CN115216555B - Root-knot nematode resistance gene Mg1 and application of closely-linked molecular marker thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly discloses a root-knot nematode resistance gene Mg1, a closely linked molecular marker and application thereof, wherein the protein coded by the root-knot nematode resistance gene Mg1 is shown as SEQ ID NO. 2. Knocking out the gene by using a CRISPR/Cas9 technology or transferring the gene into a sensitive rice variety, and evaluating the disease resistance of the rice variety by using a Mg infection method, so that the gene is finally determined to have resistance to the root knot nematode of the Gramineae family of rice. The molecular marker primer is designed aiming at the gene, so that rice varieties containing the disease-resistant gene Mg1 can be screened. Therefore, the gene can improve the resistance of rice to the root-knot nematode of Gramineae, reduce the damage of the nematode and ensure the grain safety of the rice.

Description

Root-knot nematode resistance gene Mg1 and application of closely-linked molecular marker thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a root-knot nematode resistance gene Mg1, a closely linked molecular marker thereof and application thereof.

Background

The root-knot nematodes are important plant parasitic nematodes, and the diseases belong to soil-borne diseases, and have the characteristics of strong transmissibility and wide transmission range. The economic losses from root knot nematode disease are over 700 billion dollars each year worldwide (Nicol et al 2011), while losses from rice account for 20% (SASSER AND FRECKMAN, 1987). Root-knot nematodes (Meloi dogyne graminicola, abbreviated as Mg) of the poaceae family, also known as rice root-knot nematodes, are one of the most common parasitic nematodes in the rice ecosystem. The rice is widely distributed throughout Asia, south America, north America, europe, africa and the like, but is mainly distributed in subspecies rice planting areas. Because Mg completes the spawning process in the roots of rice, the method can be well adapted to the flooding environment, can hatch into J2 for secondary infection under the condition of proper environment, and can cooperate with other types of biotic and abiotic stress such as drought, thereby causing great threat to high and stable rice yield. And the cultivation mode of the rice is bound to be developed from the traditional rice flooding irrigation mode to the drought rice cultivation mode along with a series of climate and environment problems such as global warming, water resource shortage and the like, and the yield reduction of the rice caused by Mg infection is further aggravated. At present, measures such as flooding, rotation, nematicide application and the like are adopted to reduce the harm of Mg to rice to a certain extent, but the prevention measures have the defects of wasting water and soil resources, poor effect, environmental pollution and the like.

Presently, rice varieties that have been found to be Mg-resistant mainly include african cultivar (o.glaberrima), oryza longifolia (O.l ongistaminata) (Plowright et al, 1999;Soriano et al, 1999;Cabasan et al, 2012), oryza glaberrima (o.glazepost et al, 2019), and indica varieties LD24 (Dimkpa et al, 2016), shenliangyou 1, cliangyou 4418 (Zhan et al, 2018), and the like. In addition, recent studies have found that flower 11 in japonica rice varieties also exhibits a strong resistance to Mg (Zhan et al, 2018). The wild rice variety showing strong resistance to Mg has not been well applied due to the problems of low yield, hybrid sterility, unstable resistance of offspring and the like, so the development of the resistance sites in the conventional indica rice and japonica rice varieties is of great importance. Shrestha et al (2007) constructed a population of genetic maps using two rice varieties, bala and Azucena, found that Mg-resistant QTL s exist on chromosome 1,2, 6, 7, 9 and 11; jena et al (2013) identified QTLs on rice chromosome 3 and 11 that correlated with root number and nematode egg mass number using recombinant inbred lines of Mg-sensitive variety Annapurna and high-resistance variety RAMAKRISHNA; dimkpa et al (2016) found that QTLs associated with the number of rice root knots were present on chromosomes 1,3, 4, 5, 11 and 12 by Mg vaccination experiments on five asian rice subgroups collected worldwide; mhatre et al (2017) performed a BSA analysis on the Mg-resistant variety A bhishek and susceptible variety Bangla Patni hybrid progeny F2 populations of India, presumably with the marker on chromosome 10 of rice (HvSSR-21) associated with the resistance locus in Abhishek; phan et al (2018) reported that flower 11 in Asian rice variety showed hypersensitivity to Mg, and considered that the Mg resistance gene was the dominant, dominant resistance gene. La hari et al (2019) performed resistance locus analysis on two crossing F2 populations of Mg-resistant varieties LD24 and Khao Pahk Maw and sensitive variety Va llone Nano using QTL-seq technology, found that there was a nematode resistance locus near the bottom 23Mbp of chromosome 11 of rice, indicating that the resistance of both varieties was due to introgression at the same locus.

