the results of FACS detection of the expression of GFP regulated by different safe harbor sites.
FIG. 9 is a structural diagram of plasmid pKG-EF1 α -fat1.
FIG. 10 shows the sequencing results of the COL1A1 gene sequence and the insulator 1 adaptor sequence.
FIG. 11 shows the sequencing results of the adaptor sequences of insulator 1 and the human EF 1. Alpha. Promoter.
FIG. 12 shows the sequencing results of the human EF 1. Alpha. Promoter and the junction sequence of fat1 gene.
FIG. 13 shows the sequencing results of the adapter sequence of fat1 gene and EF 1. Alpha. Poly (A).
FIG. 14 shows the sequencing results of the adaptor sequence of LoxP (a part of the expression cassette of Puromycin gene) and insulator 3.
FIG. 15 shows the sequencing results of the adaptor sequence of insulator 3 and COL1A1 gene sequences.
FIG. 16 shows the results of testing the transcription level of fat1 gene of single cell clones.
Fig. 17 is a photograph of a cloned pig.
FIG. 18 shows the results of the detection of fat1 gene expression levels in cloned pigs.
FIG. 19 is the results of the fatty acid content of cloned pigs.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence-verified. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃,5% of CO 2 、5％O 2 The constant temperature incubator.
The porcine primary fibroblasts used in the examples were prepared from porcine ear tissue, which was freshly obtained from Jiangxiang pigs. The method for preparing the primary pig fibroblast comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging at 500g for 5min, and discarding the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, then spreading into a 10 cm-diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.
Plasmid pKG-GE3, a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:2, respectively. Patent application 202010084343.6 SEQ ID NO:2, the nucleotide 395-680 constitutes CMV enhancer, the nucleotide 682-890 constitutes EF1a promoter, the nucleotide 986-1006 encodes Nuclear Localization Signal (NLS), the nucleotide 1016-1036 encodes Nuclear Localization Signal (NLS), the nucleotide 1037-5161 encodes Cas9 protein, the nucleotide 5162-5209 encodes Nuclear Localization Signal (NLS), the nucleotide 5219-5266 encodes Nuclear Localization Signal (NLS), the nucleotide 5276-5332 encodes P2A peptide (the amino acid sequence of P2A peptide is "ATNFLKQACGDVEENPGP", the cleavage site is between the first and second amino acid residues from the C-terminal), the nucleotide 5333-6046 encodes EGFPEGFP protein, the nucleotide 6056-6109 encodes T2A peptide (the amino acid sequence of T2A peptide is "EGRGSLGDVEENPGP", the cleavage site is between the first and second amino acid residues from the C-terminal), the nucleotide 682-890 encodes Puror 6703 resistance protein (Puror 6703-amino acid residue for short) R Protein), nucleotides 6722-7310 to form a WPRE sequence element, nucleotides 7382-7615 to form a 3' LTR sequence element, and nucleotides 7647-7871 to form a bGH poly (A) signal sequence element. SEQ ID NO:2, the 911-6706 th nucleotides form fusion gene to express fusion protein. Due to the presence of P2A peptide and T2A peptide, the fusion protein spontaneously forms the following three proteins: protein having Cas9 protein, protein having EGFP protein, and protein having Puro R A protein of a protein.
The pKG-U6gRNA vector, plasmid pKG-U6gRNA, is a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:3, respectively. SEQ ID NO:3, the 2280 th to 2539 th nucleotides form the hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) of about 20bp is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA.
Example 1 preparation, purification and Performance of NCN protein
1. Construction of prokaryotic Cas9 high-efficiency expression vector
The structure of plasmid pET-32a is schematically shown in FIG. 1.
The plasmid pKG-GE4 is obtained by modifying plasmid pET-32a serving as a starting plasmid. Plasmid pET32a-T7lac-phoA SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (plasmid pKG-GE4 for short), as shown in SEQ ID NO:1, is a circular plasmid, and the structural schematic diagram is shown in figure 2.
SEQ ID NO:1, the 5121-5139 th nucleotide constitutes T7 promoter, the 5140-5164 th nucleotide encodes Lac operator (Lac operator), the 5178-5201 th nucleotide constitutes Ribosome Binding Site (RBS), the 5209-5271 th nucleotide encodes alkaline phosphatase signal peptide (phoA signal peptide), the 5272-5598 th nucleotide encodes TrxA protein, and the 5620-5637 th nucleotide encodes His-Tag (also called His-Tag) 6 Tag), 5638-5652 nucleotides encode enterokinase cleavage site (EK cleavage site), 5656-5670 nucleotides encode nuclear localization signal, 5701-9801 nucleotides encode spCas9 protein, 9802-9849 nucleotides encode nuclear localization signal, and 9902-9949 nucleotides constitute T7 terminator. The nucleotides encoding the spCas9 protein have been codon optimized for the e.coli BL21 (DE 3) strain.
The main modifications of plasmid pKG-GE4 are as follows: (1) the encoding region of the TrxA protein is reserved, and the TrxA protein can help the expressed target protein to form a disulfide bond and increase the solubility and the activity of the target protein; adding a coding sequence of an alkaline phosphatase signal peptide in front of a coding region of the TrxA protein, wherein the alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the membrane of the bacterium and can be cut by a prokaryotic periplasmic signal peptidase; (2) adding a coding sequence of His-Tag after the coding sequence of the TrxA protein, wherein the His-Tag can be used for enriching the expressed target protein; (3) adding a coding sequence of an enterokinase enzyme cutting site DDDDDDK (Asp-Asp-Asp-Asp-Lys) at the downstream of a coding sequence of the His-Tag, and removing the His-Tag and the upstream fused TrxA protein by the purified protein under the action of enterokinase; (4) the Cas9 gene which is suitable for the expression of an escherichia coli BL21 (DE 3) strain after codon optimization is inserted, and meanwhile, the nuclear localization signal coding sequence is added at the upstream and the downstream of the gene, so that the nuclear localization capability of the Cas9 protein purified at the later stage is improved.
The fusion gene in plasmid pKG-GE4 is shown in SEQ ID NO:1, nucleotides 5209 to 9852 of SEQ ID NO:2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the existence of the alkaline phosphatase signal peptide and the enterokinase enzyme cutting site, the fusion protein is cut by enterokinase enzyme to form SEQ ID NO:3, and SEQ ID NO:3 is designated as NCN protein.
2. Inducible expression
1. The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.
2. The recombinant strain obtained in step 1 was inoculated into a liquid LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 37 ℃ with shaking at 200 rpm.
3. Inoculating the bacterial liquid obtained in the step 2 to a liquid LB culture medium, and carrying out shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD 600nm The value =1.0, isopropyl thiogalactoside (IPTG) was added to the system to give a concentration of 0.5mM, and the system was cultured at 25 ℃ for 12 hours with shaking at 230rpm, and then centrifuged at 4 ℃ for 15 minutes at 10000g, and the cells were collected.
4. The cells obtained in step 3 were washed with PBS buffer.
3. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS
1. And (3) adding the crude extraction buffer solution into the thalli obtained in the step two, suspending the thalli, then crushing the thalli by a homogenizer (1000 par circulation is carried out for three times), then centrifuging for 30min at 4 ℃ at 15000g, collecting supernate, filtering the supernate by a filter membrane with the aperture of 0.22 mu m, and collecting filtrate. In this step, 10ml of crude extraction buffer solution is prepared for each g of wet-weight thallus.
Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance ddH 2 O。
2. The fusion protein was purified by affinity chromatography.
Firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in step 1 was loaded (flow rate 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.
Ni-NTA agarose column: ausrey, L00250/L00250-C, 10ml of filler.
Balance liquid: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance ddH 2 O。
Buffer solution: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the balance ddH 2 O。
Eluent: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the balance ddH 2 O。
4. Enzyme digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein
1. 15ml of the post-column solution collected in step three was concentrated to 200. Mu.l using Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml) and then diluted to 1ml with 25mM Tris-HCl (pH 8.0). 6 ultrafiltration tubes were used to give a total of 6ml.
2. The product is obtained from commercial sources and has His 6 Tagged recombinant bovine enterokinase (Bio, C620031, recombinant bovine enterokinase light chain with His) 6 The tag, recombinant Bovine Enterokinase Light Chain, his), was added to the solution (about 6 ml) obtained in step 1, and cleaved at 25 ℃ for 16 hours. 2 units of enterokinase are added in the amount of each 50 mug protein.
3. The solution (about 6 ml) that completed step 2 was mixed with 480. Mu.l Ni-NTA resin (Kinseri, L00250/L00250-C), mixed by rotation at room temperature for 15min, then centrifuged at 7000g for 3min, and the supernatant (4-5.5 ml) was collected.
4. And (3) taking the supernatant obtained in the step (3), concentrating the supernatant to 200 mu l by using an Amicon ultrafiltration tube (Sigma, UFC9100, the volume of which is 15 ml), adding the concentrated solution into an enzyme stock solution, and adjusting the protein concentration to be 5mg/ml to obtain the NCN protein solution.
And (3) sequencing the protein in the NCN protein solution, wherein the 15N-terminal amino acid residues are shown as SEQ ID NO:3, positions 1 to 15, namely the NCN protein.
The NCN protein used in the subsequent steps and in the subsequent examples was provided by the NCN protein solution.
Enzyme stock solution (ph 7.4): containing 10mM Tris,300mM NaCl,0.1mM EDTA,1mM DTT,50% (by volume) glycerol, and the balance ddH 2 O。
5. Properties of NCN protein
The 2 gRNA targets targeting the TTN gene were selected as follows:
TTN-gRNA1 target: AGAGCACAGCTCAGCCTGGCG;
TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.
Primers used to identify target fragments comprising grnas in the TTN gene were as follows:
TTN-F55：TACGGAATTGGGGAGCCAGCGGA；
TTN-R560：CAAAGTTAACTCTCTGTGTCT。
1. preparation of gRNA
(1) Preparing TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template
The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:4, respectively.
The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:5, respectively.
(2) In vitro transcription to obtain gRNA
Taking TTN-T7-gRNA1 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA1.TTN-gRNA1 is single-stranded RNA, shown in SEQ ID NO: and 6.
Taking TTN-T7-gRNA2 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA2.TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: shown at 7.
2. gRNA and NCN protein dosage ratio optimization
(1) Co-transfected porcine primary fibroblasts
A first group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 0.5 μ g TTN-gRNA1:0.5 μ g TTN-gRNA2: mu.g NCN protein.
Second group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 0.75 μ g TTN-gRNA1:0.75 μ g TTN-gRNA2: mu.g NCN protein.
Third group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.
And a fourth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1.25 μ g TTN-gRNA1:1.25 μ g TTN-gRNA2: mu.g NCN protein.
And a fifth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.
Co-transfection was performed by electroporation using a mammalian Nuclear transfection kit (Neon kit, thermofisiher) with a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).
(2) After the step (1) is completed, the complete culture solution is adopted for culturing for 12 to 18 hours, and then the complete culture solution is replaced by a new complete culture solution for culturing. The total time of incubation after electroporation was 48 hours.
(3) After the completion of step (2), cells were collected by trypsinization, genomic DNA was extracted, PCR-amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.
The electrophoretogram is shown in FIG. 3. The 505bp band is wild type band (WT), and the about 254bp band (251 bp band is theoretically deleted from 505bp band of wild type) is deletion mutant band (MT).
Gene deletion mutation efficiency = (MT gray/MT band bp number)/(WT gray/WT band bp number + MT gray/MT band bp number) × 100%. The deletion mutation efficiency of the first group of genes is 19.9 percent, the deletion mutation efficiency of the second group of genes is 39.9 percent, the deletion mutation efficiency of the third group of genes is 79.9 percent, and the deletion mutation efficiency of the fourth group of genes is 44.3 percent. Group five was not mutated.
The result shows that when the mass ratio of the two gRNAs to the NCN protein is 1:1:4, the actual dosage is 1 mu g:1 μ g: the gene editing efficiency is highest at 4 mug. Thus, the optimal amount of two grnas and NCN proteins was determined to be 1 μ g:1 μ g:4 μ g.
3. Comparison of Gene editing efficiency of NCN protein with that of the commercial Cas9 protein
(1) Co-transfected porcine primary fibroblasts
Cas9-a group: co-transfecting the TTN-gRNA1, the TTN-gRNA2 and a commercial Cas9-A protein into a pig primary fibroblast. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-A protein.
pKG-GE4 group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.
Cas9-B set: co-transfecting TTN-gRNA1, TTN-gRNA2 and a commercial Cas9-B protein into a porcine primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-B protein.
Control group: co-transfecting the TTN-gRNA1 and the TTN-gRNA2 to the pig primary fibroblasts. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.
Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).
(2) After the step (1) is completed, the complete culture solution is adopted for culturing for 12 to 18 hours, and then the complete culture solution is replaced by new complete culture solution for culturing. The total time of incubation after electroporation was 48 hours.
(3) After completion of step (2), cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.
The electrophoretogram is shown in FIG. 4. The gene deletion mutation efficiency with the commercial Cas9-a protein was 28.5%, the gene deletion mutation efficiency with the NCN protein was 85.6%, and the gene deletion mutation efficiency with the commercial Cas9-B protein was 16.6%.
The result shows that compared with the Cas9 protein which adopts a commodity, the NCN protein prepared by the invention can obviously improve the gene editing efficiency.
Example 2 screening of optimal safe harbor site for site-directed insertion of foreign Gene into pig genome
1. Construction of different safe harbor site Donor vectors containing GFP Gene
Plasmids PB-1G 2R3-puro-ROSA 26, PB-1G 2R3-puro-AAVS 1, PB-1G 2R3-puro-H11, and PB-1G 2R3-puro-COL 1A1 were constructed. The four plasmids were circular plasmids.