Up to now, the development of Mg resistance locus has not been clearly concluded, and the cloning of resistance gene has not been reported. Therefore, the separation and acquisition of the Mg resistance gene of the rice have important theoretical and application values for the resistance breeding of the rice.

Disclosure of Invention

The invention aims at providing a root-knot nematode resistance gene Mg1 of Gramineae, the CDS sequence of which is shown as SEQ ID NO.1, and the encoded amino acid sequence of which is shown as SEQ ID NO. 2.

Another object of the present invention is to provide the use of the gene encoding the amino acid sequence shown in SEQ ID NO.2 for controlling resistance sensitivity of Meloidogyne incognita in rice.

Still another object of the present invention is to provide a molecular marker primer related to the resistance trait of the root-knot nematode of the poaceae family of rice, wherein the molecular marker primer is: WXM1-F GAGGAGTGGTCCTTTGTTGAAG and WXM1-R atagctgctcc aaaccacccaac; and/or CR24-F TCGTCATGTGGTTTCTGGC and CR24-R: TGTTGCAGTTGCTTCTGC.

The final object of the invention is to provide the application of the molecular marker primer related to the resistance trait of the root-knot nematode of the rice poaceae.

In order to achieve the above object, the present invention adopts the following technical measures:

the applicant carries out Mg inoculation resistant variety screening experiments on 209 varieties from American Ministry of agriculture and conventional cultivated rice and wild rice, takes one of the nematode-resistant japonica rice varieties ZH11 as a research object, constructs F2 mapping populations with nematode-sensitive indica rice varieties Le Hui and Minghui 63 (MH 63) respectively, adopts a conventional map-based cloning method to locate Mg resistant genes in ZH11 between two makers of MH15 and MH20, finally obtains cDNA sequences of the Mg 1 genes of the root-knot nematode resistant genes of Gramineae, the cDNA sequences are shown as SEQ ID NO.1, and the coded proteins are shown as SEQ ID NO.2

The protection scope of the invention comprises:

The application of the gene encoding the amino acid sequence shown in SEQ ID NO.2 in controlling the resistance sensitivity of the root-knot nematode of the rice poaceae, namely, the expression of the Mg1 gene is controlled by using the prior art, such as knockout, silencing or over-expression and the like, so as to realize the control of the resistance sensitivity of the rice.

Specifically, mutation of the disease-resistant variety Mg1 gene by gene editing can result in resistance loss; over-expression of the gene can make rice produce specific disease-resistant response to diseases caused by Mg.

For the cloned novel genes of the invention, the applicant designed two molecular marker primers, respectively: WXM1-F gag gagtggtcctttgttgaag and WXM1-R ATAGCTGCTCCAAACCACCCAAC; and/or CR24-F TCGTCATGTGGTTTCTGGC and CR24-R: TGTTGCAGTTGCTTCTGC.

The primer or the combination of the primer and the primer can be used for screening resistant rice varieties.

The rice containing the gene for encoding the amino acid sequence shown in SEQ ID NO.2 can also be used for breeding of rice against the root-knot nematode of Gramineae.

Compared with the prior art, the invention has the following beneficial effects:

The cloned root-knot nematode resistance gene Mg1 of the Gramineae is transferred into a disease-sensitive plant body, which is helpful for obtaining a new disease-resistant plant. Crossing rice with the resistance gene Mg1 with other susceptible rice produces resistant progeny plants. The cloned disease-resistant gene can be transferred and utilized among different species, so that the difficulty of distant hybridization in traditional disease-resistant breeding can be overcome. Multiple disease resistance genes can be accumulated in plants by transgenic techniques. In addition, molecular marker is utilized for auxiliary breeding, so that the breeding period can be shortened, and the breeding efficiency of the variety can be improved.

Drawings

FIG. 1 is a schematic diagram showing the identification of resistance of a root knot nematode resistant rice variety of Gramineae;

Wherein: in A, nip is a Mg sensitive variety, MC162, MC174 and ZH11 are Mg resistant varieties; b is the average root knot number of a single plant of the Mg-resistant rice variety and the average Mg number of different development stages in the root 15 days after Mg inoculation. J2: second instar larvae; j3: three-instar larvae; j4/females: four-year old or mature females.

FIG. 2 is a graph showing the identification of the Mg resistance of a plant of the mutant of the Gramineae root-knot nematode resistance gene Mg1 gene knockout.

Wherein: a is a cDNA schematic diagram of the amplified resistance gene Mg 1; b is root knot number statistics; c is the root phenotype of sensitive variety Nip, resistant variety ZH11 and Mg1 homozygous knockout mutant after M g days of inoculation; d is the phenotype of root acid fuchsin after staining, and the Mg1 knockout mutation shows a remarkable sensitive phenotype.

FIG. 3 is a diagram showing the identification of resistance by introducing Mg1 into a sensitive variety Nip by genetic transformation.

Wherein: a is Mg1 fragment transferred into an over-expression vector pCAMBIA 1300; B-D panels are root phenotypes, root numbers and RT-PCR results of sensitive varieties Nip, resistant varieties ZH11 and Mg1 over-expression mutants Mg1-7 and Mg1-9 after 15 days of Mg inoculation; mg1 overexpressing mutations exhibited a pronounced resistance phenotype.

FIG. 4 shows that backcrossing of ZH11 with Huazhan resulted in Mg-resistant BC3F4.

FIG. 5 shows the molecular characterization of different rice varieties using two pairs of molecular markers, respectively.

Detailed Description

The technical scheme of the invention is conventional in the field unless specifically stated otherwise, and the reagents or materials are commercially available if not specifically stated otherwise.

The procedure of the Mg resistance experiment in the examples of the present invention was referred to (Nahar et al, 2011;Dimkpa et al, 2015;

Yimer et al.,2018；)

Example 1:

obtaining the resistance gene Mg1 of the root-knot nematode of the Gramineae:

The applicant carries out Mg inoculation resistance variety screening experiments on 209 varieties from the United states department of agriculture and conventional cultivated rice and wild rice, screens 4 varieties ZH11, MC79, MC162 and MC174 (figure 1), takes one of the varieties ZH11 as a research object, constructs F2 mapping groups with a nematode-sensitive indica type rice variety Le Hui and Minghui 63 (MH 63) respectively, adopts a traditional map cloning method, positions the Mg resistance gene in ZH11 between two makers of MH15 and MH20, takes the total RNA reverse transcription product of ZH11 root tips as a template, designs 5 'and 3' RACE primers according to gene prediction results, obtains 5 'end and 3' end sequences of candidate genes, determines the transcription start site and the termination site of Mg1, and splices full-length cDNA sequences (figure 2A), wherein the cDNA sequences are shown as SEQ ID NO.1, and the coded proteins are shown as SEQ ID NO. 2.

Example 2:

application of resistance gene Mg1 in controlling sensitivity of rice to root-knot nematodes:

And constructing a rice pseudo-gramineous root-knot nematode resistance candidate Mg1 gene knockout strain by using a CRISPR/Cas9 system. Two target sites were selected in the CDS region of M g, and the gRNA sequences were: CTCAACCGCAGACATCATAA and AG GTGTTTTACAAACTTCTC. The PTG fragment was constructed by concatenating two tR NA-gRNAs according to Golden Gate ligation (ENGLER ET AL, 2008) (Xie et al 2015). The assembled PTG fragment is amplified by PCR and digested by FokI, and then is connected to a BsaI cloning site in pRGEB vectors by a T4 DNA ligase, so that the Mg1 knockout expression vector is obtained.

The Mg1 gene knockout expression vector is introduced into agrobacterium tumefaciens EHA105, and the obtained positive clone carries out genetic transformation on ZH 11.

Mg resistance verification is carried out by utilizing T2 generation positive homozygous gene knockout mutants Mg1-7 and Mg1-9 (the identification primer F primer is GCCTTTCAC TTTCATCCTGCT and the R primer is GTACAAGTGAGCCAGCCAAATC), and the method mainly comprises the steps of observing root phenotype and counting root knot number.

As a result, it was found that the Mg1 knockout mutant forms a large number of root knots at the root after two weeks of Mg inoculation, and root growth was significantly hindered compared to wild-type ZH11, consistent with the sensitive variety Nip phenotype (B, C in FIG. 2). In addition, after staining the roots of the inoculated wild-type ZH11 and mutant by acid fuchsin, it was found that the root knot of the Mg1 knockout mutant was aggregated into a large number of mature Mg and egg masses, showing a distinct disease-sensitive phenotype (D in fig. 2), indicating that Mg1 gene in rice was knocked out, and Mg-sensitive rice could be obtained, and the Mg1 gene was related to resistance of rice.