The plasmid PB-1G 2R 3-puro-ROSA26 is shown as SEQ ID NO:8, the structure is schematically shown in figure 5. The amino acid sequence of SEQ ID NO: in 8, the 9 th to 339 th nucleotides form a porcine genome region (SH 1 left arm) at the 5 'end of the ROSA26 safe harbor insertion site, and the 9184 th to 10195 th nucleotides form a porcine genome region (SH 1 right arm) at the 3' end of the ROSA26 safe harbor insertion site. The amino acid sequence of SEQ ID NO: in 8, the 346-546, 3132-3531, 6506-6706, 8975-9175 nucleotides constitute 4 different insulator regions, respectively. SEQ ID NO:8, the 637-1209 th nucleotide constitutes EF-1 alpha poly (A) signal, the 1216-1935 th nucleotide encodes EGFP protein, the 1954-3131 th nucleotide constitutes EF-1 alpha promoter, the 3543-4042 th nucleotide constitutes PGK promoter, the 4059-4769 th nucleotide encodes mCheerry protein, the 4791-5015 th nucleotide constitutes bGH poly (A) signal, the 5054-6504 th nucleotide is loxP-puro-loxP expression frame region, the 6969-7233 th nucleotide constitutes beta-globin poly (A) signal, and the 7259-8974 th nucleotide constitutes pCAG promoter.
The plasmid PB-1G 2R 3-puro-AAVS1 differs from the plasmid PB-1G 2R 3-puro-ROSA26 only in that: the SH1 left arm was replaced with the pig genome region 5 'of the AAVS1 safety harbor insertion site (SH 2 left arm, SH2 left arm shown in SEQ ID NO: 9) and the SH1 right arm was replaced with the pig genome region 3' of the AAVS1 safety harbor insertion site (SH 2 right arm, SH2 right arm shown in SEQ ID NO: 10).
The plasmid PB-1G 2R3-puro-H11 differs from the plasmid PB-1G 2R 3-puro-ROSA26 only in that: the SH1 left arm was replaced with the 5 'pig genome region of the H11 safety harbor insertion site (SH 3 left arm, SH3 left arm is shown in SEQ ID NO: 11) and the SH1 right arm was replaced with the 3' pig genome region of the H11 safety harbor insertion site (SH 3 right arm, SH3 right arm is shown in SEQ ID NO: 12).
The plasmid PB-1G 2R 3-puro-COL1A1 differs from the plasmid PB-1G 2R 3-puro-ROSA26 only in that: the SH1 left arm was replaced with the pig genome region 5 'of the COL1A1 safety harbor insertion site (SH 4 left arm, SH4 left arm is shown in SEQ ID NO: 13) and the SH1 right arm was replaced with the pig genome region 3' of the COL1A1 safety harbor insertion site (SH 4 right arm, SH4 right arm is shown in SEQ ID NO: 14).
2. Efficient cutting target screening of safe harbor sites of porcine ROSA26, AAVS1, H11 and COL1A1 genomes
Through preliminary screening, the efficient cutting target of the ROSA26 safe harbor site is sgRNA ROSA26-g3 (cleavage efficiency of 38%), and the efficient cleavage target of the AAVS1 safe harbor site is sgRNA AAVS1-g4 (cleavage efficiency of 30%) and the efficient cleavage target of the H11 safe harbor site is sgRNA H11-g1 (cleavage efficiency is 60%), and the efficient cleavage target of the COL1A1 safe harbor site is sgRNA COL1A1-g3 (cleavage efficiency 56%).
The target sequences are as follows:
sgRNA ROSA26-g3 and (3) target spot: 5 'GAAGGAGCAAACTGACATGG-3';
sgRNA AAVS1-g4 and (3) target point: 5 'TGCAGTGGGTCTTTGGGGAC-3';
sgRNA H11-g1 and (3) target point: 5 'TTCCAGGAACATAAAGAAAGT-containing 3';
sgRNA COL1A1-g3 and (3) target point: 5 'GCAGTCTCAGCAACCACTGA-3'.
3. Preparation of safe harbor site gRNA recombinant vector
The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.
ROSA26-g3-S and ROSA26-g3-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. Double-stranded DNA having cohesive endsThe molecule was ligated to the vector backbone to give plasmid pKG-U6gRNA (ROSA 26-g 3). Plasmid pKG-U6gRNA (ROSA 26-g 3) expresses the nucleic acid sequence of SEQ ID NO:15 sgRNA ROSA26-g3 。
AAVS1-g4-S and AAVS1-g4-A were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (AAVS 1-g 4). Plasmid pKG-U6gRNA (AAVS 1-g 4) expresses the nucleic acid sequence of SEQ ID NO:16 a sgRNA AAVS1-g4 。
H11-g1-S and H11-g1-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (H11-g 1). Plasmid pKG-U6gRNA (H11-g 1) expresses the nucleic acid sequence of SEQ ID NO:17 sgRNA H11-g1 。
COL1A1-g3-S and COL1A1-g3-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (COL 1A1-g 3). Plasmid pKG-U6gRNA (COL 1A1-g 3) expresses the nucleic acid sequence of SEQ ID NO:18 sgRNA COL1A1-g3 。
ROSA26-g3-S, ROSA26-g3-A, AAVS1-g4-S, AAVS1-g4-A, H11-g1-S, H11-g1-A, COL1A1-g3-S and COL1A1-g3-A are single-stranded DNA molecules.
ROSA26-g3-S：caccGAAGGAGCAAACTGACATGG；
ROSA26-g3-A：aaacCCATGTCAGTTTGCTCCTTC。
AAVS1-g4-S：caccgTGCAGTGGGTCTTTGGGGAC；
AAVS1-g4-A：aaacGTCCCCAAAGACCCACTGCAc。
H11-g1-S：caccgTTCCAGGAACATAAGAAAGT；
H11-g1-A：aaacACTTTCTTATGTTCCTGGAAc。
COL1A1-g3-S：caccGCAGTCTCAGCAACCACTGA；
COL1A1-g3-A：aaacTCAGTGGTTGCTGAGACTGC。
sgRNA ROSA26-g3 (SEQ ID NO：15)：
GAAGGAGCAAACUGACAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。
sgRNA AAVS1-g4 (SEQ ID NO：16)：
UGCAGUGGGUCUUUGGGGACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。
sgRNA H11-g1 (SEQ ID NO：17)：
UUCCAGGAACAUAAGAAAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。
sgRNA COL1A1-g3 (SEQ ID NO：18)：
GCAGUCUCAGCAACCACUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。
4. Fluorescent Donor vectors (namely different safety harbor site vectors containing exogenous gene GFP), sgRNA vectors and Cas9 vectors (namely plasmid pKG-GE 3) containing homologous arms on two sides of different safety harbor insertion sites for mixed electrotransformation of porcine primary fibroblasts and detection of fluorescence intensity of cell GFP
1. Cotransfection
First group (ROSA 26 group): the plasmid PB-1G 2R 3-puro-ROSA26, the plasmid pKG-U6gRNA (ROSA 26-g 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G 2R 3-puro-ROSA26: 0.82. Mu.g of plasmid pKG-U6gRNA (ROSA 26-g 3): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.
second group (AAVS 1 group): the plasmid PB-1G 2R 3-puro-AAVS1, the plasmid pKG-U6gRNA (AAVS 1-g 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G 2R 3-puro-AAVS1:0.82 μ g plasmid pKG-U6gRNA (AAVS 1-g 4): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.
third group (H11 group): the plasmid PB-1G 2R3-puro-H11, the plasmid pKG-U6gRNA (H11-g 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G 2R3-puro-H11: 0.82. Mu.g of plasmid pKG-U6gRNA (H11-g 1): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.
fourth group (COL 1A1 group): the plasmid PB-1G 2R 3-puro-COL1A1, plasmid pKG-U6gRNA (COL 1A1-g 3) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G 2R 3-puro-COL1A1: 0.82. Mu.g of plasmid pKG-U6gRNA (COL 1A1-g 3): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.
and a fifth group: carrying out electrotransformation operation on primary pig fibroblasts without adding any plasmid according to isoelectric parameters.
Co-transfection was performed by electroporation using a mammalian Nuclear transfection kit (Neon kit, thermofisiher) with a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).
2. After step 1 is completed, the culture is carried out for 12 to 24 hours by using the complete culture solution, and then the culture is carried out by replacing a new complete culture solution. The total time of incubation was 48 hours.
3. After the completion of step 2, the cells were cultured in a complete culture medium containing 1.5. Mu.g/mL puromycin for 3 weeks (a new complete culture medium containing 1.5. Mu.g/mL puromycin was added every 2 days), and the GFP green fluorescence was continuously observed and photographed, and the level of the expression efficiency of the foreign gene at the safe harbor site was judged by the intensity of the GFP fluorescence expression.
One week after puromycin screening, the fluorescence intensity of the ROSA26 and COL1A1 safety harbor site test group is obviously stronger than that of the AAVS1 and H11 test group. After two weeks of puromycin screening, the fluorescence intensity is from strong to weak: COL1A1> ROSA26> H11> AAVS1, wherein the fluorescence intensity of the H11 group is not very uniform, the fluorescence intensity of the ROSA26 group is relatively uniform and relatively high, the fluorescence expression of the AAVS1 group cells is the weakest, and the fluorescence of the COL1A1 group cells is the largest and strongest. After the puromycin is continuously screened for three weeks, the fluorescence intensity is sequentially from strong to weak: COL1A1> ROSA26> H11> AAVS1, see FIG. 6 for a photograph.
5. GFP Gene transcript level detection
To compare mRNA transfer after integration of the GFP Gene into four different safe harbor sitesThe difference of the transcription level can be involved in the expression regulation of GFP and the influence on the expression quantity. Designing a pair of primers at the exon of the GFP gene, taking the cells after three weeks of puromycin screening in the step four, extracting total RNA, carrying out reverse transcription to obtain cDNA, detecting the transcription level of primary cells after the GFP gene is integrated at four different safe harbor sites, and simultaneously using the quantitative result obtained by the cells of the fifth group (a plasmid-free control electrotransformation group) as a control. GAPDH gene as reference gene according to 2 -ΔCt The method carries out calculation.
Primers for detection of GFP gene: AGATCCGCCACACACATCGAG; r is GTCCATGCCGAGAGTGATCC.
Primers for detecting GAPDH gene: GGTCGGAGTGAACGGATTTG; and R is CCATTTGATGTTGGCGGGAT.
Data analysis was performed using SPSS statistical software, expressed as (mean. + -. Standard deviation), and statistical analysis was performed using two-way analysis of variance. 2 -ΔCt The results showed that the GFP expression levels in AAVS1 and H11 groups were low, that in ROSA26 and COL1A1 groups were high, and that the difference in GFP transcription levels between COL1A1 and ROSA26 groups was very significant (P) compared with AAVS1 and H11 groups after three weeks of puromycin screening (P)<0.01)。2 -ΔCt The values are shown in Table 1, and the results of the significance analysis are shown in FIG. 7.
TABLE 12 -ΔCt Value information
Figure BDA0003651935450000151
From the results of real-time fluorescent quantitative PCR of GFP gene and fluorescence signal intensity after three weeks of cell culture, it was concluded that, among the four harbor safe loci of ROSA26, AAVS1, H11, and COL1A1, the COL1A1 locus was the most efficiently expressed when a foreign gene was inserted therein.
6. FACS detection of protein expression level of GFP Gene
To compare the expression of GFP after the GFP gene was integrated into four different safe harbor sites. After three weeks of puromycin screening in step four, the cells were electroporated by trypsinization, centrifuged at 400g for 4min and the supernatant discarded. Resuspend the cells in 1mL of complete mediumAnd transferring the cell suspension into a flow tube respectively. GFP signals were detected in the FITC channel of a BD FACCSmolody flow cytometer, and 5X 10 GFP signals were collected 4 Individual cells were analyzed and the results are shown in figure 8.
The results showed that the GFP fluorescence signal intensity COL1A1> ROSA26> H11> AAVS1.
Therefore, combining the above results, the COL1A1 site is the safe harbor site of the porcine primary cell that most efficiently expresses the foreign gene among four safe harbor sites ROSA26, AAVS1, H11, and COL1A1.
Example 3 preparation of Single cell clone with site-directed insertion of fat1 Gene expression cassette into COL1A1 safe harbor site in genome
fat1 gene information: encodes omega-3fatty acid desaturase-1 (omega-3 fatty acid desaturase fat-1); caenorhabditis elegans; located on chromosome IV of caenorhabditis elegans; the GeneID was 178291. The amino acid sequence of the omega-3fatty acid desaturase-1 is shown as SEQ ID NO:19, respectively.
The inventor shows through multiple experimental studies that compared with the mode of the combined electrotransformation of pKG-GE3 plasmid and gRNA plasmid in example 2, the combination of NCN protein and gRNA, namely RNP electrotransformation, can make the activity of cells better, so that the single cell clone with the fat1 gene expression cassette inserted into the COL1A1 safe harbor locus of the genome in the example is prepared by the RNP electrotransformation mode.
1. Construction of pKG-EF1 alpha-fat 1 Donor vector
The pKG-EF1 alpha-fat 1 Donor vector is plasmid pKG-EF1 alpha-fat 1.
The plasmid pKG-EF1 alpha-fat 1 is shown as SEQ ID NO:20, which is a circular plasmid, and the structure schematic diagram is shown in FIG. 9.SEQ ID NO:20, the 9 th to 880 th nucleotides are 5' end pig genome regions (SH 4 left arm) of COL1A1 safe harbor insertion sites, the 887 th to 1087 th nucleotides are insulators (named as insulators 1 and insulator 1), the 1088 th to 2266 th nucleotides are human hEF1 alpha promoters, the 2279 th to 3487 th nucleotides are fat1 genes (codon optimization suitable for pig cell expression is carried out), the 3510 th to 4082 th nucleotides are EF1 alpha Poly (A), the 4203 th to 4236 th nucleotides are LoxP sequences, the 4279 th to 4608 th nucleotides are SV40 promoters, and the 4654 th to 5253 th nucleotides encode purromycin resistance proteins (short for Puro) R Protein), the nucleotide at the 5433-5554 position is SV40 Poly (A), the nucleotide at the 5599-5632 position is a LoxP sequence, the nucleotide at the 5641-5841 position is an insulator (named as insulator 3 and insulator 3), and the nucleotide at the 5842-6568 position is a pig genome region (SH 4 right arm) at the 3' end of a COL1A1 safe harbor insertion site.