Example 3:

application of resistance gene Mg1 in controlling sensitivity of rice to root-knot nematodes:

1. construction and transformation of genetic transformation vectors

And constructing an Mg1 gene overexpression vector. The vector used is pCAMBIA2300, salI and XbaI are adopted to cleave the vector, according to the result of RACE, the DNA fragment containing the self promoter in the whole length of Mg1 is directly amplified by adopting a PCR method, and the amplified fragment is connected into the vector by utilizing a Gibson assembly cloning method. After sequencing verification, the obtained vector is the Mg1 gene over-expression vector (A in FIG. 3). The strain is transferred into agrobacterium EHA105, and genetic transformation of NiP is carried out after positive cloning is obtained.

2. Transgenic functional verification

After the transgenic plant is obtained by the Mg1 gene over-expression transformation vector, the T2 generation is singly harvested, and the antibiotic G418 (the concentration is 150 Mg/L) and the detection primer (the F primer is TCTTCACTGTGGGTCCCAAGG and the R primer is CCAGG CTTTACACTTTATGC) are utilized to screen the Mg1 transgenic positive homozygous lines 40-5 and 21-6 for resistance identification.

As shown in the identification results of B and C in FIG. 3, after 15 days of Mg inoculation, the root of the sensitive variety Nip has a large number of root knots, the average number of root knots is 24.1, and the transgenic positive homozygous lines 40-5 and 21-6 show obvious resistance to Mg, and the average number of root knots is 2.5 and 3.4 respectively, so that obvious resistance phenotype is shown. In addition, the transgenic line 40-5 has stronger resistance than 21-6, and the expression level of Mg1 at the root of the transgenic line 40-5 is slightly higher than 21-6 according to the RT-PCR result (GCTCGAAATGTTGATCTTCAA for the F primer and GGCAGTTCACAAGTTGCAACTCAT for the R primer). Therefore, this experiment further confirmed that the Mg1 gene has an anti-Mg function. Therefore, the rice Mg-resistant gene Mg1 can be applied to rice resistance breeding.

Example 4:

Use of a variety containing a resistance gene Mg1 for the preparation of a resistant hybrid variety:

the method comprises the steps of selecting a variety ZH11 containing a resistance gene Mg1 and a sensitive variety Huazhan without Mg1 as parents for hybridization, using Huazhan as a recurrent parent for backcrossing after F1 generation is obtained, screening resistant plants after inoculating Mg in the backcrossing offspring, and finally obtaining a backcrossing third-generation Mg1 homozygous offspring F4 generation, namely BC3F4, and showing an obvious resistance phenotype after inoculating Mg (figure 4). The colony not only introduces the resistance gene Mg1 of the root-knot nematode of the rice, but also retains the excellent agronomic characters of the rice variety Huazhan, and can be applied to Mg resistance breeding.

Example 5:

application of resistance gene Mg1 molecular marker primer in rice resistance breeding:

compared with the homologous gene in the known sensitive variety Nip, two MboI cleavage sites exist between the Mg1 intron region markers WXM1, after MboI cleavage, the fragment of the resistant variety ZH11 can be cut into three sections, namely 39bp, 190bp and 258bp, and the strips with the lengths of 190bp and 285bp can be distinguished in 3% agarose gel, while the sensitive variety has the fragment length of 487bp because of the absence of MboI cleavage sites in the section. The primers designed for the marker WXM1 were: WXM1-F GAGGAGTGGTCCTTTGTTGAAG and WXM1-R ATAGCTGCTCCAAACCACCCAAC.

In addition, CR24 mark exists near the Mg1 gene, the fragment length of the amplified Mg resistant variety is 423bp, and the sensitive variety is 541bp. Primers designed for marker CR24 were: CR24-F: TCGTCATGTGGTTTCTGGC and CR24-R: t gttgcagttgcttctgc.

1. Materials and methods

1.1 Materials: comprises a core germplasm resource (Wang et al, 2016) from a previous study and a wild rice variety (Dimkpa et al, 2015) from a conventional cultivar of rice which has been disclosed. Mg resistant varieties ZH11, LD24, 174, 162, KPM (rice root-knot nematode resistant gene Mg 1), MC79 (no rice root-knot nematode resistant gene Mg 1); mg sensitive rice varieties Huazhan, TP309, nip, MC111, MC112, ta Mao Tsao, koshihikari, R498, kasalath, MH63.

1.2 Method

Extracting genome DNA of rice samples by CTAB extraction method. Sample DNA was amplified with primers WXM1 and CR24, respectively. The 10. Mu.l reaction system comprises: taq DNA Polymerase (5U/ul) 0.1 μl;10×Taq Buffer 1 μl; dNTP (10 mM); 10 mu.l each of the mu.M m F/R primers; 50ng of DNA template; ddH2O was added to 10. Mu.l. The amplification reaction was performed on a PCR instrument: 94 ℃ for 5min;94℃for 30s,55℃for 30s,72℃for 60s,39 cycles; and at 72℃for 5min. The amplified product of WXM1 is digested with MboI for 3 hours, separated by 3% agarose gel, and analyzed after electrophoresis; the amplified product of CR24 was separated with 3% agarose gel and directly analyzed after electrophoresis.

2. Results: the above method was used to amplify 16 rice varieties, respectively. As a result, as shown in FIG. 5, it was revealed that resistant varieties ZH11, LD24, 174, 162, K PM containing Mg1 and resistant varieties MC79 containing no Mg1, as well as other sensitive varieties, could be distinguished by using both of the WX M1 and CR24 molecular markers. Therefore, the molecular marking method provided by the invention can accurately screen out the resistant rice variety containing Mg1, thereby greatly improving the breeding efficiency.

SEQUENCE LISTING

<110> University of agriculture in China

<120> Application of root-knot nematode resistance gene Mg1 and closely linked molecular markers thereof