2. Preparation of gRNA
Two efficient cutting target spots sgRNA of COL1A1 safe harbor site obtained in earlier stage screening are selected COL1A1-g1 (cleavage efficiency 50%) and sgRNA COL1A1-g3 (cutting efficiency 56%).
The information for both targets is as follows:
sgRNA COL1A1-g1 and (3) target point: 5 'CTACCAAGAGAGTGACCAGC-3';
sgRNA COL1A1-g3 and (3) target spot: 5 'GCAGTCTCAGCAACCACTGA-3'.
1. Preparation of COL1A1-T7-gRNA1 transcription template and COL1A1-T7-gRNA3 transcription template
The COL1A1-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 21.
The COL1A1-T7-gRNA3 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:22, respectively.
2. In vitro transcription to obtain gRNA
Taking COL1A1-T7-gRNA1 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to make in vitro Transcription, then using MEGA clear TM The COL1A1-gRNA1 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). The COL1A1-gRNA1 is single-stranded RNA, and is shown in SEQ ID NO: as shown at 23.
Taking COL1A1-T7-gRNA3 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to make in vitro Transcription, then using MEGA clear TM The COL1A1-gRNA3 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). The COL1A1-gRNA3 is single-stranded RNA, and is shown in SEQ ID NO: as shown at 24.
COL1A1-gRNA1(SEQ ID NO：23)：
GGCUACCAAGAGAGUGACCAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU。
COL1A1-gRNA3(SEQ ID NO：24)：
GGGCAGUCUCAGCAACCACUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU。
3. Cotransfection
COL1A1-gRNA1, COL1A1-gRNA3, NCN protein and plasmid pKG-EF1 alpha-fat 1 were co-transfected into porcine primary fibroblasts. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g COL1A1-gRNA1:1 μ g COL1A1-gRNA3:4 μ g NCN protein: mu.g of plasmid pKG-EF 1. Alpha. -fat1. Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).
The COL1A1-gRNA1, COL1A1-gRNA3, and NCN proteins function to create DNA double strand breaks in porcine genomic DNA to increase the homologous recombination rate. The plasmid pKG-EF1 alpha-fat 1 and the pig genome DNA are subjected to homologous recombination, and an exogenous target gene fragment (namely a DNA molecule shown by nucleotides 881-5841 in SEQ ID NO: 20) is inserted between the left arm of SH4 and the right arm of SH4 in the pig genome DNA.
4. Puromycin pressure screening
1. Screening positive cells inserted with exogenous target gene fragment
(1) And after the third step is completed, culturing the transformed cells by adopting the complete culture solution for 16-18 hours, and then replacing a new complete culture solution for culturing. The total time of incubation was 48 hours.
(2) After completion of step (1), the selection culture was carried out by replacing the whole culture medium containing 1.5. Mu.g/mL puromycin with a new whole culture medium containing 1.5. Mu.g/mL puromycin every day for 3 weeks.
When the cells were cultured for 1 week, the cells died a lot.
When the screening culture is carried out for 2 weeks, the cells die sporadically, part of positive clones begin to divide and proliferate, and the number of the cells is increased continuously.
The purpose of the selection at week 3 of culture was to allow complete degradation of intracellular plasmid to eliminate false positive cell clones.
(3) After completion of step (2), the cells were harvested and cultured for 2 passages (1 passage every 2 days) with complete puromycin-free medium to return the cells to a good condition for the next single cell sorting.
2. Single cell sorting and amplification culture
(1) After completion of step 1, the cells were collected, digested with trypsin, neutralized with complete medium, centrifuged at 500g for 5min, the supernatant was discarded, the pellet was resuspended and diluted appropriately with 1mL of complete medium, the cells were picked up with a pipette and transferred to a 96-well plate (one 96-well plate per cell group, one cell per well) with 100 μ l of complete medium added in advance, and cultured, after 2 days of culture, replaced with complete medium containing 1.5 μ g/mL puromycin, and then replaced with new complete medium containing 1.5 μ g/mL puromycin every 2 to 3 days, during which the growth of the cells per well was observed with a microscope, and wells without cells and non-single cell clones were excluded.
(2) After the cells in the wells of the 96-well plate in step (1) grew to the bottom of the wells (about 2 weeks or so), cells were digested with trypsin and collected, 2/3 of the cells were seeded into a 6-well plate containing complete culture broth, and the remaining 1/3 of the cells were collected in a 1.5mL centrifuge tube.
(3) When the cells in the wells of the 6-well plate in step (2) were grown to 50% full, the cells were digested with 0.25% (Gibco) trypsin and collected, and the cells were cryopreserved using cell cryopreserved (90% complete medium +10% DMSO, volume ratio).
5. Genome level identification of exogenous target gene fragment inserted into COL1A1 safe harbor site at fixed point
To examine whether or not the COL1A1 safe harbor site of the cell genome was successfully site-specifically inserted with a foreign target gene fragment. Taking the centrifuge tube in the step 2 (2) in the step four, extracting cell genome DNA, carrying out PCR amplification by using a specific primer pair (the specific primer pair respectively comprises a primer pair consisting of sh4-Lr-JDF1414 and sh4-Lr-JDR5965, a primer pair consisting of sh4-Rr-JDF282 and sh4-Rr-JDR4723, and a primer pair consisting of sh4-wt-JDF1085 and sh4-wt-JDR 1560), and then carrying out electrophoresis. Porcine primary fibroblasts were used as wild type control (WT).
A primer pair consisting of sh4-Lr-JDF1414 and sh4-Lr-JDR5965 is used for identifying whether the exogenous target gene fragment at the 5' end of the porcine COL1A1 safe harbor insertion site is successfully recombined (the target sequence is 4552bp, and an amplification product of about 4552bp is obtained to indicate that the recombination is successful); a primer pair consisting of sh4-Rr-JDF282 and sh4-Rr-JDR4723 is used for identifying whether the exogenous target gene fragment at the 3' end of the porcine COL1A1 safe harbor insertion site is successfully recombined (the target sequence is 4442bp, and an amplification product of about 4442bp is obtained to indicate that the recombination is successful); the primer pair consisting of sh4-wt-JDF1085 and sh4-wt-JDR1560 is used for identifying whether the exogenous target gene fragment inserted into the porcine COL1A1 safe harbor site at a fixed point is homozygous or heterozygous (the genomic DNA of the wild type control can amplify a 476bp fragment, and the recombinant cell cannot amplify the inserted exogenous target gene fragment because the inserted exogenous target gene fragment is too large, so that if the amplification product is not displayed, the cell is homozygous for inserting the exogenous target gene fragment, and if the 476bp amplification product is displayed, the cell is heterozygous or wild type for inserting the exogenous target gene fragment).
sh4-Lr-JDF1414：CCTGCTGTAAGTGCCGTAGT；
sh4-Lr-JDR5965：CTAGGGGCACAGCACGTC。
sh4-Rr-JDF282：AAGTTATTAGGTCTGAAGAGGAGTTT；
sh4-Rr-JDR4723：CCCATCATTCCGTCCCAGAG。
sh4-wt-JDF1085：TGCTGAGTTCTGGCTTCCTG；
sh4-wt-JDR1560：TCTACCAAGAGAGTGACCAGCAG。
According to the identification result, the single cell clones numbered 1-15 and 17-22 are clones which are successfully inserted with exogenous target gene fragments at the site of the porcine COL1A1 safe harbor, wherein the single cell clones numbered 4 and 12 are homozygous site-specific insertion, and the other single cell clones are heterozygous site-specific insertion. See table 2. The monoclonal cell No. 16 was of the incompletely inserted type, i.e., one end of the foreign target gene fragment was inserted and the other end was dissociated.
TABLE 2 genotypes of single cell clones
Figure BDA0003651935450000171
Figure BDA0003651935450000181
The recombinant cell numbered 1 in Table 2 (heterozygous site-directed insertion) was designated as recombinant cell # 1. Through whole genome sequencing, compared with porcine primary fibroblasts from the same source, the genomic DNA of the # 1 recombinant cell only differs in that: a foreign target gene fragment (i.e., a DNA molecule represented by nucleotides 881 to 5841 in SEQ ID NO: 20) is inserted between the left arm of SH4 and the right arm of SH4 in genomic DNA and is heterozygous (i.e., one chromosome is inserted and the other chromosome is not inserted in a pair of homologous chromosomes).
The recombinant cell numbered 4 in table 2 (homozygous site-directed insertional) was designated as recombinant cell # 4. The recombinant cell numbered 12 in table 2 (homozygous site-directed insertional) was designated as recombinant cell # 12. Through whole genome sequencing, the genomic DNA of the 4# recombinant cell (or 12# recombinant cell) differs from that of a porcine primary fibroblast cell of the same source only in that: an exogenous target gene fragment (i.e., a DNA molecule represented by nucleotides 881-5841 in SEQ ID NO: 20) is inserted between the left arm of SH4 and the right arm of SH4 in the genomic DNA and is homozygous (i.e., the same insertion occurs in both homologous chromosomes). The results of sequencing the key adaptor sequences are shown in FIGS. 10-15.
6. Detection of transcription level of fat1 gene of single cell clone
Test cells: wild type control (WT), recombinant cell # 1 or recombinant cell # 4.
Taking a test cell, extracting total RNA, and carrying out reverse transcription to obtain cDNA. The relative expression level of fat1 gene was detected by fluorescence quantitative PCR using cDNA as template (2 for beta-actin as reference gene) -ΔCt Method for calculation). Porcine primary fibroblasts were used as control (WT).
The primers for the fluorescent quantitative PCR were as follows:
fat1-F：TTGGCCTGATGCTGGTGATT；
fat1-R：TCGATGGTCTGAGTTTGCCC；
β-actin-F：CACGCCATCCTGCGTCTGGA；
β-actin-R：AGCACCGTGTTGGCGTAGAG。
data analysis was performed using SPSS statistical software, expressed as (mean ± standard deviation), using independent sample T-test statistical analysis. The results are shown in FIG. 16.2 -ΔCt The results show that the expression level of fat1 gene of the tested cells is obviously higher than that of the control, and the expression level of the single-cell clone inserted in a homozygous fixed-point way is higher than that of the single-cell clone inserted in a heterozygous fixed-point way. The results show that fat1 gene is expressed to a higher degree in the test cells.
Example 4 preparation and identification of cloned pigs
1. Cloning production of cloned pig by somatic cell nuclear transfer technology
1. In vitro maturation of oocytes
Fresh in vitro pig ovaries (ovaries from dorsalis communis) were collected from slaughterhouses and stored in 0.9% sodium chloride solution containing 75mg/mL penicillin and 50mg/mL streptomycin and transported to the laboratory at 25-30 ℃.
Ovaries were taken, cumulus-oopyte complexes (COCs) were extracted from follicles of 3-6 mm diameter, COCs with at least three layers of dense Cumulus cells were selected and inoculated into 4-well plates, each well containing 400. Mu.L of porcine oocyte in vitro maturation medium, 50 per well, each well covered with 400. Mu.L of mineral oil (Sigma, M8410). 300-400 COCs are cultured for each transplantation. The culture plates containing COCs were treated at 38.5 ℃ with 5% CO 2 And culturing in a saturated humidity incubator for 42-44 hr.
Porcine oocyte in vitro maturation medium (IVM medium): contains 0.1mg/mL pyruvic acid, 0.1mg/mL cysteine hydrochloride, 10ng/mL epidermal growth factor, 10% (v/v) pig follicular fluid, 75mg/mL penicillin, 50mg/mL streptomycin, 10IU/mL eCG and 10IU/mL hCG, and the balance TCM-199 culture medium.
2. Somatic cell nuclear transfer and embryo transfer
(1) Somatic Cell Nuclear Transfer (SCNT)
The nuclear donor cells were the recombinant cell # 4 obtained in example 3.
After completion of step 1, the dilated cumulus cells from which COCs were removed were repeatedly blown up with 0.1% (w/v) hyaluronidase. Oocytes having intact membranes and containing the first polar body discharged were cultured for 0.5-1h in NCSU23 medium containing 0.1mg/mL dimecorsin, 0.05M sucrose and 4mg/mL bovine serum albumin to induce nuclear protrusion of oocytes, and then protruding nuclei and polar bodies were removed in Tyrode lactate medium containing 10 μ M HEPES, 0.3% (w/v) polyvinylpyrrolidone, 10% FBS, 0.1mg/mL dimecorsin and 5mg/mL cytochalasin B using a tip-tipped microinjection needle (about 20 μ M in diameter). The mononuclear donor cell was injected into the perivitelline space of the enucleated oocyte, and the mononuclear donor cell was fused with the recipient oocyte for 20 μ s using a direct current pulse of 200V/mm in a fusion medium using an embryonic cell fusion apparatus (ET 3, fuj ihira Industry). The reconstituted embryos were then cultured in PZM-3 medium (recipe see Table 3) for 2h to allow nuclear reprogramming and then activated with a single pulse of 150V/mm for 100 μ s in activation medium. The activated reconstituted embryos are then placed in PZM-3 medium containing 5. Mu.g/mL cytochalasin B, and 5% CO at 38.5 ℃% 2 、5％O 2 、90％N 2 And incubation in an incubator saturated with humidity for 2 hours for further activation; then placing the reconstituted embryo in PZM-3 medium at 38.5 deg.C, 5% 2 、5％O 2 、90％N 2 And culturing in an incubator with saturated humidity. Most of the reconstructed embryos can be used for subsequent embryo transplantation after being cultured for 6 hours after being activated.
Fusion culture medium: containing 0.25M D-sorbitol, 0.05mM Mg (C) 2 H 3 O 2 ) 2 20mg/mL BSA and 0.5mM HEPES [ acid-free ]]And the balance being water.
Activating the culture medium: containing 0.25M D-sorbitol, 0.01mM Ca (C) 2 H 3 O 2 ) 2 ,0.05mM Mg(C 2 H 3 O 2 ) 2 And 0.1mg/mL BSA, the balance being water.
TABLE 3 PZM-3 culture Medium formulation
Figure BDA0003651935450000191
Figure BDA0003651935450000201
* Added before use.
(2) Embryo transfer
Selecting 9-month-old Erhualian sows in estrus as surrogate mother sows of the reconstructed embryos, transplanting the reconstructed embryos cultured for 6h after activation into the oviducts of the surrogate mother sows, and transplanting 300-350 reconstructed embryos to each sow. Approximately 23 days after embryo transfer, pregnancy was examined using an ultrasonic scanner (HS-101V, japan Honda electronic) to confirm whether the recipient sow was pregnant. Of the 4 pregnant sows, 2 pregnant sows.
Cloned pigs are born around day 116-117 after embryo transfer. 2 successfully pregnant sows were co-produced to obtain 7 cloned pigs. The cloned pig is the cloned pig with the transferred fat1 gene (the picture is shown in figure 17).
3. Preparation of wild-type control pigs
And (3) replacing the recombinant cells with pig primary fibroblasts from the same source as nuclear donor cells to perform the step (2) to obtain 4 cloned pigs, namely the wild control cloned pigs. The genetic background of the wild control cloned pig is completely consistent with that of the transgenic fat1 cloned pig.
2. Fat1 gene expression level detection of cloned pigs
The test pigs: the cloned pig with the transferred fat1 gene or the wild control cloned pig.
Taking the tail of the test pig (born for 2-3 days), extracting RNA, and carrying out reverse transcription to obtain cDNA. The cDNA was used as a template, and the relative expression level of fat1 gene was detected by fluorescent quantitative PCR (2. Beta. -actin was used as an internal reference gene) -ΔCt Method for calculation). The primers were the same as in step six of example 3.
Data analysis was performed using SPSS statistical software, expressed as (mean ± standard deviation), using independent sample T-test statistical analysis. The results are shown in FIG. 18. The expression level of the fat1 gene in the tail tissue of the transgenic fat1 pig (fat 1-pig) is 0.2 times of that of the housekeeping gene beta-actin, which is obviously higher than that of the fat1 gene in the tail tissue of the wild control cloned pig (WT-pig).
In conclusion, fat1 gene has stronger expression in fat1 transgenic cloned pigs.
3. Detection of composition of polyunsaturated fatty acids
Test pigs: the cloned pig with the transferred fat1 gene or the wild control cloned pig.
Taking the tail of the test pig (born for 2-3 days), unhairing, peeling, and peeling to obtain muscle tissue.
The muscle tissue is sent to the meat and meat product quality supervision and inspection test center of the agricultural rural area of Nanjing university of agriculture, and the meat and meat product quality supervision and inspection test center of the agricultural rural area of Nanjing university of agriculture detects the content of ALA (alpha-linolenic acid), EPA (eicosapentaenoic acid), DPA (docosapentaenoic acid), DHA (docosahexaenoic acid), LA (linoleic acid) and AA (arachidonic acid). The method comprises the following specific steps: taking muscle tissue, extracting with chloroform-methanol solution containing 0.005% (% represents g/100 ml) butyl hydroxy toluene (chloroform-methanol solution is composed of 2 parts by volume of chloroform and 1 part by volume of methanol), collecting organic phase, and removing solvent to obtain product as total lipid; incubating the total lipid with 1mL of methylation reagent containing 5% sulfuric acid at 100 ℃ for 1 hour, extracting with n-hexane, collecting an organic phase, and removing a solvent to obtain a product, namely fatty acid methyl ester (the total mass of the fatty acid methyl ester is 100%); detecting the mass percentage content of ALA, EPA, DPA, DHA, LA and AA in the fatty acid methyl ester by using a gas chromatography-mass spectrometry method. The mass percentage of the total omega-3fatty acids = mass percentage of ALA + mass percentage of EPA + mass percentage of DPA + mass percentage of DHA. The mass percentage of total omega-6 fatty acids = mass percentage of LA + mass percentage of AA.
The results are shown in Table 4 and FIG. 19. The results show that the levels of ALA, EPA, DPA, DHA and total omega-3fatty acid of the transgenic fat1 cloned pig (fat 1-pig) are obviously higher than those of a wild control cloned pig (WT-pig); the LA and total omega-6 fatty acid levels of the cloned pig (fat 1-pig) with the transferred fat1 gene are obviously lower than those of a wild control cloned pig (WT-pig); the omega-6/omega-3 ratio of the cloned pig with the transferred fat1 gene (fat 1-pig) is obviously lower than that of the cloned pig with the wild control (WT-pig).
TABLE 4 Mass percents of various fatty acids in fatty acid methyl esters
fat-pig WT-pig
ALA(％) 0.84±0.08 a 0.58±0.04 b
EPA(％) 2.14±0.42 A 0.15±0.06 B
DPA(％) 0.97±0.21 a 0.27±0.06 b
DHA(％) 2.03±0.29 A 0.53±0.08 B
LA(％) 12.61±1.05 B 17.27±0.54 A
AA(％) 0.55±0.05 0.49±0.02
Total omega-3fatty acids 5.97±0.61 A 1.51±0.12 B
Total omega-6 fatty acids 13.15±1.25 b 17.77±1.11 a
Ratio of omega-6/omega-3 2.27±0.43 B 11.76±0.92 A
The procedure of example 4 was followed using the recombinant 12# cells obtained in example 3 instead of the recombinant 4# cells as nuclear transfer donor cells. The results are consistent with example 4: the levels of ALA, EPA, DPA, DHA and total omega-3fatty acid of the fat1 gene cloned pig (fat 1-pig) are obviously higher than those of a wild control cloned pig (WT-pig); the LA and total omega-6 fatty acid levels of the cloned pig (fat 1-pig) with the transferred fat1 gene are obviously lower than those of a wild control cloned pig (WT-pig); the omega-6/omega-3 ratio of the cloned pig with the transferred fat1 gene (fat 1-pig) is obviously lower than that of the cloned pig with the wild control (WT-pig).
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Sequence listing
<110> Nanjing King Gene engineering Co., ltd
<120> kit for preparing omega-3fatty acid-rich pig, preparation method and application thereof
<130> GNCYX221804
<160> 25
<170> SIPOSequenceListing 1.0
<210> 1
<211> 9974
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540
tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600
gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660
ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720
agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780
agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840
tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900
tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960
cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020
aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080
tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140
tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380
gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980
gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400
gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460
tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520
cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580
gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640
gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700
catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760
tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820
ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880
tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940
ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000
aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060
gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120
tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180
acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240
cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300
cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360
gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420
cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480
gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540
tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600
atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660
tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720
gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780
tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840
cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900
tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960
atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020
atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080
tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140
cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200
aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260
ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320
tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380
tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440
gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500
gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560
gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620
ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680
taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740
ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800
atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860
tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920
gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980
gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040
aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100
cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160
ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220
actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280
aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340
atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400
gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460
aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520
aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580
ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640
gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700
gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760
actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820
tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880
acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940
ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000
gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060
attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120
ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180
atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240
gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300
aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360
ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420
atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480
gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540
atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600
ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660
attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720
cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780
tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840
aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900
cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960
atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020
aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080
ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140
gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200
ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260
aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320
ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380
aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440
ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500
aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560
accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620
ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680
ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740
ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800
ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860
gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920
aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980
gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040
aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100
gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160
atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220
gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280
aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340
tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400
aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460
gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520
aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580
ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640
caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700
ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760
atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820
attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880
ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940
accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000
accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060
cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120
tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180
gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240
ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300
agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360
aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420
tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480
cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540
ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600
atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660
gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720
gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780
ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840
aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900
actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960
aactatatcc ggat 9974
<210> 2
<211> 1547
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr
1 5 10 15
Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp
20 25 30
Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp
35 40 45
Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu
50 55 60
Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu
65 70 75 80
Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly
85 90 95
Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys
100 105 110
Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn
115 120 125
Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp
130 135 140
Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly
145 150 155 160
Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr
165 170 175
Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser
180 185 190
Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys
195 200 205
Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala
210 215 220
Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn
225 230 235 240
Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val
245 250 255
Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu
260 265 270
Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu
275 280 285
Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys
290 295 300
Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala
305 310 315 320
Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp
325 330 335
Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val
340 345 350
Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly
355 360 365
Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg
370 375 380
Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu
385 390 395 400
Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys
405 410 415
Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp
420 425 430
Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln
435 440 445
Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu
450 455 460
Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu
465 470 475 480
Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr
485 490 495
Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu
500 505 510
Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly
515 520 525
Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu
530 535 540
Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp
545 550 555 560
Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln
565 570 575
Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe
580 585 590
Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr
595 600 605
Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg
610 615 620
Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn
625 630 635 640
Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu
645 650 655
Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro
660 665 670
Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr
675 680 685
Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser
690 695 700
Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg
705 710 715 720
Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu
725 730 735
Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala
740 745 750
Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp
755 760 765
Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu
770 775 780
Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys
785 790 795 800
Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg
805 810 815
Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly
820 825 830
Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser
835 840 845
Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser
850 855 860
Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly
865 870 875 880
Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile
885 890 895
Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys
900 905 910
Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg
915 920 925
Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met
930 935 940
Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys
945 950 955 960
Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu
965 970 975
Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp
980 985 990
Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser
995 1000 1005
Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp
1010 1015 1020
Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys
1025 1030 1035 1040
Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr
1045 1050 1055
Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser
1060 1065 1070
Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg
1075 1080 1085
Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr
1090 1095 1100
Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr
1105 1110 1115 1120
Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr
1125 1130 1135
Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu
1140 1145 1150
Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu
1155 1160 1165
Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met
1170 1175 1180
Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe
1185 1190 1195 1200
Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala
1205 1210 1215
Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr
1220 1225 1230
Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys
1235 1240 1245
Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln
1250 1255 1260
Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp
1265 1270 1275 1280
Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly
1285 1290 1295
Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val
1300 1305 1310
Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly
1315 1320 1325
Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe
1330 1335 1340
Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys
1345 1350 1355 1360
Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met
1365 1370 1375
Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro
1380 1385 1390
Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu
1395 1400 1405
Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln
1410 1415 1420
His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser
1425 1430 1435 1440
Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala
1445 1450 1455
Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile
1460 1465 1470
Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys
1475 1480 1485
Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu
1490 1495 1500
Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu
1505 1510 1515 1520
Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala
1525 1530 1535
Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys
1540 1545
<210> 3
<211> 1399
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala
1 5 10 15
Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly
20 25 30
Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys
35 40 45
Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly
50 55 60
Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys
65 70 75 80
Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr
85 90 95
Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe
100 105 110
Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His
115 120 125
Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His
130 135 140
Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser
145 150 155 160
Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met
165 170 175
Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp
180 185 190
Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn
195 200 205
Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys
210 215 220
Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu
225 230 235 240
Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu
245 250 255
Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp
260 265 270
Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp
275 280 285
Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu
290 295 300
Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile
305 310 315 320
Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met
325 330 335
Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala
340 345 350
Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp
355 360 365
Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln
370 375 380
Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly
385 390 395 400
Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys
405 410 415
Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly
420 425 430
Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu
435 440 445
Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro
450 455 460
Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met
465 470 475 480
Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val
485 490 495
Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn
500 505 510
Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu
515 520 525
Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr
530 535 540
Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys
545 550 555 560
Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val
565 570 575
Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser
580 585 590
Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr
595 600 605
Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn
610 615 620
Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu
625 630 635 640
Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His
645 650 655
Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr
660 665 670
Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys
675 680 685
Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala
690 695 700
Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys
705 710 715 720
Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His
725 730 735
Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile
740 745 750
Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg
755 760 765
His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr
770 775 780
Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu
785 790 795 800
Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val
805 810 815
Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln
820 825 830
Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu
835 840 845
Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp
850 855 860
Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly
865 870 875 880
Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn
885 890 895
Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe
900 905 910
Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys
915 920 925
Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys
930 935 940
His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu
945 950 955 960
Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys
965 970 975
Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu
980 985 990
Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val
995 1000 1005
Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val
1010 1015 1020
Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser
1025 1030 1035 1040
Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn
1045 1050 1055
Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile
1060 1065 1070
Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val
1075 1080 1085
Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met
1090 1095 1100
Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe
1105 1110 1115 1120
Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala
1125 1130 1135
Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro
1140 1145 1150
Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys
1155 1160 1165
Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met
1170 1175 1180
Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys
1185 1190 1195 1200
Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr
1205 1210 1215
Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala
1220 1225 1230
Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val
1235 1240 1245
Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro
1250 1255 1260
Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr
1265 1270 1275 1280
Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile
1285 1290 1295
Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His
1300 1305 1310
Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe
1315 1320 1325
Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr
1330 1335 1340
Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala
1345 1350 1355 1360
Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp
1365 1370 1375
Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala
1380 1385 1390
Gly Gln Ala Lys Lys Lys Lys
1395
<210> 4
<211> 225
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60
taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120
ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180
tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225
<210> 5
<211> 225
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60
taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120
ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180
tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225
<210> 6
<211> 102
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60
uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102
<210> 7
<211> 102
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60
uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102
<210> 8
<211> 14138
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggcgcgccct ctacctgctc tcggacccgt gggggtgggg ggtggaggaa ggagtggggg 60
gtcggtcctg ctggcttgtg ggtgggaggc gcatgttctc caaaaacccg cgcgagctgc 120
aatcctgagg gagctgcagt ggaggaggcg gagagaaggc cgcacccttc tccgcagggg 180
gaggggagtg ccgcaatacc tttatgggag ttctctgctg cctccttttc ctaaggaccg 240
ccctgggcct agaaaaatcc ctccctcccc cgcgatctcg tcatcgcctc catgtcagtt 300
tgctccttct cgattatggg cgggattctt ttgccctggc gcgccccaga cccgggcctg 360
gggggcaagt cggggggcgg ggggaggtcg ggcagggtcc cctgggagga tggggacgtg 420
ctgtgcccct agcggccacc agagggcacc aggacaccac tgcggtcggc tcagcggctc 480
ctgccctggt cagggggcgc caggtcctgc ccctcctggg gagggcgggg ggcgagaagg 540
gcgattttaa ttaacccacg tttcaacatg cacatcccag taatttggaa acattttgtt 600
tccaaagatt cacttaacat tggtttagca acatgaagct ttctatgcaa cccaaggact 660
cagtttttgg cctgttttag tgacaggcaa tcagcaacat gctgcatttc tctccagtgt 720
tgtaatcaaa gaaaccctcc catagcttta aatgatattc cttccccttc caattatgtg 780
gggggaaaac aaccctattc tccacccaga agtgttaact caagaattac attttcaaga 840
agtttccaga ttcgtaaaac cagaattaga tgtctttcac ctaaatgtct cggtgttgac 900
caaaggaaca cacaggtttc tcatttaact tttttaatgg gtctcaaaat tctgtgacaa 960
atttttggtc aagttgtttc cattaaaaag tactgatttt aaaaactaat aacttaaaac 1020
tgccacacgc aaaaaagaaa accaaagtgg tccacaaaac attctccttt ccttctgaag 1080
gttttacgat gcattgttat cattaaccag tcttttacta ctaaacttaa atggccaatt 1140
gaaacaaaca gttctgagac cgttcttcca ccactgatta agagtggggt ggcaggtatt 1200
agggataatg ctagcttact tgtacagctc gtccatgccg agagtgatcc cggcggcggt 1260
cacgaactcc agcaggacca tgtgatcgcg cttctcgttg gggtctttgc tcagggcgga 1320
ctgggtgctc aggtagtggt tgtcgggcag cagcacgggg ccgtcgccga tgggggtgtt 1380