<160> 14

<170> PatentIn version 3.1

<210> 1

<211> 3102

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

atggcaacaa tagtagacac attggttgga tcatgcatca ataagttgca agcgatcatt 60

acagacaaga caatactcat tttaggggta aaagatgagc ttgaagaact gcaacgaaga 120

acaaacgtca taagatcttc tcttcaggat gctgaggcaa ggaggatgga agattcagta 180

gttgaaaaat ggcttgacca gctaagagat gttatgtatg atgttgatga tattattgat 240

ttggctagat ttaaaggaag tgtcctactg cctgactatc ctatgtcatc gtcaaggaaa 300

tcaactgctt gcagtggcct ttcactttca tcctgctttt ctaatattcg tatacgtcat 360

gaagttgctg taaaaattag aagcctgaac aaaaagatcg ataacatttc aaaggatgag 420

gtatttttaa aactcaaccg cagacatcat aatggaagtg gttcagcatg gacaccaata 480

gaaagctcca gcctagttga acccaacctt gtgggcaagg aggtcatacg tgcttgcaga 540

gaagtggtgg atttggtgct tgcacacaag aaaaagaatg tttacaagct tgctattgtt 600

ggaacaggag gagttggtaa gacaacacta gctcagaaaa tattcaatga taaaaaatta 660

gaagggagat ttgaccatca tgcatgggct tgtgtttcca aggagtattc tagggattct 720

cttttgagac aagttcttcg taatatggga attcgatatg agcaagatga atcagttcca 780

gagctccaaa gaaagattaa atcacacatt gcaaataaaa gtttttttct ggtgttggat 840

gatgtgtgga actctgaagc atggacagat ttactaagca ctccacttca tgcagccgcc 900

acaggagtaa ttctaataac tactcgagat gacactattg ctagagtaat tggggtggac 960

cacactcata gggttgattt gatgtcagcc gatgtaggat gggagttact ttggaggagc 1020

atgaacatca aagaagagaa acaagtgaaa aatctacggg acacaggtat cgagattgtc 1080

cgcaaatgtg gtggcctacc tcttgcaatc agggctattg ccaaagtctt agcaagcctg 1140

caagatcaaa cagagaatga gtggagacag atattgggga aaaatgcctg gtccatgagc 1200

aaacttcctg atgaattaaa tggtgcttta tatctgagtt atgaagtgct gccgcaccag 1260

ctgaagcaat gttttcttta ttgtgcactt ttccctgaag atgcaaccat tttctgtggt 1320

gatcttacta ggatgtgggt ggctgaaggc tttatagatg agcaagaagg ccaattacta 1380

gaagacacag cagagaggta ttatcatgag ttgatccatc ggaacttgct ccaaccagat 1440

ggtttatatt ttgaccacag caggtgcaag atgcatgatc tcttaaggca acttgcttct 1500

tatttgtcaa gagaagaatg ttttgttgga gacccagagt cactagggac taatactatg 1560

tgcaaagtac ggcgtatttc agttgtcact gagaaggaca tagtggtgtt acctagcatg 1620

gacaaggatc aatataaagt gaggtgtttt acaaacttct ctgggaagtc agcaagaatt 1680

gataattcac ttttcaagag acttgtatgt cttcgcattt tggatttggc tggctcactt 1740

gtacatgaca tcccaggtgc gattggaaat ttgatttatc tgcggttgct cgatcttgac 1800

aggacaaata tatgttctct cccagaggcc attggctccc ttcaaagcct tcaaatattg 1860

aatttgcagg ggtgtgaatc tttgcgcaga cttcctttgg caacaactca actatgcaat 1920

ttgaggcggc ttggtcttgc tggtactcca ataaaccagg ttccaaaagg gataggaaga 1980

ctgaaatttc tcaatgattt agaaggattt cctatcggtg gtggaaatga caataccaaa 2040

atacaagatg gatggaattt ggaagagttg ggtcatcttt cacagttgag gtgtcttgat 2100

atgataaaat tggagagagc tactccttgc agcagtacag acccatttct actatcagag 2160

aaaaagcatc tcaaagttct gaatctacac tgcactgaac agacagatga agcatattca 2220

gaggaaggca ttagcaatgt tgagaagatc tttgagaagc tagaacctcc acacaactta 2280

gaagatcttg ttattgggga tttctttggg cgaaggttcc ccacctggct tggtagtacc 2340

catttgtctt cagtgaaata cgtgctcctc atagattgca aatcttgtgt gcatcttccc 2400

ccaatcggac agctaccaaa cttgaaatac ctaaaaatta ttggagcaag tgcaatcacc 2460

aagattggac ccgaatttgt tggctgctgg gagggtaatc tcagatccac agaggcagtt 2520

gctttcccca agctcgaaat gttgatcttc aaggagatgc ccaactggga ggagtggtcc 2580

tttgttgaag aagaagaagt gcaggaggaa gcagctgcag cagccaagga agggggagag 2640

gatggaattg ctgcttcgaa gcaaaagggg gaggaagccc cgtctccaac tccaaggtcg 2700

tcgtggctgc tgccttgttt gaatgagttg caacttgtga actgccccaa gctgagggct 2760

ctcccaccac agcttggaca gcaggccacc aacttgaatg agatccttat aagagacaca 2820

agatacttga agacggtgga ggacctccca ttcctctctg gtttccttca agttgaagga 2880

tgtgaaggac tggagagggt ctccaacctt ccccaagtga gagagctgtt tgtaaatgaa 2940