ctgctggtag tggtcggcga gctgcacgct gccgtcctcg atgttgtggc ggatcttgaa 1440
gttcaccttg atgccgttct tctgcttgtc ggccatgata tagacgttgt ggctgttgta 1500
gttgtactcc agcttgtgcc ccaggatgtt gccgtcctcc ttgaagtcga tgcccttcag 1560
ctcgatgcgg ttcaccaggg tgtcgccctc gaacttcacc tcggcgcggg tcttgtagtt 1620
gccgtcgtcc ttgaagaaga tggtgcgctc ctggacgtag ccttcgggca tggcggactt 1680
gaagaagtcg tgctgcttca tgtggtcggg gtagcggctg aagcactgca cgccgtaggt 1740
cagggtggtc acgagggtgg gccagggcac gggcagcttg ccggtggtgc agatgaactt 1800
cagggtcagc ttgccgtagg tggcatcgcc ctcgccctcg ccggacacgc tgaacttgtg 1860
gccgtttacg tcgccgtcca gctcgaccag gatgggcacc accccggtga acagctcctc 1920
gcccttgctc accatggtgg cgtcgaccgt acgtcacgac acctgaaatg gaagaaaaaa 1980
actttgaacc actgtctgag gcttgagaat gaaccaagat ccaaactcaa aaagggcaaa 2040
ttccaaggag aattacatca agtgccaagc tggcctaact tcagtctcca cccactcagt 2100
gtggggaaac tccatcgcat aaaacccctc cccccaacct aaagacgacg tactccaaaa 2160
gctcgagaac taatcgaggt gcctggacgg cgcccggtac tccgtggagt cacatgaagc 2220
gacggctgag gacggaaagg cccttttcct ttgtgtgggt gactcacccg cccgctctcc 2280
cgagcgccgc gtcctccatt ttgagctccc tgcagcaggg ccgggaagcg gccatctttc 2340
cgctcacgca actggtgccg accgggccag ccttgccgcc cagggcgggg cgatacacgg 2400
cggcgcgagg ccaggcacca gagcaggccg gccagcttga gactaccccc gtccgattct 2460
cggtggccgc gctcgcaggc cccgcctcgc cgaacatgtg cgctgggacg cacgggcccc 2520
gtcgccgccc gcggccccaa aaaccgaaat accagtgtgc agatcttggc ccgcatttac 2580
aagactatct tgccagaaaa aaagcgtcgc agcaggtcat caaaaatttt aaatggctag 2640
agacttatcg aaagcagcga gacaggcgcg aaggtgccac cagattcgca cgcggcggcc 2700
ccagcgccca ggccaggcct caactcaagc acgaggcgaa ggggctcctt aagcgcaagg 2760
cctcgaactc tcccacccac ttccaacccg aagctcggga tcaagaatca cgtactgcag 2820
ccagtggaag taattcaagg cacgcaaggg ccataacccg taaagaggcc aggcccgcgg 2880
gaaccacaca cggcacttac ctgtgttctg gcggcaaacc cgttgcgaaa aagaacgttc 2940
acggcgacta ctgcacttat atacggttct cccccaccct cgggaaaaag gcggagccag 3000
tacacgacat cactttccca gtttaccccg cgccaccttc tctaggcacc ggttcaattg 3060
ccgacccctc cccccaactt ctcggggact gtgggcgatg tgcgctctgc ccactgacgg 3120
gcaccggagc cctagattcg attccctttg gggcaaaact caccgcctaa tcccctataa 3180
ctctaccggg gagcccggtg gagagcagac gggctgacgc tgccacctgc cggccatccc 3240
aggataggac cgccgtattc aagtcgccct caggaaggac cctcggggca ccagaggcct 3300
tcgaagcccc aatgagtgag gcaactgagg gtcgcgggtg ccattacaag gcccagccaa 3360
ggcctagagc caaggcttga accgtggggg acccccaagc cccacctgcc caggaacagc 3420
agacactggg acactttgtt tcaggtcctg cccaggcccc tcccactgtg aggctgggat 3480
ttgtcgccca gggtgcagat gagaagagtg gggaaagcag tcctgagcca ggaaattcta 3540
ccgggtaggg gaggcgcttt tcccaaggca gtctggagca tgcgctttag cagccccgct 3600
gggcacttgg cgctacacaa gtggcctctg gcctcgcaca cattccacat ccaccggtag 3660
gcgccaaccg gctccgttct ttggtggccc cttcgcgcca ccttctactc ctcccctagt 3720
caggaagttc ccccccgccc cgcagctcgc gtcgtgcagg acgtgacaaa tggaagtagc 3780
acgtctcact agtctcgtgc agatggacag caccgctgag caatggaagc gggtaggcct 3840
ttggggcagc ggccaatagc agctttgctc cttcgctttc tgggctcaga ggctgggaag 3900
gggtgggtcc gggggcgggc tcaggggcgg gctcaggggc ggggcgggcg cccgaaggtc 3960
ctccggaggc ccggcattct gcacgcttca aaagcgcacg tctgccgcgc tgttctcctc 4020
ttcctcatct ccgggccttt cgacctccta gggccaccat ggtgagcaag ggcgaggacg 4080
acaacatggc catcatcaag gagttcatgc gcttcaaggt gcacatggag ggctccgtga 4140
acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag ggcacccaga 4200
ccgccaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac atcctgtccc 4260
ctcagttcat gtacggctcc aaggcctacg tgaagcaccc cgccgacatc cccgactact 4320
tgaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg 4380
gcgtggtgac cgtgacccag gactcctccc tgcaggacgg cgagttcatc tacaaggtga 4440
agctgcgcgg caccaacttc ccctccgacg gccccgtaat gcagaagaag accatgggct 4500
gggaggcctc ctccgagcgg atgtaccccg aggacggcgc cctgaagggc gagatcaagc 4560
agaggctgaa gctgaaggac ggcggccact acgacgccga ggtcaagacc acctacaagg 4620
ccaagaagcc cgtgcagctg cccggcgcct acaacgtcaa catcaagctg gacatcacct 4680
cccacaacga ggactacacc atcgtggaac agtacgagcg cgccgagggc cgccactcca 4740
ccggcggcat ggacgagctg tacaagtgag gatccgctga tcagcctcga ctgtgccttc 4800
tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc 4860
cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg 4920
tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa 4980
tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa gaacccttct 5040
gaggcggaaa gaaccagctg ccttaatata acttcgtata atgtatgcta tacgaagtta 5100
ttaggtctga agaggagttt acgtccagcc aattctgtgg aatgtgtgtc agttagggtg 5160
tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc 5220
agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca 5280
tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc ccctaactcc 5340
gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc 5400
cgaggccgcc tctgcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct 5460
aggcttttgc aaaaagctcc cgggagcttg tatatccatt ttcggcggcc gcgccaccat 5520
gaccgagtac aagcccacgg tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg 5580
caccctcgcc gccgcgttcg ccgactaccc cgccacgcgc cacaccgtcg atccggaccg 5640
ccacatcgag cgggtcaccg agctgcaaga actcttcctc acgcgcgtcg ggctcgacat 5700
cggcaaggtg tgggtcgcgg acgacggcgc cgcggtggcg gtctggacca cgccggagag 5760
cgtcgaagcg ggggcggtgt tcgccgagat cggcccgcgc atggccgagt tgagcggttc 5820
ccggctggcc gcgcagcaac agatggaagg cctcctggcg ccgcaccggc ccaaggagcc 5880
cgcgtggttc ctggccaccg tcggagtctc gcccgaccac cagggcaagg gtctgggcag 5940
cgccgtcgtg ctccccggag tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga 6000
gacctccgcg ccccgcaacc tccccttcta cgagcggctc ggcttcaccg tcaccgccga 6060
cgtcgaggtg cccgaaggac cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaga 6120
attcgcggga ctctggggtt cgaaatgacc gaccaagcga cgcccaacct gccatcacga 6180
gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac 6240
gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac 6300
ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 6360
aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 6420
catgtctgta taccgctcga ctagagcttg cggaaccctt aatataactt cgtataatgt 6480
atgctatacg aagttattag gtccgctggc catctacgag ccaaagactt tcaaatcttt 6540
ggctgccttg gccagtagga ggcgacacga aggatttgct gctgccttgg gggatgggaa 6600
ggaacctgaa ggcatttttt ccagagtggt gcagtaccac tgaggactgt tgctgtattg 6660
attaggaaaa gagacagagt aatttgcagt ttgtttgatt tatactgggc tgcaggtcga 6720
gggatcttca taagagaaga gggacagcta tgactgggag tagtcaggag aggaggaaaa 6780
atctggctag taaaacatgt aaggaaaatt ttagggatgt taaagaaaaa aataacacaa 6840
aacaaaatat aaaaaaaatc taacctcaag tcaaggcttt tctatggaat aaggaatgga 6900
cagcaggggg ctgtttcata tactgatgac ctctttatag ccacctttgt tcatggcagc 6960
cagcatatgg catatgttgc caaactctaa accaaatact cattctgatg ttttaaatga 7020
tttgccctcc catatgtcct tccgagtgag agacacaaaa aattccaaca cactattgca 7080
atgaaaataa atttccttta ttagccagaa gtcagatgct caaggggctt catgatgtcc 7140
ccataatttt tggcagaggg aaaaagatct cagtggtatt tgtgagccag ggcattggcc 7200
acaccagcca ccaccttctg ataggcagcc tgcggtacct tacatggtgg cgaattcgtt 7260
tgccaaaatg atgagacagc acaataacca gcacgttgcc caggagctgt aggaaaaaga 7320
agaaggcatg aacatggtta gcagaggctc tagagccgcc ggtcacacgc cagaagccga 7380
accccgccct gccccgtccc ccccgaaggc agccgtcccc ctgcggcagc cccgaggctg 7440
gagatggaga aggggacggc ggcgcggcga cgcacgaagg ccctccccgc ccatttcctt 7500
cctgccggcg ccgcaccgct tcgcccgcgc ccgctagagg gggtgcggcg gcgcctccca 7560
gatttcggct ccgccagatt tgggacaaag gaagtccctg cgccctctcg cacgattacc 7620
ataaaaggca atggctgcgg ctcgccgcgc ctcgacagcc gccggcgctc cggggccgcc 7680
gcgcccctcc cccgagccct ccccggcccg aggcggcccc gccccgcccg gcacccccac 7740
ctgccgccac cccccgcccg gcacggcgag ccccgcgcca cgccccgcac ggagccccgc 7800
acccgaagcc gggccgtgct cagcaactcg gggagggggg tgcagggggg ggttacagcc 7860
cgaccgccgc gcccacaccc cctgctcacc cccccacgca cacaccccgc acgcagcctt 7920
tgttcccctc gcagcccccc cgcaccgcgg ggcaccgccc ccggccgcgc tcccctcgcg 7980
cacacgcgga gcgcacaaag ccccgcgccg cgcccgcagc gctcacagcc gccgggcagc 8040
gcgggccgca cgcggcgctc cccacgcaca cacacacgca cgcacccccc gagccgctcc 8100
cccccgcaca aagggccctc ccggagccct ttaaggcttt cacgcagcca cagaaaagaa 8160
acgagccgtc attaaaccaa gcgctaatta cagcccggag gagaagggcc gtcccgcccg 8220
ctcacctgtg ggagtaacgc ggtcagtcag agccggggcg ggcggcgcga ggcggcgcgg 8280
agcggggcac ggggcgaagg caacgcagcg actcccgccc gccgcgcgct tcgcttttta 8340
tagggccgcc gccgccgccg cctcgccata aaaggaaact ttcggagcgc gccgctctga 8400
ttggctgccg ccgcacctct ccgcctcgcc ccgccccgcc cctcgccccg ccccgccccg 8460
cctggcgcgc gccccccccc cccccgcccc catcgctgca caaaataatt aaaaaataaa 8520
taaatacaaa attgggggtg gggagggggg ggagatgggg agagtgaagc agaacgtggg 8580
gctcacctcg acccatggta atagcgatga ctaatacgta gatgtactgc caagtaggaa 8640
agtcccataa ggtcatgtac tgggcataat gccaggcggg ccatttaccg tcattgacgt 8700
caataggggg cgtacttggc atatgataca cttgatgtac tgccaagtgg gcagtttacc 8760
gtaaatagtc cacccattga cgtcaatgga aagtccctat tggcgttact atgggaacat 8820
acgtcattat tgacgtcaat gggcgggggt cgttgggcgg tcagccaggc gggccattta 8880
ccgtaagtta tgtaacgcgg aactccatat atgggctatg aactaatgac cccgtaattg 8940
attactatta ataactagtc aataatcaat gtcgtaaatg tcgtaaatgt ctcagctagt 9000
caggtagtaa aaggtgtcaa ctaggcagtg gcagagcagg attcaaattc agggctgttg 9060
tgatgcctcc gcagactctg agcgccacct ggtggtaatt tgtctgtgcc tcttctgacg 9120
tggaagaaca gcaactaaca cactaacacg gcatttacta tgggccagcc attgtacgcg 9180
ttgcttaacc tgattcttgg gcgttgtcct gcaggggatt gagcaggtgt acgaggacga 9240
gcccaatttc tctatattcc cacagtcttg agtttgtgtc acaaaataat tatagtgggg 9300
tggagatggg aaatgagtcc aggcaacacc taagcctgat tttatgcatt gagactgcgt 9360
gttattacta aagatctttg tgtcgcaatt tcctgatgaa gggagatagg ttaaaaagca 9420
cggatctact gagttttaca gtcatcccat ttgtagactt ttgctacacc accaaagtat 9480
agcatctgag attaaatatt aatctccaaa ccttaggccc cctcacttgc atccttacgg 9540
tcagataact ctcactcata ctttaagccc attttgtttg ttgtacttgc tcatccagtc 9600
ccagacatag cattggcttt ctcctcacct gttttaggta gccagcaagt catgaaatca 9660
gataagttcc accaccaatt aacactaccc atcttgagca taggcccaac agtgcattta 9720
ttcctcattt actgatgttc gtgaatattt accttgattt tcattttttt ctttttctta 9780
agctgggatt ttactcctga ccctattcac agtcagatga tcttgactac cactgcgatt 9840
ggacctgagg ttcagcaata ctccccttta tgtcttttga atacttttca ataaatctgt 9900
ttgtattttc attagttagt aactgagctc agttgccgta atgctaatag cttccaaact 9960
agtgtctctg tctccagtat ctgataaatc ttaggtgttg ctgggacagt tgtcctaaaa 10020
ttaagataaa gcatgaaaat aactgacaca actccattac tggctcctaa ctacttaaac 10080
aatgcattct atcatcacaa atgtgaaaaa ggagttccct cagtggacta accttatctt 10140
ttctcaacac ctttttcttt gcacaatttt ccacacatgc ctacaaaaag tacttatgcg 10200
gccgccataa aagttttgtt actttataga agaaattttg agtttttgtt ttttttaata 10260
aataaataaa cataaataaa ttgtttgttg aatttattat tagtatgtaa gtgtaaatat 10320
aataaaactt aatatctatt caaattaata aataaacctc gatatacaga ccgataaaac 10380
acatgcgtca attttacaca tgattatctt taacgtacgt cacaatatga ttatctttct 10440
agggttaatc tagctgcgtg ttctgcagcg tgtcgagcat cttcatctgc tccatcacgc 10500
tgtaaaacac atttgcaccg cgagtctgcc cgtcctccac gggttcaaaa acgtgaatga 10560
acgaggcgcg ctcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta 10620
cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg 10680
cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg gacgcgccct 10740
gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg 10800
ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg 10860
gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac 10920
ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct 10980
gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 11040
tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta taagggattt 11100
tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 11160
ttaacaaaat attaacgctt acaatttagg tggcactttt cggggaaatg tgcgcggaac 11220
ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 11280
ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 11340
cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 11400
ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 11460
tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 11520
cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca 11580
actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 11640
aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 11700
tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 11760
ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 11820
tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 11880
gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 11940
gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 12000
tattgctgat aaatctggag ccggtgagcg tggttcacgc ggtatcattg cagcactggg 12060
gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat 12120
ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 12180
gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 12240
aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 12300
ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 12360
ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 12420
tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 12480
gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 12540
agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 12600
taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 12660
gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact 12720
gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga 12780
caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg 12840
aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 12900
tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 12960
acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga 13020
ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac 13080
gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcccaatac gcaaaccgcc 13140
tctccccgcg cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa 13200
agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc 13260
tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca 13320
cacaggaaac agctatgacc atgattacgc caagcgcgcc cgccgggtaa ctcacggggt 13380
atccatgtcc atttctgcgg catccagcca ggatacccgt cctcgctgac gtaatatccc 13440
agcgccgcac cgctgtcatt aatctgcaca ccggcacggc agttccggct gtcgccggta 13500
ttgttcgggt tgctgatgcg cttcgggctg accatccgga actgtgtccg gaaaagccgc 13560
gacgaactgg tatcccaggt ggcctgaacg aacagttcac cgttaaaggc gtgcatggcc 13620
acaccttccc gaatcatcat ggtaaacgtg cgttttcgct caacgtcaat gcagcagcag 13680
tcatcctcgg caaactcttt ccatgccgct tcaacctcgc gggaaaaggc acgggcttct 13740
tcctccccga tgcccagata gcgccagctt gggcgatgac tgagccggaa aaaagacccg 13800
acgatatgat cctgatgcag ctagattaac cctagaaaga tagtctgcgt aaaattgacg 13860
catgcattct tgaaatattg ctctctcttt ctaaatagcg cgaatccgtc gctgtgcatt 13920
taggacatct cagtcgccgc ttggagctcc cgtgaggcgt gcttgtcaat gcggtaagtg 13980
tcactgattt tgaactataa cgaccgcgtg agtcaaaatg acgcatgatt atcttttacg 14040
tgacttttaa gatttaactc atacgataat tatattgtta tttcatgttc tacttacgtg 14100
ataacttatt atatatatat tttcttgtta tagatatc 14138
<210> 9
<211> 1069
<212> DNA
<213> Sus scrofa
<400> 9
gtgctgagtc cttttcccat cccacccacc tggagctccc ctcttccagt cctgagccac 60
ttgaactggc ctggtttttg ccatcctgcg ctgccctctc tccggactcg agccactgct 120