tgcccgaatt tgaggcatgt cgaggagttg ggtggtttgg agcagctatt gctggatgaa 3000

ggtatgcagg agatctcttc actgtgggtc ccaaggcttc aggagcaaca ccgccagctc 3060

catggagatg agcatgagct ggaggtcatc gagtggctgt ga 3102

<210> 2

<211> 1033

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

Met Ala Thr Ile Val Asp Thr Leu Val Gly Ser Cys Ile Asn Lys Leu

1 5 10 15

Gln Ala Ile Ile Thr Asp Lys Thr Ile Leu Ile Leu Gly Val Lys Asp

20 25 30

Glu Leu Glu Glu Leu Gln Arg Arg Thr Asn Val Ile Arg Ser Ser Leu

35 40 45

Gln Asp Ala Glu Ala Arg Arg Met Glu Asp Ser Val Val Glu Lys Trp

50 55 60

Leu Asp Gln Leu Arg Asp Val Met Tyr Asp Val Asp Asp Ile Ile Asp

65 70 75 80

Leu Ala Arg Phe Lys Gly Ser Val Leu Leu Pro Asp Tyr Pro Met Ser

85 90 95

Ser Ser Arg Lys Ser Thr Ala Cys Ser Gly Leu Ser Leu Ser Ser Cys

100 105 110

Phe Ser Asn Ile Arg Ile Arg His Glu Val Ala Val Lys Ile Arg Ser

115 120 125

Leu Asn Lys Lys Ile Asp Asn Ile Ser Lys Asp Glu Val Phe Leu Lys

130 135 140

Leu Asn Arg Arg His His Asn Gly Ser Gly Ser Ala Trp Thr Pro Ile

145 150 155 160

Glu Ser Ser Ser Leu Val Glu Pro Asn Leu Val Gly Lys Glu Val Ile

165 170 175

Arg Ala Cys Arg Glu Val Val Asp Leu Val Leu Ala His Lys Lys Lys

180 185 190

Asn Val Tyr Lys Leu Ala Ile Val Gly Thr Gly Gly Val Gly Lys Thr

195 200 205

Thr Leu Ala Gln Lys Ile Phe Asn Asp Lys Lys Leu Glu Gly Arg Phe

210 215 220

Asp His His Ala Trp Ala Cys Val Ser Lys Glu Tyr Ser Arg Asp Ser

225 230 235 240

Leu Leu Arg Gln Val Leu Arg Asn Met Gly Ile Arg Tyr Glu Gln Asp

245 250 255

Glu Ser Val Pro Glu Leu Gln Arg Lys Ile Lys Ser His Ile Ala Asn

260 265 270

Lys Ser Phe Phe Leu Val Leu Asp Asp Val Trp Asn Ser Glu Ala Trp

275 280 285

Thr Asp Leu Leu Ser Thr Pro Leu His Ala Ala Ala Thr Gly Val Ile

290 295 300

Leu Ile Thr Thr Arg Asp Asp Thr Ile Ala Arg Val Ile Gly Val Asp

305 310 315 320

His Thr His Arg Val Asp Leu Met Ser Ala Asp Val Gly Trp Glu Leu

325 330 335

Leu Trp Arg Ser Met Asn Ile Lys Glu Glu Lys Gln Val Lys Asn Leu

340 345 350

Arg Asp Thr Gly Ile Glu Ile Val Arg Lys Cys Gly Gly Leu Pro Leu

355 360 365

Ala Ile Arg Ala Ile Ala Lys Val Leu Ala Ser Leu Gln Asp Gln Thr

370 375 380

Glu Asn Glu Trp Arg Gln Ile Leu Gly Lys Asn Ala Trp Ser Met Ser

385 390 395 400

Lys Leu Pro Asp Glu Leu Asn Gly Ala Leu Tyr Leu Ser Tyr Glu Val

405 410 415

Leu Pro His Gln Leu Lys Gln Cys Phe Leu Tyr Cys Ala Leu Phe Pro

420 425 430

Glu Asp Ala Thr Ile Phe Cys Gly Asp Leu Thr Arg Met Trp Val Ala

435 440 445

Glu Gly Phe Ile Asp Glu Gln Glu Gly Gln Leu Leu Glu Asp Thr Ala

450 455 460

Glu Arg Tyr Tyr His Glu Leu Ile His Arg Asn Leu Leu Gln Pro Asp

465 470 475 480

Gly Leu Tyr Phe Asp His Ser Arg Cys Lys Met His Asp Leu Leu Arg

485 490 495

Gln Leu Ala Ser Tyr Leu Ser Arg Glu Glu Cys Phe Val Gly Asp Pro

500 505 510

Glu Ser Leu Gly Thr Asn Thr Met Cys Lys Val Arg Arg Ile Ser Val

515 520 525

Val Thr Glu Lys Asp Ile Val Val Leu Pro Ser Met Asp Lys Asp Gln

530 535 540

Tyr Lys Val Arg Cys Phe Thr Asn Phe Ser Gly Lys Ser Ala Arg Ile

545 550 555 560

Asp Asn Ser Leu Phe Lys Arg Leu Val Cys Leu Arg Ile Leu Asp Leu

565 570 575

Ala Gly Ser Leu Val His Asp Ile Pro Gly Ala Ile Gly Asn Leu Ile

580 585 590

Tyr Leu Arg Leu Leu Asp Leu Asp Arg Thr Asn Ile Cys Ser Leu Pro

595 600 605

Glu Ala Ile Gly Ser Leu Gln Ser Leu Gln Ile Leu Asn Leu Gln Gly

610 615 620

Cys Glu Ser Leu Arg Arg Leu Pro Leu Ala Thr Thr Gln Leu Cys Asn

625 630 635 640

Leu Arg Arg Leu Gly Leu Ala Gly Thr Pro Ile Asn Gln Val Pro Lys

645 650 655

Gly Ile Gly Arg Leu Lys Phe Leu Asn Asp Leu Glu Gly Phe Pro Ile

660 665 670

Gly Gly Gly Asn Asp Asn Thr Lys Ile Gln Asp Gly Trp Asn Leu Glu

675 680 685

Glu Leu Gly His Leu Ser Gln Leu Arg Cys Leu Asp Met Ile Lys Leu

690 695 700

Glu Arg Ala Thr Pro Cys Ser Ser Thr Asp Pro Phe Leu Leu Ser Glu

705 710 715 720

Lys Lys His Leu Lys Val Leu Asn Leu His Cys Thr Glu Gln Thr Asp

725 730 735

Glu Ala Tyr Ser Glu Glu Gly Ile Ser Asn Val Glu Lys Ile Phe Glu

740 745 750

Lys Leu Glu Pro Pro His Asn Leu Glu Asp Leu Val Ile Gly Asp Phe

755 760 765

Phe Gly Arg Arg Phe Pro Thr Trp Leu Gly Ser Thr His Leu Ser Ser

770 775 780

Val Lys Tyr Val Leu Leu Ile Asp Cys Lys Ser Cys Val His Leu Pro

785 790 795 800

Pro Ile Gly Gln Leu Pro Asn Leu Lys Tyr Leu Lys Ile Ile Gly Ala

805 810 815

Ser Ala Ile Thr Lys Ile Gly Pro Glu Phe Val Gly Cys Trp Glu Gly

820 825 830

Asn Leu Arg Ser Thr Glu Ala Val Ala Phe Pro Lys Leu Glu Met Leu

835 840 845

Ile Phe Lys Glu Met Pro Asn Trp Glu Glu Trp Ser Phe Val Glu Glu

850 855 860

Glu Glu Val Gln Glu Glu Ala Ala Ala Ala Ala Lys Glu Gly Gly Glu

865 870 875 880

Asp Gly Ile Ala Ala Ser Lys Gln Lys Gly Glu Glu Ala Pro Ser Pro

885 890 895

Thr Pro Arg Ser Ser Trp Leu Leu Pro Cys Leu Asn Glu Leu Gln Leu

900 905 910

Val Asn Cys Pro Lys Leu Arg Ala Leu Pro Pro Gln Leu Gly Gln Gln

915 920 925

Ala Thr Asn Leu Asn Glu Ile Leu Ile Arg Asp Thr Arg Tyr Leu Lys

930 935 940

Thr Val Glu Asp Leu Pro Phe Leu Ser Gly Phe Leu Gln Val Glu Gly

945 950 955 960

Cys Glu Gly Leu Glu Arg Val Ser Asn Leu Pro Gln Val Arg Glu Leu

965 970 975

Phe Val Asn Glu Cys Pro Asn Leu Arg His Val Glu Glu Leu Gly Gly

980 985 990

Leu Glu Gln Leu Leu Leu Asp Glu Gly Met Gln Glu Ile Ser Ser Leu

995 1000 1005

Trp Val Pro Arg Leu Gln Glu Gln His Arg Gln Leu His Gly Asp

1010 1015 1020

Glu His Glu Leu Glu Val Ile Glu Trp Leu

1025 1030

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

gaggagtggt cctttgttga ag 22

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

atagctgctc caaaccaccc aac 23

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

tcgtcatgtg gtttctggc 19

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

tgttgcagtt gcttctgc 18

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

ctcaaccgca gacatcataa 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

aggtgtttta caaacttctc 20

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

gcctttcact ttcatcctgc t 21

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

gtacaagtga gccagccaaa tc 22

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 11

tcttcactgt gggtcccaag g 21

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 12

ccaggcttta cactttatgc 20

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 13

gctcgaaatg ttgatcttca a 21

<210> 14

<211> 24

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 14

ggcagttcac aagttgcaac tcat 24

Claims (7)

1. A root-knot nematode resistance protein has a protein sequence shown in SEQ ID NO. 2.

2. A gene encoding the protein shown in SEQ ID NO. 2.

3. The gene according to claim 2, wherein the gene sequence is shown in SEQ ID NO. 1.

4. Use of the protein of claim 1 or the gene of claim 2 for controlling sensitivity of rice to root knot nematodes.

5. Use of the protein of claim 1 or the gene of claim 2 to increase the expression level in the preparation of root-knot nematode resistant rice.

6. Use of the protein of claim 1 or the gene of claim 2 in the preparation of root-knot nematode-sensitive rice by knockdown or knockdown of expression level.

7. An application of a molecular marker primer closely related to the resistance of rice root-knot nematodes in breeding of rice root-knot nematode resistance, wherein the primer is as follows: WXM1-F GAGGAGTGGTCCTTTGTTGAAG and WXM1-R ATAGCTGCTCCAAACCACCCAAC.