gagggcctca ggccagtcca tcctcgtctt gtctctttcg ccctgctctt tccccacctt 180
gagcgctctt aaccagcctg gcccgtgcca cctctactct gccatcgaat gctgccccac 240
tttctcgagt ccgccacttc tcccagcttc accggtaccc actgtttccc ctagtccagg 300
caggtaccac tttccctgag cgtcctcctc ctctctcctg ggcctgtgct gcttcttttc 360
ccgctctctg gcctgggccg tttcttcggc cagcccccga gccttccatg ccctttcctt 420
caggtttctg ctcttcatcc ttggtctctg ccatctgttg ccatgtaagg gtgctctttc 480
ctgagccatc gccctcaagg cgctctgctc ctcaagtgga tgcttccctc gcctggctca 540
cctcctgctc tctctcctgc ccccttcacc tgcgtgccct cctcattctc cctctgtgcc 600
acctctggcc ttgcactgta ggctctctct tggggatgtt tctccttctc cacacacttc 660
tctttcactc tgtcctcttg ctttgtgtgg gcctgcagcg ttaccctttt ttctgggcac 720
actcagagca ccctcctctt tctggttctg ggccacctgt ctgtcctcgg gtcatcttgc 780
tctctctgcc tggatgccct cctgtggctt tgggcagctt ctccctcctt cagagtgcac 840
cgccagttct cctaggcccg gtcacttccc cttcccaggg gacctagagc cctgctaggt 900
cctctctctc cacaacctgg gcccccaaac ctttccaaaa caccttgctt tctgcctcca 960
ttggtcttgt gttccagagc cagagtcact atatgtccca gaaccaggat tccctctggt 1020
tctgagggct tttatcgcat cccctgcctg gctgcagtgg gtctttggg 1069
<210> 10
<211> 260
<212> DNA
<213> Sus scrofa
<400> 10
gacaggccac agaagagcct ctactcctcc ctctgtcccc gaggctgtct ccctcccagt 60
cttcccagct caggccagtc cccaggcctc tcttccctgc cagagcccgt caggttcggt 120
tactttgggg cccagagagg accctgtgaa ggaagcgtgg gtaggggcac gggaatgggg 180
aggatgcctg aagaggcccc cttagccaga agaggagcag aagaggagca ggtacccaga 240
agaggagcag ttcagggaaa 260
<210> 11
<211> 540
<212> DNA
<213> Sus scrofa
<400> 11
aaatacccac gtttattggg acaaaagttg ttagggaaaa tggggcctca gagttatgat 60
tcaagtcata attctttcca tttataattt cactcgagac tctgttaact gattccttgt 120
gtgttgtatc ttactcctca gctcacaatt acttttagtt attcacctta actgtatgaa 180
taacagtgga gaaaaggatt ctaccagaat actctaatta tggttttgag tcccctttcc 240
agactgaaga tttttcagtc tttttgatct gaggtgattt ttcagtcttt tcgatctgag 300
gtgacagtct caagctcctc aattcaccca gtctcttgat acttgtccat ttagggccac 360
caaagctact ttgacttcat actagagagt caattaatga ggccattctc tgatggacag 420
gtgaagcagg caaggtgact atattttgac taaacggtag aaaacagcct gagtgttaac 480
agtgtagcct ataaaaccca gagctgccca ccctgatcta aacttccagg aacataagaa 540
<210> 12
<211> 1009
<212> DNA
<213> Sus scrofa
<400> 12
agtaggtcac atttcagtaa aacctggctt tgtggattga gcatggtctg tctcttcctg 60
gtacttcatt agtcccctaa gtgggatttg ctgagcaaga ctcctcaatt acagaaatac 120
tccagtttag aattctcgca aaggcttttt gtttccacaa gtagaatcta gaaagcaatc 180
tcaagtaaca acagcagaga cctgaatccc aatccatctt tcctgtgtgt cctcttttac 240
ctccttccct ttcatgttga accaacagtc ctttttcagt ctagaagcta gtacgaaaga 300
aatgtacaga tgtaggtacc aagcaaagcc attagccaat aactggtgag atggagctaa 360
gaggaaataa aagtgttcct aagaatagca cagcagaagc tagatccaca gatcttaaaa 420
caattttggt tgagtaagag tagaggcaaa agaggaagct aataatgcag tttttaggag 480
ctaagagcca gataaagggt aagggcagga ggaagtgcta tctcagctaa cgagatacat 540
gaaacaacgg tggaagtcca gcaggcacaa gatgagttga gaagcaatca gggccagaag 600
gatgtgcaag gcctcaaaat aaaaaagcac agggccacag ggaaccttat ggaaattaaa 660
aggaagagga tgcagtcagg agaggaaaaa atagtgctcc ctcccccatg cccaaggaag 720
cagctgagca gccagtactt gggaagttag tagtaataag ttggtaagag ggagttctgt 780
tcgtggctca atggttaaca aatcagacta gaaaccgtga ggttgcgggt ttgatccctg 840
gccttgctca gtgggttaag gatccggcat tgccgtgacc tgtggtgtag gtcacagacg 900
tggctcagtt cccgcattcc tgtggctctg gtgtaggctg gtggctacag ctctgattag 960
acccctaggc tgggaacctc catatgccct ggaagtggcc gtagaaaag 1009
<210> 13
<211> 872
<212> DNA
<213> Sus scrofa
<400> 13
ggatggggac tcatgtgaat tttctaaagg tgctatttaa acggggggca cgagtgccgg 60
ctttggacag ggccgctcgc tctccaccct ttcttcttcc ccctcggccg cctctcaccc 120
cctgaggcct ctctcccccc acgacctcct ctctctcctc tgaaaccctc tcctcctcag 180
ctgcatccca ccctcgtggc ctctctctct ctctgtctgt cctgtgtcct ctctcactgg 240
gtttcagagc acagatgccc aaagcacaaa agcagttttc ccctggggtg ggaggaagca 300
agagactttg tacctatttt gtatgtgtat aataatttga gatgttttta attattttga 360
ttgctggaat aaagcatgtg gaaatgaccc aaaccaatct tgcactggcc tcctgatttc 420
cttccttgga gacggaggga gggggagacc tgggggaggg cgcttggggg ggggtgggct 480
ctcttctttc tgcgctcccc ccccccacct ccaacacctt gacgacccct cctgcttccg 540
cttgcctttc tcaggcttta acactttctc ctcgccctct cagcatgcgc atgcgcgtgc 600
ctctacctcc cccgcacatc ctggcctgcc caccctgaat ggcctggccc agcgatgcca 660
ccaactctct cgctccgtcc acggctgggg aggggggcac tctgcagggt tggggggcac 720
tgggaggctg ggttgggtga gggaggggtg cctgggcccc caccccccag caagttctct 780
ccctaggcga actggagggt cgtctggcct cttgagcctt gttgctggct ctgagctcta 840
ccaagagagt gaccagcagg accgcaccat ca 872
<210> 14
<211> 727
<212> DNA
<213> Sus scrofa
<400> 14
gtggttgctg agactgcgtg ggggcccaag gagacctgga gaaaggaatg cttcctgctc 60
cttcttctgg ggccccagga gagccttccc agggccttgg agaggtgctg tccagggact 120
aaccctgtgc tctaggaagg ctgcaggccc tgaccagctg ggcaggtcct gggtccctcc 180
tggccttcta agttccccaa acatgagacc tctgggtgtg gggtggcctg gggaggtcat 240
tttgcccagg ccctacctcc tgcccattcc taaccctttt taaaaatctg tgcgtcctct 300
tcttccttct tctccctccc ttcccttttc gctcaccctc tgctgctggc ctgagagccg 360
gaggccccca gggggaaggc gactggtctc ctccccagtc tcagggaagg gagacagaga 420
atccaggaag ccagaactca gcagacgaag cacccaggga cctagagatg ggttgaaaag 480
ttgacagctg tcccacctgc ctcccaaggt ctcagggcct aaacctccaa ggcaggaaag 540
gcccctgtcc ctccctgggg tccatagaaa gagggacaag tctgcacgga ccatttgctg 600
taatattaac accttggctg tcattaggta gtcttggctg ttaattatgt cctgtgataa 660
tgtattatta gcacgccgac cacatagggt agggaactgc agctagtaaa caaaagtttg 720
ttcctat 727
<210> 15
<211> 100
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gaaggagcaa acugacaugg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 16
<211> 100
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
ugcagugggu cuuuggggac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 17
<211> 100
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
uuccaggaac auaagaaagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 18
<211> 100
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gcagucucag caaccacuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210> 19
<211> 402
<212> PRT
<213> Caenorhabditis elegans
<400> 19
Met Val Ala His Ser Ser Glu Gly Leu Ser Ala Thr Ala Pro Val Thr
1 5 10 15
Gly Gly Asp Val Leu Val Asp Ala Arg Ala Ser Leu Glu Glu Lys Glu
20 25 30
Ala Pro Arg Asp Val Asn Ala Asn Thr Lys Gln Ala Thr Thr Glu Glu
35 40 45
Pro Arg Ile Gln Leu Pro Thr Val Asp Ala Phe Arg Arg Ala Ile Pro
50 55 60
Ala His Cys Phe Glu Arg Asp Leu Val Lys Ser Ile Arg Tyr Leu Val
65 70 75 80
Gln Asp Phe Ala Ala Leu Thr Ile Leu Tyr Phe Ala Leu Pro Ala Phe
85 90 95
Glu Tyr Phe Gly Leu Phe Gly Tyr Leu Val Trp Asn Ile Phe Met Gly
100 105 110
Val Phe Gly Phe Ala Leu Phe Val Val Gly His Asp Cys Leu His Gly
115 120 125
Ser Phe Ser Asp Asn Gln Asn Leu Asn Asp Phe Ile Gly His Ile Ala
130 135 140
Phe Ser Pro Leu Phe Ser Pro Tyr Phe Pro Trp Gln Lys Ser His Lys
145 150 155 160
Leu His His Ala Phe Thr Asn His Ile Asp Lys Asp His Gly His Val
165 170 175
Trp Ile Gln Asp Lys Asp Trp Glu Ala Met Pro Ser Trp Lys Arg Trp
180 185 190
Phe Asn Pro Ile Pro Phe Ser Gly Trp Leu Lys Trp Phe Pro Val Tyr
195 200 205
Thr Leu Phe Gly Phe Cys Asp Gly Ser His Phe Trp Pro Tyr Ser Ser
210 215 220
Leu Phe Val Arg Asn Ser Glu Arg Val Gln Cys Val Ile Ser Gly Ile
225 230 235 240
Cys Cys Cys Val Cys Ala Tyr Ile Ala Leu Thr Ile Ala Gly Ser Tyr
245 250 255
Ser Asn Trp Phe Trp Tyr Tyr Trp Val Pro Leu Ser Phe Phe Gly Leu
260 265 270
Met Leu Val Ile Val Thr Tyr Leu Gln His Val Asp Asp Val Ala Glu
275 280 285
Val Tyr Glu Ala Asp Glu Trp Ser Phe Val Arg Gly Gln Thr Gln Thr
290 295 300
Ile Asp Arg Tyr Tyr Gly Leu Gly Leu Asp Thr Thr Met His His Ile
305 310 315 320
Thr Asp Gly His Val Ala His His Phe Phe Asn Lys Ile Pro His Tyr
325 330 335
His Leu Ile Glu Ala Thr Glu Gly Val Lys Lys Val Leu Glu Pro Leu
340 345 350
Ser Asp Thr Gln Tyr Gly Tyr Lys Ser Gln Val Asn Tyr Asp Phe Phe
355 360 365
Ala Arg Phe Leu Trp Phe Asn Tyr Lys Leu Asp Tyr Leu Val His Lys
370 375 380
Thr Ala Gly Ile Met Gln Phe Arg Thr Thr Leu Glu Glu Lys Ala Lys
385 390 395 400
Ala Lys
<210> 20
<211> 10511
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
ggcgcgccgg atggggactc atgtgaattt tctaaaggtg ctatttaaac ggggggcacg 60
agtgccggct ttggacaggg ccgctcgctc tccacccttt cttcttcccc ctcggccgcc 120
tctcaccccc tgaggcctct ctccccccac gacctcctct ctctcctctg aaaccctctc 180
ctcctcagct gcatcccacc ctcgtggcct ctctctctct ctgtctgtcc tgtgtcctct 240
ctcactgggt ttcagagcac agatgcccaa agcacaaaag cagttttccc ctggggtggg 300
aggaagcaag agactttgta cctattttgt atgtgtataa taatttgaga tgtttttaat 360
tattttgatt gctggaataa agcatgtgga aatgacccaa accaatcttg cactggcctc 420
ctgatttcct tccttggaga cggagggagg gggagacctg ggggagggcg cttggggggg 480
ggtgggctct cttctttctg cgctcccccc ccccacctcc aacaccttga cgacccctcc 540
tgcttccgct tgcctttctc aggctttaac actttctcct cgccctctca gcatgcgcat 600
gcgcgtgcct ctacctcccc cgcacatcct ggcctgccca ccctgaatgg cctggcccag 660
cgatgccacc aactctctcg ctccgtccac ggctggggag gggggcactc tgcagggttg 720
gggggcactg ggaggctggg ttgggtgagg gaggggtgcc tgggccccca ccccccagca 780
agttctctcc ctaggcgaac tggagggtcg tctggcctct tgagccttgt tgctggctct 840
gagctctacc aagagagtga ccagcaggac cgcaccatca cgcgccccag acccgggcct 900
ggggggcaag tcggggggcg gggggaggtc gggcagggtc ccctgggagg atggggacgt 960
gctgtgcccc tagcggccac cagagggcac caggacacca ctgcggtcgg ctcagcggct 1020
cctgccctgg tcagggggcg ccaggtcctg cccctcctgg ggagggcggg gggcgagaag 1080
ggcgattggc tccggtgccc gtcagtgggc agagcgcaca tcgcccacag tccccgagaa 1140
gttgggggga ggggtcggca attgatccgg tgcctagaga aggtggcgcg gggtaaactg 1200
ggaaagtgat gtcgtgtact ggctccgcct ttttcccgag ggtgggggag aaccgtatat 1260
aagtgcagta gtcgccgtga acgttctttt tcgcaacggg tttgccgcca gaacacaggt 1320
aagtgccgtg tgtggttccc gcgggcctgg cctctttacg ggttatggcc cttgcgtgcc 1380
ttgaattact tccacctggc tgcagtacgt gattcttgat cccgagcttc gggttggaag 1440
tgggtgggag agttcgaggc cttgcgctta aggagcccct tcgcctcgtg cttgagttga 1500
ggcctggcct gggcgctggg gccgccgcgt gcgaatctgg tggcaccttc gcgcctgtct 1560
cgctgctttc gataagtctc tagccattta aaatttttga tgacctgctg cgacgctttt 1620
tttctggcaa gatagtcttg taaatgcggg ccaagatctg cacactggta tttcggtttt 1680
tggggccgcg ggcggcgacg gggcccgtgc gtcccagcgc acatgttcgg cgaggcgggg 1740
cctgcgagcg cggccaccga gaatcggacg ggggtagtct caagctggcc ggcctgctct 1800
ggtgcctggc ctcgcgccgc cgtgtatcgc cccgccctgg gcggcaaggc tggcccggtc 1860
ggcaccagtt gcgtgagcgg aaagatggcc gcttcccggc cctgctgcag ggagctcaaa 1920
atggaggacg cggcgctcgg gagagcgggc gggtgagtca cccacacaaa ggaaaagggc 1980
ctttccgtcc tcagccgtcg cttcatgtga ctccacggag taccgggcgc cgtccaggca 2040
cctcgattag ttctcgagct tttggagtac gtcgtcttta ggttgggggg aggggtttta 2100
tgcgatggag tttccccaca ctgagtgggt ggagactgaa gttaggccag cttggcactt 2160
gatgtaattc tccttggaat ttgccctttt tgagtttgga tcttggttca ttctcaagcc 2220
tcagacagtg gttcaaagtt tttttcttcc atttcaggtg tcgtgacgta cggccaccat 2280
ggttgctcat tctagtgagg gtctctctgc tactgcacca gtgaccggag gagatgtgtt 2340
ggttgatgcg cgggccagtc tggaagaaaa agaagcaccg cgcgatgtca atgcaaatac 2400
taagcaggcc accaccgagg aaccaaggat ccaactgcct accgtggacg cctttaggcg 2460
agccatcccc gctcactgtt ttgaacggga cctggttaaa tccatcagat accttgtcca 2520
agatttcgct gccttgacca tcctgtactt tgccctgcca gctttcgagt actttggcct 2580
gttcggctac ttggtgtgga atatcttcat gggggtgttt ggattcgctt tgtttgtggt 2640
gggccatgac tgtctgcacg gaagtttctc tgataatcag aatctgaacg acttcatagg 2700
ccatatcgcc ttctctcccc tgttctcccc ctatttcccc tggcagaaaa gccataagct 2760
gcaccatgct ttcaccaatc atatcgataa ggaccacgga cacgtttgga tccaagacaa 2820
agattgggaa gcgatgccta gctggaaacg atggtttaat ccaatccctt tcagcgggtg 2880
gctgaagtgg ttccccgtgt atacactgtt tgggttttgt gatggtagtc acttttggcc 2940
atactcatca ctcttcgtga ggaactcaga gcgcgtccag tgcgtcatca gtgggatttg 3000
ctgttgcgtg tgcgcctata tagcactgac catcgcaggg tcttactcca actggttctg 3060
gtattattgg gttccactta gcttttttgg cctgatgctg gtgattgtca cctacctgca 3120
gcacgttgat gatgtggcgg aggtgtacga agctgatgag tggagcttcg tgcgggggca 3180
aactcagacc atcgatcgct actacggtct cggcctggat accactatgc atcatatcac 3240
agacggccac gtagcccatc acttcttcaa taagatcccc cactatcatc ttatcgaagc 3300
cacagaagga gtgaagaaag tattggaacc gttgtccgac acccagtatg gatacaagag 3360
tcaggttaat tacgatttct tcgcccgctt cctctggttt aactacaaac tggattatct 3420
ggttcataag accgcaggga tcatgcagtt tagaacgact ctggaagaga aggccaaggc 3480
aaaatgaggt cttctcgaag accgctagca ttatccctaa tacctgccac cccactctta 3540
atcagtggtg gaagaacggt ctcagaactg tttgtttcaa ttggccattt aagtttagta 3600
gtaaaagact ggttaatgat aacaatgcat cgtaaaacct tcagaaggaa aggagaatgt 3660
tttgtggacc actttggttt tcttttttgc gtgtggcagt tttaagttat tagtttttaa 3720
aatcagtact ttttaatgga aacaacttga ccaaaaattt gtcacagaat tttgagaccc 3780
attaaaaaag ttaaatgaga aacctgtgtg ttcctttggt caacaccgag acatttaggt 3840
gaaagacatc taattctggt tttacgaatc tggaaacttc ttgaaaatgt aattcttgag 3900
ttaacacttc tgggtggaga atagggttgt tttcccccca cataattgga aggggaagga 3960
atatcattta aagctatggg agggtttctt tgattacaac actggagaga aatgcagcat 4020
gttgctgatt gcctgtcact aaaacaggcc aaaaactgag tccttgggtt gcatagaaag 4080
cttcatgttg ctaaaccaat gttaagtgaa tctttggaaa caaaatgttt ccaaattact 4140
gggatgtgca tgttgaaacg tgggttaatt aatctgaggc ggaaagaacc agctgcctta 4200
atataacttc gtataatgta tgctatacga agttattagg tctgaagagg agtttacgtc 4260
cagccaattc tgtggaatgt gtgtcagtta gggtgtggaa agtccccagg ctccccagca 4320
ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca 4380
ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc aaccatagtc 4440
ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc 4500
catggctgac taattttttt tatttatgca gaggccgagg ccgcctctgc ctctgagcta 4560
ttccagaagt agtgaggagg cttttttgga ggcctaggct tttgcaaaaa gctcccggga 4620
gcttgtatat ccattttcgg cggccgcgcc accatgaccg agtacaagcc cacggtgcgc 4680
ctcgccaccc gcgacgacgt ccccagggcc gtacgcaccc tcgccgccgc gttcgccgac 4740
taccccgcca cgcgccacac cgtcgatccg gaccgccaca tcgagcgggt caccgagctg 4800
caagaactct tcctcacgcg cgtcgggctc gacatcggca aggtgtgggt cgcggacgac 4860
ggcgccgcgg tggcggtctg gaccacgccg gagagcgtcg aagcgggggc ggtgttcgcc 4920
gagatcggcc cgcgcatggc cgagttgagc ggttcccggc tggccgcgca gcaacagatg 4980
gaaggcctcc tggcgccgca ccggcccaag gagcccgcgt ggttcctggc caccgtcgga 5040
gtctcgcccg accaccaggg caagggtctg ggcagcgccg tcgtgctccc cggagtggag 5100
gcggccgagc gcgccggggt gcccgccttc ctggagacct ccgcgccccg caacctcccc 5160
ttctacgagc ggctcggctt caccgtcacc gccgacgtcg aggtgcccga aggaccgcgc 5220
acctggtgca tgacccgcaa gcccggtgcc tgagaattcg cgggactctg gggttcgaaa 5280
tgaccgacca agcgacgccc aacctgccat cacgagattt cgattccacc gccgccttct 5340
atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc ctccagcgcg 5400
gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct tataatggtt 5460
acaaataaag caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta 5520
gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgtataccg ctcgactaga 5580
gcttgcggaa cccttaatat aacttcgtat aatgtatgct atacgaagtt attaggtccg 5640
ctggccatct acgagccaaa gactttcaaa tctttggctg ccttggccag taggaggcga 5700
cacgaaggat ttgctgctgc cttgggggat gggaaggaac ctgaaggcat tttttccaga 5760
gtggtgcagt accactgagg actgttgctg tattgattag gaaaagagac agagtaattt 5820
gcagtttgtt tgatttatac tgtggttgct gagactgcgt gggggcccaa ggagacctgg 5880
agaaaggaat gcttcctgct ccttcttctg gggccccagg agagccttcc cagggccttg 5940
gagaggtgct gtccagggac taaccctgtg ctctaggaag gctgcaggcc ctgaccagct 6000
gggcaggtcc tgggtccctc ctggccttct aagttcccca aacatgagac ctctgggtgt 6060
ggggtggcct ggggaggtca ttttgcccag gccctacctc ctgcccattc ctaacccttt 6120
ttaaaaatct gtgcgtcctc ttcttccttc ttctccctcc cttccctttt cgctcaccct 6180
ctgctgctgg cctgagagcc ggaggccccc agggggaagg cgactggtct cctccccagt 6240
ctcagggaag ggagacagag aatccaggaa gccagaactc agcagacgaa gcacccaggg 6300
acctagagat gggttgaaaa gttgacagct gtcccacctg cctcccaagg tctcagggcc 6360
taaacctcca aggcaggaaa ggcccctgtc cctccctggg gtccatagaa agagggacaa 6420
gtctgcacgg accatttgct gtaatattaa caccttggct gtcattaggt agtcttggct 6480
gttaattatg tcctgtgata atgtattatt agcacgccga ccacataggg tagggaactg 6540
cagctagtaa acaaaagttt gttcctatat gcggccgcca taaaagtttt gttactttat 6600
agaagaaatt ttgagttttt gtttttttta ataaataaat aaacataaat aaattgtttg 6660
ttgaatttat tattagtatg taagtgtaaa tataataaaa cttaatatct attcaaatta 6720
ataaataaac ctcgatatac agaccgataa aacacatgcg tcaattttac acatgattat 6780
ctttaacgta cgtcacaata tgattatctt tctagggtta atctagctgc gtgttctgca 6840
gcgtgtcgag catcttcatc tgctccatca cgctgtaaaa cacatttgca ccgcgagtct 6900
gcccgtcctc cacgggttca aaaacgtgaa tgaacgaggc gcgctcactg gccgtcgttt 6960
tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc 7020
cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt 7080
tgcgcagcct gaatggcgaa tgggacgcgc cctgtagcgg cgcattaagc gcggcgggtg 7140
tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg 7200
ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg 7260
ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt 7320
agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt 7380
tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca ctcaacccta 7440
tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat tggttaaaaa 7500
atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg cttacaattt 7560
aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 7620
ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 7680
aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 7740
ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 7800
gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 7860
ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 7920
ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 7980
gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 8040
aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 8100
gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt 8160
aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 8220
caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 8280
tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 8340
acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 8400
gcgtggttca cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 8460
agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga 8520
gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 8580
ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 8640
taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 8700
agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 8760
aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 8820
ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 8880
gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 8940
aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 9000
aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 9060
gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga 9120
aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 9180
aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt 9240
cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag 9300
cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 9360
tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 9420
tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 9480
ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 9540
atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 9600
tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat 9660
gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 9720
cgccaagcgc gcccgccggg taactcacgg ggtatccatg tccatttctg cggcatccag 9780
ccaggatacc cgtcctcgct gacgtaatat cccagcgccg caccgctgtc attaatctgc 9840
acaccggcac ggcagttccg gctgtcgccg gtattgttcg ggttgctgat gcgcttcggg 9900
ctgaccatcc ggaactgtgt ccggaaaagc cgcgacgaac tggtatccca ggtggcctga 9960
acgaacagtt caccgttaaa ggcgtgcatg gccacacctt cccgaatcat catggtaaac 10020
gtgcgttttc gctcaacgtc aatgcagcag cagtcatcct cggcaaactc tttccatgcc 10080
gcttcaacct cgcgggaaaa ggcacgggct tcttcctccc cgatgcccag atagcgccag 10140
cttgggcgat gactgagccg gaaaaaagac ccgacgatat gatcctgatg cagctagatt 10200
aaccctagaa agatagtctg cgtaaaattg acgcatgcat tcttgaaata ttgctctctc 10260
tttctaaata gcgcgaatcc gtcgctgtgc atttaggaca tctcagtcgc cgcttggagc 10320
tcccgtgagg cgtgcttgtc aatgcggtaa gtgtcactga ttttgaacta taacgaccgc 10380
gtgagtcaaa atgacgcatg attatctttt acgtgacttt taagatttaa ctcatacgat 10440
aattatattg ttatttcatg ttctacttac gtgataactt attatatata tattttcttg 10500
ttatagatat c 10511
<210> 21
<211> 225
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60
taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120
ataggctacc aagagagtga ccagcgtttt agagctagaa atagcaagtt aaaataaggc 180
tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225
<210> 22
<211> 225
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60
taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120
atagggcagt ctcagcaacc actgagtttt agagctagaa atagcaagtt aaaataaggc 180
tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225
<210> 23
<211> 102
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ggcuaccaag agagugacca gcguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60
uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102
<210> 24
<211> 102
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gggcagucuc agcaaccacu gaguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60
uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102
<210> 25
<211> 1089
<212> DNA
<213> Sus scrofa
<400> 25
actttgtacc tattttgtat gtgtataata atttgagatg tttttaatta ttttgattgc 60
tggaataaag catgtggaaa tgacccaaac caatcttgca ctggcctcct gatttccttc 120
cttggagacg gagggagggg gagacctggg ggagggcgct tggggggggg tgggctctct 180
tctttctgcg ctcccccccc ccacctccaa caccttgacg acccctcctg cttccgcttg 240
cctttctcag gctttaacac tttctcctcg ccctctcagc atgcgcatgc gcgtgcctct 300
acctcccccg cacatcctgg cctgcccacc ctgaatgtcc tggcccagcg atgccaccaa 360
ctctctcgct ccgtccacgg ctggggaggg gggcactctg cagggttggg gggcactggg 420
aggctgggtt gggtgaggga ggggtgcctg ggcccccacc ccccagcaag ttctctccct 480
aggcgaactg gagggtcgtc tggcctcttg agccttgttg ctggctctga gctctaccaa 540
gagagtgacc agcaggaccg caccatcagt ggttgctgag actgcgtggg ggcccaagga 600
gacctggaga aaggaatgct tcctgctcct tcttctgggg ccccaggaga gccttcccag 660
ggccttggag agttgctgtc cagggactaa ccctgtgctc taggaaggct gcaggccctg 720
accagctggg caggtcctgg gtccctcctg gccttctaag ttccccaaac atgagacctc 780
tgggtgtggg gtggcctggg gaggtcattt tgcccaggcc ctacctcctg cccattccta 840
acccttttta aaaatctgtg cgtcctcttc ttccttcttc tccctccctt cccttttcgc 900
tcaccctctg ctgctggcct gagagccgga ggcccccagg gggaaggcga ctggtctcct 960
ccccagtctc agggaaggga gacagagaat ccaggaagcc agaactcagc agacgaagca 1020
cccagggacc tagagatggg ttgaaaagtt gacagctgtc ccacctgcct cccaaggtct 1080
cagggccta 1089

Claims (15)

1. A breeding method of pigs comprises the following steps:
(1) Integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses omega-3fatty acid desaturase-1;
(2) Preparing the recombinant pig cells obtained in the step (1) into cloned pigs through somatic cell cloning;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
2. A method of making a recombinant porcine cell comprising the steps of: integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses omega-3fatty acid desaturase-1.
3. The method of claim 1 or 2, wherein: the DNA molecule A is integrated into the COL1A1 gene of the genomic DNA of the pig cells.
4. A method as claimed in claim 1, 2 or 3, characterized by: the "integration of the DNA molecule designated DNA molecule A into the genomic DNA of the pig cells" is carried out in the following manner: introducing a DNA molecule named DNA molecule B into a pig cell or introducing a recombinant plasmid with the DNA molecule B into the pig cell; and in the DNA molecule B, the DNA molecule A is provided, an upstream homology arm is arranged at the upstream of the DNA molecule A, and a downstream homology arm is arranged at the downstream of the DNA molecule A, and the upstream homology arm and the downstream homology arm are used for integrating the DNA molecule A into the genome DNA of the pig cells.
5. The method of claim 4, wherein: in the method, a recombinant plasmid with the DNA molecule B, two gRNAs and NCN proteins are introduced into a pig cell together;
the target sequence binding region of the first gRNA is set forth in SEQ ID NO:23, nucleotides 3-22;
the target sequence binding region of the second gRNA is set forth in SEQ ID NO: nucleotides 3 to 22 of 24;
the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein.
6. Recombinant porcine cells produced by the method of any of claims 2 to 5.
7. Use of the recombinant porcine cell of claim 6 in breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining pigs with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
8. A breeding method of pigs comprises the following steps:
preparing a cloned pig from the recombinant pig cell of claim 6 by somatic cell cloning;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
9. A kit comprising the DNA molecule B of claim 4;
the application of the kit is as follows (I) or (II): preparing recombinant porcine cells; (II) breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
10. A kit comprising a recombinant plasmid having the DNA molecule B of claim 4;
the application of the kit is as follows (I) or (II): preparing recombinant porcine cells; (II) breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
11. The kit of claim 9 or 10, wherein: the kit also comprises two gRNAs and NCN proteins; the two gRNAs are two gRNAs recited in claim 5; the NCN protein is the NCN protein described in claim 5.
12. The use of the DNA molecule B as claimed in claim 4 for the preparation of a kit;
the application of the kit is as follows (I) or (II): preparing a recombinant pig cell; (II) breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
13. Use of a recombinant plasmid having the DNA molecule B of claim 4 for the preparation of a kit;
the application of the kit is as follows (I) or (II): preparing recombinant porcine cells; (II) breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining pigs with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
14. Use of a recombinant plasmid having the DNA molecule B of claim 4, two gRNAs, and an NCN protein in the preparation of a kit; the two gRNAs are two gRNAs recited in claim 5; the NCN protein is the NCN protein of claim 5;
the application of the kit is as follows (I) or (II): preparing a recombinant pig cell; (II) breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
15. The use of the DNA molecule B as claimed in claim 4, of the recombinant plasmid having the DNA molecule B as claimed in claim 4, of the kit as claimed in claim 9, of the kit as claimed in claim 10 or of the kit as claimed in claim 11, in the following (I) or (II): preparing recombinant porcine cells; (II) breeding pigs;
the breeding targets are (a) and/or (b) and/or (c) as follows: (a) obtaining a pig with an increased omega-3fatty acid content; (b) obtaining pigs with reduced omega-6 fatty acid content; (c) obtaining pigs with a reduced omega-6/omega-3 ratio.
CN202210545044.7A 2022-05-19 2022-05-19 Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof Pending CN115245144A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210545044.7A CN115245144A (en) 2022-05-19 2022-05-19 Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210545044.7A CN115245144A (en) 2022-05-19 2022-05-19 Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN115245144A true CN115245144A (en) 2022-10-28

Family

ID=83697848

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210545044.7A Pending CN115245144A (en) 2022-05-19 2022-05-19 Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN115245144A (en)

Similar Documents

Publication Publication Date Title
KR102622910B1 (en) Pd-1 homing endonuclease variants, compositions, and methods of use
AU2020286323B2 (en) Co-stimulatory domains for use in genetically-modified cells
KR102604096B1 (en) Gene therapy to treat Wilson&#39;s disease
KR101982360B1 (en) Method for the generation of compact tale-nucleases and uses thereof
US20030177507A1 (en) Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification of anematode gene
CN110467679B (en) Fusion protein, base editing tool and method and application thereof
CN111733174B (en) Isolated nucleic acid molecule and application thereof
KR20210151916A (en) AAV vector-mediated deletion of large mutant hotspots for the treatment of Duchenne muscular dystrophy.
CN112041334A (en) Expression of human FOXP3 in gene-edited T cells
CN116083398B (en) Isolated Cas13 proteins and uses thereof
KR102409420B1 (en) Marker composition for transformed organism, transformed organism and method for transformation
CN114990157B (en) Gene editing system for constructing LMNA gene mutation dilated cardiomyopathy model pig nuclear transplantation donor cells and application thereof
CN115245144A (en) Kit for preparing pig rich in omega-3fatty acid and preparation method and application thereof
CN114958762B (en) Method for constructing nerve tissue specific overexpression humanized SNCA parkinsonism model pig and application
CN114958759B (en) Construction method and application of amyotrophic lateral sclerosis model pig
US20030186291A1 (en) Genetically engineered phiC31-integrase genes
CN114958760B (en) Gene editing technology for constructing Alzheimer disease model pig and application thereof
CN114958758B (en) Construction method and application of breast cancer model pig
KR20220142502A (en) Muscle-specific nucleic acid regulatory elements and methods and uses thereof
RU2781083C2 (en) Options, compositions, and methods for use of homing-endonuclease pd-1
CN114958761B (en) Construction method and application of stomach cancer model pig
CN113260704B (en) Use of CYP4V2 and RdCVF for the manufacture of a medicament
KR102083729B1 (en) Adenylate cyclase-based bacterial strain for the detection of estrogenic compounds and a method for detecting estrogenic compounds using the same
CN115247180A (en) Kit and application thereof in construction of recombinant pig cells of hair follicle tissue specific expression human II type 5 alpha-reductase gene
CN115247186A (en) Gene editing system for constructing AF double-gene mutant atherosclerosis model pig nuclear transplantation donor cells and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination